JOURNAL OF PLANKTON RESEARCH

j

29

VOLUME

j

NUMBER

4

j

PAGES

391 – 399

j

2007

Nodularia sp. nifH gene transcripts in the Baltic Sea proper ˚ KE HAGSTRO ¨ RSTIN H. BOSTRO ¨ M, LASSE RIEMANN*, ULLA LI ZWEIFEL AND A ¨M KJA NATURAL SCIENCES, KALMAR UNIVERSITY, S-391

82 KALMAR, SWEDEN

*CORRESPONDING AUTHOR: [email protected] Received December 13, 2006; accepted in principle January 11, 2007; accepted for publication January 18, 2007; published online January 26, 2007 Communicating editor: K.J. Flynn

I N T RO D U C T I O N Eutrophication poses a significant threat to the coastal environment, particularly in semi-enclosed seas with slow turn over, e.g. the Baltic Sea. Although costly measures are taken to decrease the anthropogenic nitrogen input that may stimulate microbial growth, N2-fixation may impede such efforts. In the Baltic Proper, plankton production in summer is often limited by nitrogen (Grane´li et al., 1990). The combination of high water temperature, calm weather conditions and dissolved inorganic nitrogen depletion regularly trigger massive cyanobacterial blooms, mainly of the two filamentous heterocyst-forming genera Aphanizomenon and Nodularia (Stal et al., 2003 and references herein). These blooms are problematic for esthetic reasons and hamper recreational activities because of their potential toxicity (Sivonen et al., 1989); however, they also contribute with an estimated yearly nitrogen input almost as large as the entire riverine load and twice the atmospheric load into the Baltic Sea proper (Larsson et al., 2001). Research on diazotrophic organisms in the Baltic Sea has focused on physical and chemical factors regulating

growth and N2-fixation by cyanobacteria (Kononen et al., 1996; Lehtima¨ki et al., 1997; Stal et al., 1999; Ohlendieck et al., 2000; Staal et al., 2001; Moisander et al., 2002; Stal et al., 2003). In an attempt to elucidate the importance of cyanobacterial N2-fixation for the nitrogen budget in the Baltic Sea, Larsson et al. (Larsson et al., 2001) found for 1998 that up to 5 –10 folds more nitrogen was being fixed by diazotrophs than incorporated into filamentous cyanobacterial biomass. They speculated that this discrepancy could be due to other organisms fixing nitrogen, such as unicellular cyanobacteria and heterotrophic bacteria (Larsson et al., 2001). Indeed, recently we successfully isolated heterotrophic bacteria capable of acetylene reduction (a proxy for active N2-fixation) from the Baltic Proper (Bostro¨m et al., 2007). Further, nifH genes (coding for dinitrogenase reductase) from Proteobacteria have been found in several oceans (e.g., Zehr et al., 1998; Bird et al., 2005; Church et al., 2005a,b). Hence, heterotrophic bacteria are likely to contribute to pelagic N2-fixation. The two aims of the present study were to identify the predominant active N2-fixing organisms in surface water

doi:10.1093/plankt/fbm019, available online at www.plankt.oxfordjournals.org # The Author 2007. Published by Oxford University Press. All rights reserved. For permissions, please email: [email protected]

Downloaded from http://plankt.oxfordjournals.org/ by guest on April 11, 2016

Nitrogen fixation contributes significantly to the nitrogen input to the Baltic Sea. To develop a better understanding of the dynamics of plankton productivity, it is important to identify the N2fixing organisms and to determine their activity and distribution. In the Baltic Sea proper, we identified two cyanobacteria, Nodularia and Aphanizomenon, as the main nitrogenase-transcribing organisms in surface waters (4 m) based upon a library of 84 nitrogenase gene (nifH) clones. Using a quantitative species-specific real-time PCR protocol, Nodularia nifH gene transcription was found to be temporally and spatially variable with a strong peak at early to mid day and large variations at a single station over periods of months. The highest Nodularia nifH transcript concentration was observed in July (3.4  106 nifH copies L 21). Large variations were observed between stations, presumably due to patchiness of Nodularia biomass and variations in the exact day time of sampling. Rapid quantification of nitrogenase transcripts at the species level represents an important advancement for research concerning the distribution and regulation of planktonic cyanobacterial N2-fixation.

