HEL010.fm Page 1 Thursday, March 29, 2001 4:30 PM

Volume 6 • Number 1 • 2001 H E L I C O B AC T E R

Helicobacter pylori Infection in the Cat: Evaluation of Gastric Colonization, Inflammation and Function Blackwell Science, Ltd

*Kenneth W. Simpson,* Dalit Strauss-Ayali,* Reinhard K. Straubinger,† Eugenio Scanziani,* Patrick L. McDonough,* Alix F. Straubinger,* Yung-Fu Chang,‡ Maria I. Esteves,‡ James G. Fox,† Cynzia Domeneghini,§ Naila Arebi and §John Calam *College of Veterinary Medicine, Cornell University, Ithaca NY, USA, †Faculty of Veterinary Medicine, University of Milan, Italy, ‡Comparative Medicine, Massachusetts Institute of Technology, Boston, USA and §Division of Medicine, Imperial College of Science, Technology and Medicine, London, UK. ABSTRACT

Background. Further elucidation of the consequences of Helicobacter pylori infection on gastric mucosal inflammation and gastric secretory function would be facilitated by an animal model that is susceptible to infection with H. pylori, is broadly similar in gastric physiology and pathology to people, and is amenable to repeated non-invasive evaluation. The goal of this study was to examine the interrelationship of bacterial colonization, mucosal inflammation and gastric secretory function in cats with naturally acquired H. pylori infection. Materials and Methods. Twenty clinically healthy cats with naturally acquired H. pylori infection (cagA–, picB) and 19 Helicobacter-free cats were evaluated. Gastric colonization was determined by tissue urease activity, light microscopy, culture and PCR. The mucosal inflammatory response was evaluated by light microscopy, and by RT-PCR of the pro-inflammatory cytokines IL-1α, IL-1β, IL-8 and TNF-α in gastric mucosa. Gastric secretory function was assessed by measuring pentagastrin-stimulated acid secretion, fasting plasma gastrin, and antral mucosal gastrin and somatostatin immunoreactivity. Results. H. pylori colonized the pylorus, fundus and cardia in similar density. Bacteria were observed

free in the lumen of gastric glands and were also tightly adherent to epithelial cells where they were associated with microvillus effacement. Mononuclear inflammation, lymphoid follicle hyperplasia, atrophy and fibrosis were observed primarily in H. pylori-infected cats, with the pylorus most severely affected. Neutrophilic and eosinophilic infiltrates, epithelial dysplasia, and upregulation of mucosal IL-1β and IL-8 were observed solely in infected cats. Fasting plasma gastrin concentrations and pentagastrin-stimulated acid output were similar in both infected and uninfected cats. There was no relationship of bacterial colonization density or gastric inflammation to plasma gastrin concentrations or gastric acid output. Conclusions. The pattern of colonization and the mucosal inflammatory response in cats with naturally acquired H. pylori are broadly similar to those in infected people, particularly children, and non-human primates. The upregulation of IL-8 in infected cats was independent of cagA and picB. Our findings argue against a direct acid-suppressing effect of H. pylori on the gastric secretory-axis in chronically infected cats. Abbreviations: RT-PCR, reverse transcriptase polymerase chain reaction, HLO; Helicobacter-like organisms.

S

About one in six people develop duodenal ulcers that are associated with antral predominant gastritis, characterized by the upregulation of pro-inflammatory cytokines such as IL-8, lL-1β and TNF-α [8–10], and increased acid secretion [11–13]. Another, smaller, subset of people develop atrophy and intestinal metaplasia of the body of the stomach and go on to develop gastric carcinoma over a period of 30 – 40 years [2]. In contrast to those with antral dominant gastritis, who tend to develop peptic ulcers and acid hypersecretion, inflammation and atrophy of the

ince its isolation in 1983 [1], it has become clear that H. pylori infection is a major cause of chronic superficial gastritis and peptic ulcers, and is a cofactor for the development of gastric carcinoma and mucosa-associated lymphoid tissue (MALT) lymphoma [1–7]. Abnormalities in gastric secretory function are also a consequence of infection with H. pylori. Reprint requests to: Dr Kenneth W. Simpson, Department of Clinical Sciences, College of Veterinary Medicine, Cornell University, Ithaca NY 14853, USA. © 2001 Blackwell Science Ltd, Helicobacter, 6, 1–14

