Cancer Cell, Volume 14

Supplemental Data Article H3K79 Methylation Profiles Define Murine and Human MLL-AF4 Leukemias Andrei V. Krivtsov, Zhaohui Feng, Madeleine E. Lemieux, Joerg Faber, Sridhar Vempati, Amit U. Sinha, Xiaobo Xia, Jonathan Jesneck, Adrian P. Bracken, Lewis B. Silverman, Jeffery L. Kutok, Andrew L. Kung, and Scott A. Armstrong

Supplemental Experimental Procedures Human Samples Peripheral blood samples contained at least 70% blasts. Four MLL-rearranged sample carried t(4;11) and one carried t(11;19) translocation detected initially by FISH and confirmed by PCR. MLL-germline ALL samples were pre-B and FISH negative for MLL-rearrangements, BCRABL, and TEL-AML1. Normal bone marrow samples were obtained from healthy donors at Dana Farber Cancer Institute and Children’s Hospital, Boston on an IRB approved protocol. Mononuclear cells were purified by Ficoll-Hypaque density-gradient centrifugation, and either frozen in liquid nitrogen with 10% dimethyl sulfoxide in fetal calf serum or transferred directly into ChIP lysis buffer. Generation of Conditional Mll-AF4 Knockin Mice The SalI linearized targeting construct was electroporated into CJ7 ES cells obtained from the laboratory of Stuart H. Orkin (strain 129/SvJ) (Simpson et al., 1997), followed by puromycin selection of positive clones. Three out of 128 clones had undergone homologous recombination. Clones that demonstrated normal karyotypes were injected into C57Bl/6 blastocysts and male chimeras were bred with C57Bl/6 females (Charles River Laboratories or Taconic Farms) to achieve germline transmission. Heterozygous Mll-AF4stop mice were maintained on a mixed C5B7Bl6/129 background by backcrossing to wild-type C5B7Bl6/129 F1 mice (Taconic Farms). Detection of Mll-AF4 Transcript To detect expression of Mll-AF4 transcripts RNA was TRIzol (Invitrogen) extracted from cells of interest, converted into cDNA using RETROScript kit (Ambion) and used in a PCR reaction with specific primers: (F) GCAGATGGAGTCCACAGGAT; (R) TGACATGCTGAGAGTCCTTTG. Immunoglobulin heavy chain rearrangements (DJH1 to DJH4) were detected by PCR reaction simultaneously with 2 forward degenerate (DFL/DSP and DQ52) and one reverse primers (Zeisig et al., 2004).

Transduction with shRNA Constructs To obtain lentiviral particles, 3.5 million human 293 embryonic kidney cells were seeded in 10 cm dishes in DMEM supplemented with 10% FBS and 1x penicillin/streptomycin. After incubation for 24 hours (37 °C, 5% CO2), 50-70% confluent 293T cells were co-transfected with 10μg of DOT1LshRNA1, DOT1LshRNA2 or GFP control shRNA, 0.4 μg of packaging plasmids containing gag, tat and rev genes and 0.8 μg VSV-G expressing plasmid using FuGENE 6 (Roche) diluted in OPTI-MEM serum-free media (Invitrogen). After incubation for 16 hours the media was replaced with DMEM supplemented with 10% FBS and 1× penicillin/streptomycin to remove the transfection reagent. The lentiviral supernatants were collected 30 to 60 hours after the transfection, filtered through 0.22 μm filter and stored at -70°C. Lentiviral titers were determined by transduction of NIH3T3 cells. For lentiviral infection of leukemia cells SEMK2 and RS4;11, 1x105 cells were seeded in 96-well tissue culture plates (100 μl per well) in the appropriate culture media. Polybrene (Hexadimethrine bromide, Sigma) was added at a final concentration of 7μg/ml. After adding 100 μl lentiviral particles (MOI ~5), spinoculation was performed at 2250 RPM for 90 minutes at 37 °C. 8 hours after infection, the media was replaced with 100 μl of the appropriate fresh culture media. Cells were incubated at 37°C, 5% CO2 until used for downstream applications. Immunoblot to detect DOT1L expression was performed with antibody A300-953A (Bethyl Labs). RNA Amplification and Microarray Data Analysis Expression files were created using RMA algorithm with background correction and quantile normalization but without present or absent calls. The expression files were pre-processed with min change 3; min delta 100; threshold 20; ceiling 20000 resulting in 10218 probe sets. For hierarchical clustering we used pairwise average-linkage and Pearson correlation for column distance measure. Consensus clustering was visualized for Lorenz N=5. Microarray signals for probe sets representing Hox A, B, C, and D cluster genes were selected and visualized using Heat Map Viewer v.8 module with the global color scheme. Expression levels of HoxA9 and Meis1 genes were confirmed using quantitative RT-PCR. Flow Cytometry B220-Pacific Blue (RA3-6B2); CD43-PE (S7); Goat-anti-mouse IgM-APC (Jackson Immunoresearch, West Grove, PA); IgD-FITC (11-26.c); Mac1-PE (M1/70); Gr1-APC (M1/70). To label lineage-positive BM cells a cocktail of purified antibodies was used CD3 (17A2); CD4 (GK1.5); CD8α (53-6.7); Gr1 (RB-8C5); F4/80 (BM8); and TER-119 (TER-119). The bound antibodies were developed using Goat-anti-rat F(ab’)2-Qdot605 secondary antibody. Normal and leukemic mouse lymphoid progenitors were FACS sorted for the following immunophenotype pro-B (Lin- B220+ CD43+); pre-B (Lin- B220+ CD43- IgM- IgD-); immature-B (Lin- B220+ CD43- IgM+ IgD-); mature-B (Lin- B220+ CD43- IgM+ IgD+). Human lineage-positive BM cells were labeled with a cocktail of purified antibodies CD3 (S4.1); CD4 (S3.5); CD8 (3B5); CD11b (ICRF44); CD14 (TUK4); CD56 (B159); CD235 (GA-R2) and developed using secondary Goatanti-mouse F(ab’)2-Qdot605 antibody. Human pre-B cells were FACS sorted for the following immunophenotypes: Lin- CD34+ CD19+ with CD19-APC/Cy7 (HIB19); CD34-APC (HPCA-2). After labeling cells were washed once in ice-cold PBS, dead cells were labeled with 7-AAD (final conc. 0.5 μg/ml) (Invitrogen) and then analyzed or sorted on FACSAria (BD Biosciences) equipped with blue (488nm), red (640nm), and violet (407nm) lasers.

Supplemental References Simpson, E. M., Linder, C. C., Sargent, E. E., Davisson, M. T., Mobraaten, L. E., and Sharp, J. J. (1997). Genetic variation among 129 substrains and its importance for targeted mutagenesis in mice. Nat Genet 16, 19-27.

Figure S1. (A) Immortalization of lymphoid progenitors upon expression of Mll-AF4. Bone marrow cells from Mll-AF4stop mice were infected with Cre-GFP (Cre) or GFP-control (MIG) expressing retrovirus and plated in cytokines supportive of lymphoid differentiation. The cells were collected and re-plated weekly. (B) Supervised microarray analysis of 20 most up regulated genes in lymphoid progenitors upon Mll-AF4 expression.

G

Figure S2.

Figure S2. (A) Survival plot of lethally irradiated B/6-129 recipient mice transplanted with bone marrow from Mll-AF4stop knockin mice retrovirally transduced with either hit and run Cre (HR-Cre) or MSCV-GFP (MIG) (p