JOURNAL OF PLANKTON RESEARCH

j

29

VOLUME

(4 m) of the Baltic Proper and to develop means of quantifying nitrogenase transcription at the species level.

METHOD Sampling

NUMBER

4

j

PAGES

391 – 399

j

2007

enumeration, 50 mL samples were fixed with 0.2 mmfiltered formalin (4% final) and stored at 48C. Aliquots (10 mL) were filtered onto 25 mm diameter, 0.2 mm polycarbonate filters (Osmonics inc.) and all autofluorescing cells were enumerated by epifluorescence microscopy. SW samples (500 mL) for a diel study were collected from 1 m depth at 2 h intervals over a 24 h period at Gotland deep (578190 N, 208030 E) on 12 July 1999 during a cruise with M/S Humboldt. The samples were filtered onto 47 mm diameter, 0.2 mm polycarbonate filters (Osmonics Inc.), immediately frozen in liquid nitrogen and stored frozen until RNA extraction.

RNA extraction In the laboratory, filters were incubated for 5 min at room temperature in 500 mL Tris-EDTA buffer (10 mM Tris–HCl pH 8.0, 1 mM EDTA) containing lysozyme (3 mg mL 21, Sigma) and DNase (0.02 U mL 21, Roche). Three hundred and fifty microliters of RNeasy lysis buffer with b-mercaptoethanol (RNeasy mini kit, Qiagen) was added, and the samples were sonicated on ice five times for 0.1 s with 1 s in-between each pulse using a sonicator ultrasonic processor with a microtip (XL 2020, Misonix). The tip was cleaned with ethanol between samples. Next, 250 mL 99.6% (v/v) ethanol was added. Further extraction was according to the protocol for the RNeasy mini kit (Qiagen), supplemented with an on column DNase treatment (RNase-free DNase kit, Qiagen). Extracted RNA was stored at 2208C in 30 mL RNase-free water (supplied in the kit). For the clone library, 10 mL RNA extracts from 20 samples were pooled (stations 2, 4, 6, 8 and 10 collected on 21 May, 26 June, 24 July and 10 September 2001) and an additional DNase treatment was performed (200 mL sample, 23 mL buffer and 40 U DNase, Roche). The pooled RNA was purified to remove DNase (RNeasy mini kit) and eluted in 30 mL RNase-free water (Qiagen). For the transect analysis, four filters were pooled, thus representing 200 mL SW. RNA was quantified using the RiboGreen RNA Quantitation Kit (Molecular Probes).

cDNA synthesis and nested PCR

Fig. 1. Map of the sampling locations in the transect between Oskarshamn and Visby, Baltic Proper. The distance between sampling locations 1 and 11 is 100 km.

cDNA was synthesized using the TaqMan reverse transcription kit (Applied Biosystems). Ten microliter reactions contained 5.5 mM MgCl2, 500 mM of each dNTP, 2.5 mM random hexamer, 4 U RNase Inhibitor, 125 U Multiscribe Reverse transcriptase, 1 mL buffer and 5 mL RNA (corresponding to an average 6 ng RNA). Reverse transcription was performed for 10 min at 258C, 30 min at 488C and 5 min at 958C. Next, cDNA was amplified

392

Downloaded from http://plankt.oxfordjournals.org/ by guest on April 11, 2016

Baltic Proper samples were collected from the unfiltered cooling water (inlet at a depth of 4 m) of the ferry M/S Thjelvar on five occasions between 21 May and 8 October 2001 along a transect consisting of nine sampling sites between Oskarshamn (mainland, 578370 N 188130 E) and Visby (Island of Gotland, 578160 N 168300 E) at the east coast of Sweden (Fig. 1). Additional samples collected at 4 m depth from M/S Thjelvar were obtained from one site (St. 7, 57810 N, 168330 E) on 14 occasions between 5 June and 22 October 2001. All samples were collected between 12 : 35 P.M. (Oskarshamn) and 3 : 45 P.M. (Visby); except for 21 May and 5 June where the cruise started in Visby 7.20 A.M. and reached Oskarshamn 10.40 A.M. and 10 September 8.00 P.M. from Visby and 11.20 P.M. in Oskarshamn. Seawater (SW) samples for RNA extraction (50 mL) were filtered onto 25 mm diameter, 0.2 mm Supor-200 polyethersulfone membrane filters (PALL Corporation) and immediately frozen in liquid nitrogen. The small volume was chosen to minimize the filtering time and, thereby, the time for potential nucleases to degrade RNA before freezing. For total cyanobacterial