1

HEL010.fm Page 2 Thursday, March 29, 2001 4:30 PM

2 fundus are associated with achlorhydria [14–17]. Interestingly, hypergastrinemia is a consistent finding in H. pylori-infected people, and is present in asymptomatic individuals, those with achlorhydria, and those with duodenal ulcers [13,18], and has substantial implications with respect to cell proliferation and tumorigenesis [19]. While eradication of H. pylori has been associated with amelioration of gastritis, cytokine over-expression and hypergastrinemia, and acid secretory abnormalities [11,13,17,20], the role of bacterial and host factors in the genesis of these abnormalities is unresolved. For example, decreased inhibition of gastrin release by somatostatin, with resultant hypergastrinemia and increased parietal cell mass, has been postulated as the cause of hyperacidity and duodenal ulceration [21,22]. However, it is unclear if this is a consequence of the host inflammatory response [8–10], as TNF-α inhibits somatostatin release by fundic D-cells [23], and IL-1β, TNF-α, and IL-8 stimulate gastrin release by antral G cells in vitro [24–26], or H. pylori-associated factors such as ammoniagenesis [27,28]. The situation is further complicated by observations that the degree of hypergastrinemia and the antral cytokine milieu can be similar in humans with and without duodenal ulcers and changes in gastric secretory function [8–10]. Additionally, host factors that are thought to promote gastrin release in the pyloric antrum, such as TNF-α and IL-1β, are associated with inhibition of acid secretion in the fundus [29,30], and bacterial factors such as acid inhibitory substances produced by H. pylori and H. felis may also have a role [31,32]. Further elucidation of the consequences of Helicobacter pylori infection on gastric colonization, mucosal inflammation and gastric secretory function would be facilitated by an animal model that is susceptible to infection with H. pylori, has broadly similar gastric physiology, has an immune and inflammatory response similar to people, and is amenable to repeated non-invasive evaluation. To this end, a variety of animal models including germ-free piglets, non-human primates, mice, gerbils and ferrets, each with complementary and useful features has been developed [see reviews 33,34]. To date, non-human primate models come closest to this description, but moral issues and cost have limited studies to date [35,36]. Apart from primates, cats are the only other animal found to have

Simpson et al. naturally acquired H. pylori infection [37–39]. Investigation of the pathogenicity of H. pylori in cats to date has focused on describing the infecting bacteria and the immune response of young cats with naturally acquired and experimental infections. The effect of infection on the induction of proinflammatory cytokines or chemokines and gastric secretory function have not been examined. We report here the evaluation of gastric histopathology and antral IL-1α, IL1-β, IL-8 and TNF-α mRNA expression, and acid secretion, plasma gastrin, antral somatostatin and gastrin immunoreactivity, in cats with naturally acquired H. pylori infection. Materials and Methods

Animals Twenty clinically healthy cats obtained from a commercial colony known to be infected with H. pylori since 1992 [37] were studied (cats 1–20: 11 female, nine male; age range 0.5 –11 years, median 2.2 years: six cats 0.5 years, six cats 2.2 years, eight cats 5–11 years). Nineteen specific pathogen-free (SPF) cats from a Helicobacter-free colony (cats 21–39: 19 male; age range 0.5 –1.6 years, median 0.5 years: 13 cats 0.6 years, six cats 1.6 years) were obtained from the same commercial vendor. The presence or absence of gastric Helicobacter spp. was ascertained by evaluating gastric tissue samples for urease activity and the presence of H. pylori-like organisms and Helicobacter DNA (see gastric biopsy). Infected cats were housed separately from uninfected cats. Cats were acclimatized to housing for at least 2 weeks prior to starting the study. All rooms or cages were equipped with objects and furniture adequate to enrich the animals’ environment. Fourteen H. pylori-infected cats and 19 SPF cats were housed in a barrier facility with a controlled environment (lighting 12 hours on, 12 hours off, temperature 68 – 72°F, humidity 35 – 45%) at Cornell University and were fed a standard commercial diet (Teklad, lab cat diet, Madison WI, USA) ad-libitum and had constant access to water throughout the study. Six H. pyloriinfected cats (cats 7–12) were housed at MIT animal facilities in stainless steel cages (temperature 68–74°F, humidity 40 – 60%, lighting 12 hours on, 12 hours off) and given food (Iams Cat Diet, Iams Co., Dayton, OH, USA) and water ad libitum. © 2001 Blackwell Science Ltd, Helicobacter, 6, 1– 14

HEL010.fm Page 3 Thursday, March 29, 2001 4:30 PM

3

H. pylori-associated gastritis in cats Cornell University and MIT operate under an approved Animal Welfare Assurance (#A3347– 01, #A-3125–01) and are fully accredited by the Association for the Assessment and Accreditation of Laboratory Animal Care (AAALAC). The Institutional Animal Care and Use Committees at Cornell University and MIT approved the project.

(site 5) of eight infected cats (numbers 13–20). Samples for quantification of gastrin and somatostatin immunoreactivity (two punch samples) were obtained from the pyloric antrum (next to sites 7–9) from 14 cats (numbers 13–26). Samples for cytokine and gastrin analysis were snap frozen in liquid nitrogen and frozen at – 80°C pending analysis.