j

¨ M ET AL. K. H. BOSTRO

j

NODULARIA SP. nifH GENE TRANSCRIPTION

Cloning Nested PCR products from sample, negative control (no template control transferred from the first PCR to the second PCR) and DNA contamination control (amplified RNA with no prior cDNA synthesis) were analyzed on a 1.8% agarose gel. Bands of appropriate size (359 bp) were excised, gel-purified (QIAquick gel extraction kit, Qiagen) and cloned into the TOPO cloning vector according to the manufacturer’s instructions (Invitrogen). A number of insert-containing clones (84 from the sample, 18 and 14 from negative and DNA contamination controls, respectively) were purified (QIAprep spin miniprep kit, Qiagen) and sequenced with the DYEnamic ET terminator cycle sequencing kit (Amersham Biosciences) using vector primer M13 forward and an ABI PRISM 377 sequencer (Applied Biosystems) as described by the manufacturer. Sequences were aligned using Clustal X (Thompson et al., 1997). A phylogenetic tree was constructed using

the neighbor-joining algorithm in Clustal X and examined with the TreeViewPPC software (Page, 1996). The sequences of some of the cloned nifH gene transcripts have been deposited in GenBank. Accession numbers are shown in Fig. 2.

Sequencing of nifH from Aphanizomenon sp. KAC15 For phylogenetic comparison, the nifH gene of Aphanizomenon sp. KAC15 was sequenced. This strain ¨ land and the was isolated from the sound between O mainland of Sweden (Janson and Grane´li, 2002), 100 km south of the sampling area in the present study. Genomic DNA was amplified by nested PCR and products were cloned as described earlier. Four clones were sequenced and found to have identical nifH gene sequences. This was deposited in GenBank under the accession number DQ291144.

Primer/probe construction and real-time PCR Our Nodularia-like sequences were aligned using the MegAline software (DNASTAR) and the Clustal W program. The consensus sequence was used to construct a primer/probe set using the software Primer Express (Applied Biosystems). Clones used for primer/probe construction and genomic DNA from Nodularia spumigena KAC17 served as positive controls, whereas Aphanizomenon-related clones (similarity 86%) and genomic DNA from Aphanizomenon sp. KAC15 served as negative controls in the evaluation of primer specificity. No non-specific amplification was detected. Nodularia nifH gene transcripts were quantified by realtime PCR using an ABI PRISM 7700 Sequence Detector and a PCR mixture (25 mL) consisting of 5 mM MgCl2, 200 mM of each dNTP (except for dUTP, 400 mM), 200 nM forward Nodularia nifH primer (50 CGAAGAA GTAATGCTGACCGG30 ), 200 nM reverse Nodularia nifH (50 CGGATAGGCATAGCAAAACCA30 ), 100 nM Nodularia nifH probe (50 6-FAM-ACCCGGTGTAGGTTG TGCTGGTCG-TAMRA30 ), 1 mL cDNA, 0.25 U AmpErase UNG enzyme, 2.5 mL TaqMan buffer and 0.625 U AmpliTaq Gold (Applied Biosystems). Samples were amplified for 2 min, 508C and 10 min, 958C followed by 45 cycles of 15 s, 958C and 1 min, 558C. A plasmid linearized by restriction enzyme cleavage (TOPO cloning vector, Invitrogen) with a Nodularia nifH gene insert was used as template for the standard curve ranging from 1 to 1  106 copies per sample. Given the 200 mL SW filtered and the amount of cDNA used in each PCR reaction, this corresponds to a detection limit

393

Downloaded from http://plankt.oxfordjournals.org/ by guest on April 11, 2016

with nested PCR using degenerate primers nifH 3 and 4 and 1 and 2 (Zehr and McReynolds, 1989; Zani et al., 2000). Each 50 mL PCR reaction consisted of 2 mM of each primer ( polyacrylamide gel electrophoresis and high performance liquid chromatography purified, New England Biolabs), 200 mM dNTPs, 4 mM MgCl2, 1 mL template cDNA, 5 mL buffer and 2.5 U Taq DNA polymerase (Roche). Genomic DNA from Azotobacter vinelandii (DSMZ 2289) served as a positive control. In the negative control, the template was replaced by water (Sigma W4502). To minimize the risk for PCR contamination by trace DNA associated with PCR reagents, a restriction enzyme digest of the reagents was done according to Zehr et al. (Zehr et al., 2003a): 0.025 U mL 21 of AluI was added to dNTPs, buffer, MgCl2, Taq polymerase and water and incubated for 2 h at 378C. The reaction was terminated with an incubation at 658C for 20 min. Thereafter, primers and template were added and the reaction amplified with a GeneAmp PCR System 2400 (Applied Biosystems) for 30 cycles (1 min at 948C, 1 min at 548C and 1 min at 728C), with an initial denaturing step at 948C for 2 min and a final extension step at 728C for 7 min. In the following PCR, using nifH 1 and 2 primers, 1 mL PCR product was transferred to a fresh 50 mL PCR mix (as above with the exception of 2.5 mM MgCl2). To minimize the possibility of contamination, mixing of reagents was done in a UV-treated sterile flowbench in a UV-treated room, DNA was added in a PCR/UV workstation in a separate room (DNA/RNA UV-cleaner UVC/T, Talron Biotech) and single tubes (not strips) were used. All pipettes, tips and water were UV pre-treated (20 min).

JOURNAL OF PLANKTON RESEARCH

j

VOLUME

29

j

NUMBER

4

j

PAGES

391 – 399

j

2007

Downloaded from http://plankt.oxfordjournals.org/ by guest on April 11, 2016

Fig. 2. Neighbor-joining phylogenetic tree of nifH gene transcripts based on 321 bp. GenBank accession numbers are indicated to the right of clone names. Numbers in parentheses indicate the number of identical clones observed in the library. Symbols represent clones derived from DNA contamination control (stars) and negative control (triangles). Phylogenetic relationships were bootstrapped 1000 times using Clustal X, with bootstrap values .50% shown.

394

¨ M ET AL. K. H. BOSTRO

j

NODULARIA SP. nifH GENE TRANSCRIPTION

of 600 nifH copies L SW2 1. Amplification efficiency was measured for each sample by amplifying a mix of sample (1 mL) and standard (1  105 copies, 1 mL), as described earlier. Efficiency was calculated according to Short et al. (Short et al., 2004).

R E S U LT S A N D D I S C U S S I O N NifH transcripts in the Baltic Proper

Variability in Nodularia nifH gene transcript concentrations To quantify nifH gene transcripts by real-time PCR, we sought to design specific primer/probe sets targeting the two major clusters of clones related to Nodularia and Aphanizomenon, respectively (Fig. 2). A primer/probe set specific for clones within the environmental Nodularia cluster and for N. spumigena KAC17 genomic DNA was successfully designed. Several primer/probe sets for the Aphanizomenon sequence cluster were designed. Despite that these showed several mismatches to Nodularia nifH sequences, we were never able to eliminate unspecific amplification despite numerous attempts. We do not have an explanation for this; however, we note that the larger sequence divergence within the Aphanizomenon cluster (,6%) relative to Nodularia (,2%) constrained the variety of primer/probe sets that could be designed. Real-time PCR quantification of Nodularia nifH genes showed decreased amplification efficiency in some samples (shown in Figs 3 and 4); hence, these reported copy numbers should be viewed as minimum estimates. Since a number of samples yielded undetectable signals, a correction for the reduced amplification efficiencies could not be applied. Owing to the high-energy requirements of N2-fixation, fixation in heterocystous cyanobacteria is often coupled with photosynthesis and, therefore, with light (e.g. Gallon et al., 2002). In contrast, the oxygen sensitivity of the nitrogenase will drive an uncoupling with photosynthetic activity. Therefore, N2-fixation is generally highest during the light period of the day (Evans et al., 2000), but often with highest activity in the morning and gradually decreasing during the day (Stal

395

Downloaded from http://plankt.oxfordjournals.org/ by guest on April 11, 2016

With the aim to identify the main N2-fixing organisms in Baltic Proper surface waters, a clone library of nifH gene transcripts amplified from community RNA was generated. The RNA was pooled from four different dates and five different stations to maximize the coverage of N2-fixing bacterioplankton over the season. All sequenced nifH clones were related to Aphanizomenon (68 clones, similarity 96– 100% to Aphanizomenon sp. KAC15; sequenced in this study) and Nodularia (16 clones, similarity 96– 99% to Nodularia sp.) (Fig. 2). The sequence divergence within the two tight clusters (6% and 2%, respectively) is supposedly due to the presence of different genotypes of Aphanizomenon (Janson and Grane´li, 2002) and Nodularia (Barker et al., 1999; Lehtima¨ki et al., 2000) in the Baltic Sea. Though considered conserved, nifH is more variable than, for instance, the 16S rRNA gene (Zehr et al., 2003b); hence, the observation of some sequence divergence is not surprising. However, it should be noted that the divergence of the clones in the contaminant group was up to 3%, which may suggest that amplification and sequencing errors could be responsible for some of the observed cyanobacterial sequence divergence. The clone library did not contain any nifH transcripts (cDNA) corresponding to heterotrophic bacteria. We speculate that although nifH may have been transcribed by heterotrophic bacteria, the resulting transcripts were likely too few relative to cyanobacterial transcription in surface samples to be detected in the clone library. A significant number of proteobacterial nifH transcripts have been found in clone libraries from waters with lower concentrations of diazotrophic cyanobacteria (Zani et al., 2000; Church et al., 2005b). Despite extensive precautions to avoid contamination, unwanted PCR amplification products were visible as faint bands in the agarose electrophoresis gel for both the negative control sample and the DNA contamination control. This was likely due to the use of highly degenerate primers and a high number of cycles (60), which makes the nested PCR analysis extraordinarily susceptible to contamination caused by handling and/or the presence of trace DNA in commercial PCR reagents (Zehr et al.,

2003a; Goto et al., 2005; Bostro¨m et al., 2007). Similar to findings by others (Zehr et al., 2003a; Goto et al., 2005), we found that restriction digest of PCR reagents decreased the amount of unwanted PCR products, but that the DNA contamination could not be eliminated. Clones from the two contamination products (DNA contamination control and negative control) clustered on a branch, well separated from the sample clones and were 90–91% similar to the nifH gene from the a-proteobacterium Methylosinus trichosporium (Fig. 2). The clustering of clones from the two controls on the same branch suggests that PCR reagents were the cause of contamination, whereas the lack of any such sequences in the clone library indicates that contaminating DNA was outcompeted by cDNA transcribed from the original samples. In general, the identification of contaminating sequences is highly recommended since it provides a means of removing these from sample clone library analysis.

JOURNAL OF PLANKTON RESEARCH

j

29

VOLUME

et al., 2003). The diel study showed overall low concentrations of Nodularia nifH transcripts with a slight increase during the early morning hours followed by a pronounced peak at noon (3.6  104 copies L 2 1, Fig. 3A). As Nodularia biomass was not measured, additional data are clearly needed to examine the variation in per cell activity; however, the observation of a diel pattern in nifH gene transcription is consistent with findings of highest nitrogenase per cell content in the morning/ early day hours during a Baltic N. spumigena bloom (Gallon et al., 2002). Similarly, Church et al. (Church et al., 2005b) recently found in the North Pacific Ocean that the nifH gene transcription of a presumed heterocystous phylotype was higher in the early morning hours relative to the rest of the day. To further examine the temporal dynamics of Nodularia nifH transcription, samples were obtained from a single station (St. 7) 14 times from early June to late October (Fig. 3B). Except for samplings on 5 June and

NUMBER

4

j

PAGES

391 – 399

j

2007

10 September, all samples were obtained in the afternoon (14.20). Two major peaks in transcription were seen during summer: 0.1  105 to 5.6  105 copies L 21 in late June to early July and 16  105 copies L 21 on 31 July. Transcription was low (,0.07  105 copies L 21) or non-detectable from the beginning of August until late October. Nodularia nifH gene transcripts were quantified in samples obtained from five Oskarshamn–Visby transects from 5 June to 8 October. Overall, the concentrations were one order of magnitude higher during mid summer relative to early summer and autumn (Fig. 4). The concentration of Nodularia nifH transcripts was low on 5 June ranging from 0.2  105 to 1.7  105 copies L 21 (Fig. 4A), but increased dramatically by mid summer from between 1.7  105 and 34  105 copies L 21 on 26 June (Fig. 4B) to between 1.8  105 and 22  105 copies L 21 on 31 July (Fig. 4C). Concentrations decreased again in early (16 August) and late autumn (8 October), with values ranging from nondetectable (,600 copies L 21) to 2.4  105 copies L 21 and from non-detectable to 0.8  105 copies L 21, respectively (Fig. 4A). High variability of transcript concentrations was observed between stations during individual transects. In part, temporal dynamics in Nodularia nifH transcription could have affected the results as transect samplings were generally initiated in the afternoon (St. 2) and completed 3 h later (St. 10). Indeed, transcript concentrations correlated with sampling time for two transect studies with decreasing values from St. 2 to St. 10 (26 June, R 2 ¼ 0.56, n ¼ 8; 16 August, R 2 ¼ 0.64, n ¼ 8); however, this pattern was not consistently observed in all transects. Overall, the concentration of Nodularia nifH transcripts was highly variable between sampling stations. Some of this variability might be due to patchiness in the distribution of cyanobacterial biomass (Kononen et al., 1996). Such patchiness could be caused by variations in hydrodynamic conditions and/or, for instance, the supply of nutrients, i.e. phosphate and/or iron, due to local inputs (Stal et al., 2003), although small-scale variability may also have occurred as Nodularia can form aggregates of the order of centimeters (Stal et al., 2003; discussed subsequently). Further, Nodularia is sensitive to strong small-scale shear, which might arise from, for example, wind (Moisander et al., 2002). However, nifH transcription and N2-fixation are not necessarily coupled with cyanobacterial biomass. For instance, in the Baltic Sea, Wasmund et al. (Wasmund et al., 2001) did not find a consistent correlation between the biomass of heterocystous cyanobacteria and 15N incorporation in 2 consecutive years; whereas Gallon et al. (Gallon et al., 2002) found that N2-fixation and primary

396

Downloaded from http://plankt.oxfordjournals.org/ by guest on April 11, 2016

Fig. 3. Concentrations of Nodularia nifH gene transcripts at Gotland deep during 24 h in 1999 (A) and at St. 7 in the Oskarshamn/Visby transect during summer and autumn 2001 (B). BDL indicates copy number below detection limit (600 copies L 21). Values are averages of duplicate samples, + SE. Amplification efficiency values ,85% are shown in parentheses.

j

¨ M ET AL. K. H. BOSTRO

j

NODULARIA SP. nifH GENE TRANSCRIPTION

Downloaded from http://plankt.oxfordjournals.org/ by guest on April 11, 2016

Fig. 4. Nodularia nifH gene transcript concentrations along the Oskarshamn (St. 1) to Visby (St. 10) transect in 2001. Transects with low nifH transcript concentrations (A). NifH transcript concentrations compared with rough estimates of total cyanobacterial abundance on 26 June (B) and 31 July (C), respectively. BDL indicates copy number below detection limit (600 copies L 21). Values are averages of duplicate PCR reactions, +SE. Amplification efficiency values ,85% are shown in parentheses. Note different scales on Y-axes.

397

JOURNAL OF PLANKTON RESEARCH

j

29

VOLUME

CONCLUDING REMARKS Analysis of a nifH transcript clone library suggests that the heterocystous cyanobacteria, Nodularia and Aphanizomenon, are the predominant organisms transcribing nitrogenase in the upper waters of the Baltic Sea Proper in summer. Real-time PCR quantification of Nodularia transcripts indicated a diel variation in nifH transcription. The temporal variation may have affected observed surface spatial variations of Nodularia transcript concentration. In addition, large variations were observed at a single station over months, although these samples were consistently obtained at the same time of the day. The present study demonstrates a pronounced variability in Nodularia nifH gene transcript concentrations in the Baltic Sea and highlights real-time PCR as a powerful and sensitive method to rapidly quantify nitrogenase transcription at the species level in a large number of samples. Our study illustrates the need for highresolution sampling in studies of planktonic N2-fixation and represents an important methodological advancement for research concerning the extent, distribution and regulation of planktonic cyanobacterial N2-fixation.

AC K N OW L E D G E M E N T S We thank Destination Gotland and the captain and crew of the ferry M/S Thjelvar for their assistance in sample collection. We thank Karin Simu for obtaining diel study samples, Sven Janson for providing genomic DNA from N. spumigena KAC17 and Aphanizomenon sp. KAC15 and

NUMBER

4

j

PAGES

391 – 399

j

2007

Richard A. Long for linguistic improvements of an earlier version of the manuscript. This work was supported by the Swedish science council FORMAS (2002-1300 to U.L.Z. and 214-2004-1414 to L.R.).

REFERENCES Barker, G. L. A., Hayes, P. K., O’Mahony, S. L. et al. (1999) A molecular and phenotypic analysis of Nodularia (cyanobacteria) from the Baltic Sea. J. Phycol., 35, 931– 937. Bird, C., Martinez, J. M., O’Donnell, A. G. et al. (2005) Spatial distribution and transcriptional activity of an uncultured clade of planktonic diazotrophic g-proteobacteria in the Arabian Sea. Appl. Environ. Microbiol., 71, 2079– 2085. Bostro¨m, K. H., Riemann, L., Ku¨hl, M. et al. (2007) Isolation and gene quantification of heterotrophic N2-fixing bacterioplankton in the Baltic Sea. Environ. Microbiol. 9, 152–164. Church, M. J., Jenkins, B. D., Karl, D. M. et al. (2005a) Vertical distributions of nitrogen-fixing phylotypes at stn ALOHA in the oligotrophic North Pacific Ocean. Aquat. Microb. Ecol., 38, 3 –14. Church, M. J., Short, C. M., Jenkins, B. D. et al. (2005b) Temporal patterns of nitrogenase gene (nifH) expression in the oligotrophic North Pacific Ocean. Appl. Environ. Microbiol., 71, 5362–5370. Evans, A. M., Gallon, J. R., Jones, A. et al. (2000) Nitrogen fixation by Baltic cyanobacteria is adapted to the prevailing photon flux density. New Phylogist, 147, 285–297. Gallon, J. R., Evans, A. M., Jones, D. A. et al. (2002) Maximum rates of N2 fixation and primary production are out of phase in a developing cyanobacterial bloom in the Baltic Sea. Limnol. Oceanogr., 47, 1514–1521. Goto, M., Ando, S., Hachisuka, Y. et al. (2005) Contamination of diverse nifH and nifH-like DNA into commercial PCR primers. FEMS Microbiol. Lett., 246, 33–38. Grane´li, E., Wallstro¨m, K., Larsson, U. et al. (1990) Nutrient limitation of primary production in the Baltic Sea area. AMBIO, 19, 142 –151. Janson, S. and Grane´li, E. (2002) Phylogenetic analyses of nitrogenfixing cyanobacteria from the Baltic Sea reveal sequence anomalies in the phycocyanin operon. Int. J. Syst. Evol. Microbiol., 52, 1397–1404. Kononen, K., Kuparinen, J., Ma¨kela¨, K. et al. (1996) Initiation of cyanobacterial blooms in a frontal region at the entrance to the Gulf of Finland, Baltic Sea. Limnol. Oceanogr., 41, 98– 112. Larsson, U., Hajdu, S., Walve, J. et al. (2001) Baltic Sea nitrogen fixation estimated from the summer increase in upper mixed layer total nitrogen. Limnol. Oceanogr., 46, 811–820. Lehtima¨ki, J., Lyra, C., Suomalainen, S. et al. (2000) Characterization of Nodularia strains, cyanobacteria from brackish waters, by genotypic and phenotypic methods. Int. J. Syst. Evol. Microbiol., 50, 1043–1053. Lehtima¨ki, J., Moisander, P., Sivonen, K. et al. (1997) Growth, nitrogen fixation, and nodularin production by two Baltic Sea cyanobacteria. Appl. Environ. Microbiol., 63, 1647–1656. Moisander, P. H., Hench, J. L., Kononen, K. et al. (2002) Small-scale shear effects on heterocystous cyanobacteria. Limnol. Oceanogr., 47, 108 –119.

398

Downloaded from http://plankt.oxfordjournals.org/ by guest on April 11, 2016

production are not always in phase. Similarly, we found no statistical correlation between our rough estimates of total cyanobacterial abundance and Nodularia nifH transcript concentration (Fig. 4B and C). The occurrence of highest transcript concentration levels during summer and decreasing values in August were concurrent with the appearance and subsequent wind-based dispersal of surface accumulations of Nodularia in the Baltic Proper (The Baltic Sea Web Portal, www.fimr.fi, J. Rissanen). Our epifluorescence microscopy enumeration of cyanobacteria served the purpose of indicating whether the pronounced variations in nifH transcription between stations were due to sampling of extensive Nodularia patches. This did not appear to be the case. RNA extracts from four distinct filters, representing a total of 200 mL SW, were pooled to accommodate for potential biological variability between samples from a single station. Still, inclusion of RNA from a large Nodularia aggregate at one station, but not at another, could have contributed significantly to the variability in nifH transcription observed between stations.

j

¨ M ET AL. K. H. BOSTRO

j

NODULARIA SP. nifH GENE TRANSCRIPTION

Ohlendieck, U., Stuhr, A. and Siegmund, H. (2000) Nitrogen fixation by diazotrophic cyanobacteria in the Baltic Sea and transfer of the newly fixed nitrogen to picoplankton organisms. J. Mar. Syst., 25, 213–219. Page, R. D. M. (1996) TREEVIEW: an application to display phylogenetic trees on personal computers. Comp. Appl. Biosci., 12, 357–358. Short, S. M., Jenkins, B. D. and Zehr, J. P. (2004) Spatial and temporal distribution of two diazotrophic bacteria in the Chesapeake Bay. Appl. Environ. Microbiol., 70, 2186–2192. Sivonen, K., Kononen, K., Carmichael, W. W. et al. (1989) Occurrence of the hepatoxic cyanobacterium Nodularia spumigena in the Baltic Sea and structure of the toxin. Appl. Environ. Microbiol., 55, 1990– 1995. Staal, M., Lintel-Hekkert, S., Harren, F. et al. (2001) Nitrogenase activity in cyanobacteria measured by the acetylene reduction assay: a comparison between batch incubation and on-line monitoring. Environ. Microbiol., 3, 343– 351.

Stal, L. J., Staal, M. and Villbrandt, M. (1999) Nutrient control of cyanobacterial blooms in the Baltic Sea. Aquat. Microb. Ecol., 18, 165–173. Thompson, J. D., Gibson, T. J., Plewniak, F. et al. (1997) The CLUSTAL_X windows interface: flexible strategies for multiple

Wasmund, N., Voss, M. and Lochte, K. (2001) Evidence of nitrogen fixation by non-heterocystous cyanobacteria in the Baltic Sea and re-calculation of a budget of nitrogen fixation. Mar. Ecol. Prog. Ser., 214, 1 –14. Zani, S., Mellon, M. T., Collier, J. L. et al. (2000) Expression of nifH genes in natural microbial assemblages in Lake George, New York, detected by reverse transcriptase PCR. Appl. Environ. Microbiol., 66, 3119–3124. Zehr, J. P. and McReynolds, L. A. (1989) Use of degenerated oligonucleotides for amplification of the nifH gene from the marine cyanobacterium Trichodesmium thiebautii. Appl. Environ. Microbiol., 55, 2522–2526. Zehr, J. P., Crumbliss, L. L., Church, M. J. et al. (2003a) Nitrogenase genes in PCR and RT–PCR reagents: implications for studies of diversity of functional genes. BioTechniques, 35, 996–1001. Zehr, J. P., Jenkins, B. D., Short, S. M. et al. (2003b) Nitrogenase gene diversity and microbial community structure: a cross-system comparison. Environ. Microbiol., 5, 539– 554. Zehr, J. P., Mellon, M. T. and Zani, S. (1998) New nitrogenfixing microorganisms detected in oligotrophic oceans by amplification of nitrogenase (nifH) genes. Appl. Environ. Microbiol., 64, 3444–3450.

399

Downloaded from http://plankt.oxfordjournals.org/ by guest on April 11, 2016

Stal, L. J., Albertano, P., Bergman, B. et al. (2003) BASIC: Baltic Sea cyanobacteria. An investigation of the structure and dynamics of water blooms of cyanobacteria in the Baltic Sea—responses to a changing environment. Cont. Shelf. Res., 23, 1695– 1714.

sequence alignment aided by quality analysis tools. Nucleic Acids Res., 25, 4876–4882.