Gastric tissue sampling

Evaluation of H. pylori infection status

Endoscopic biopsies of the stomach were obtained from 19 cats (numbers 7–12 and 27–39) with a pediatric endoscope and biopsy forceps (Olympus GIF XP20, Olympus America, Lake Success, NY, USA). Endoscopic biopsies were procured from the pyloric antrum (incisura to pyloric sphincter), the body (greater curvature) and the cardia. Three biopsies were taken from each site for light microscopy, two from each site for urease testing and one from each site for PCR. Two samples for cytokine analysis and two additional samples for quantification of gastrin and somatostatin immunoreactivity (two biopsies) were obtained from the pyloric antrum from 6 cats (numbers 7–12), and snap frozen in liquid nitrogen. Samples for PCR, gastrin and somatostatin assay were frozen at –80°C pending analysis. The endoscope was thoroughly cleaned and then sterilized using an activated aldehyde solution (Metrex, Parker, CO, USA). Biopsy forceps were sterilized in a similar fashion and the biopsy cups were immersed in chlorox (1 : 10 in water) for 10 minutes to destroy residual DNA. Full thickness gastric tissue samples were obtained from 20 cats (numbers 1–6 and 13–26) at necropsy from 10 standardized sites in the cardia, fundus, body and pylorus as described by Lee et al. [40] using sterile 6 mm skin biopsy punches. One sample from the cardia (site 1), mid-body (site 5) and mid-pylorus (site 8) was evaluated for urease activity and frozen for PCR analysis. Tissue samples were pooled into two groups according to site (cardia, body and fundus, sites 1–6: pylorus, sites 7 –10) and evaluated by light microscopy. Additional samples for transmission electron microscopy were obtained from the mid-body region (site 5). Samples for cytokine analysis (two punch samples) were obtained from the pyloric antrum (next to sites 7–9) from 14 cats (numbers 13–26). Additional samples for cytokine analysis were obtained from the cardia (site 1) and mid-body

Gastric urease Urease production by gastric tissue was evaluated as previously described [41]. Gastric tissue samples were placed in sterile tubes containing 150 µl of a solution composed of urea, sodium azide, phenol red and phosphate buffered saline (pH 6.5). Samples were incubated for 24 hours and observed at 1, 4, and 24 hours for a change in the colour of the indicator medium. Urease results were additionally scored as follows: positive at 1 hour = 3, positive at 4 hours = 2, positive at 24 hours = 1, negative at 24 hours = 0.

© 2001 Blackwell Science Ltd, Helicobacter, 6, 1–14

Culture of gastric tissue samples Gastric tissue samples were transported to the laboratory in Trypticase Soy Broth (BBL Microbiological Systems, Becton Dickinson, Cockeysville MD, USA) or Brucella broth (Difco Laboratories, Detroit, MI, USA) with 30% glycerol. Upon receipt in the laboratory, tissue samples were ground with a Ten-Broek tissue grinder and then plated directly onto Trypticase Soy Agar with 5% sheep blood plates (BBL), and onto Brucella blood PRAS agar plates (Anaerobe Systems, CA, USA), and incubated in a microaerophilic atmosphere at 36°C with added moisture for 3–7 days. Samples from 14 cats (numbers 7–20) were also plated onto selective media consisting of Blood Agar Base #2 (Difco), supplemented with 5% horse blood and antibiotics: 50 µg/ml amphotericin B, 100 µg/ml vancomycin, 3.3 µg/ml polymixin B, 200 µg/ml bacitracin, and 10.7 µg/ml nalidixic acid (Sigma, St. Louis, MO, USA). These culture plates were placed in vented jars, which were evacuated in 507–570 mmHg and refilled to atmospheric pressure with a N2, H2, and CO2 mixture (80 : 10 : 10). The jars were then incubated for 3 weeks at 37°C. Plates were checked daily for growth. Suspect colonies were subcultured to a Brucella blood PRAS agar plate and re-incubated. Bacteria were identified as H. pylori by Gram stain, morphology under phase microscopy, oxidase, catalase, and urease reactions, resistance

HEL010.fm Page 4 Thursday, March 29, 2001 4:30 PM

4 to nalidixic acid, and susceptibility to cephalothin. Bacterial colonies were also confirmed as Helicobacter pylori by PCR analysis of bacterial DNA and16srRNA using species specific primers [42]. Electron microscopy Gastric tissue was fixed by immersion in a solution containing 2.5% gluteraldehyde cacodylate (0.1 M)-buffered to pH 7.2. Samples were postfixed in 1% osmium tetroxide, dehydrated, infiltrated, and embedded in Epon araldite. Semi-thin sections cut at 0.5 µm were stained with azure blue. Thin sections, approximately 80 nm thick, were stained with uranyl acetate and lead citrate and examined at 80 kV with a Philips 201 transmission electron microscope (FEI/Philips, Hiilsboro, Oregon, USA). PCR DNA was extracted from biopsies with a Qiamp tissue kit (Qiagen, Santa Clarita, CA, USA). PCR was performed using primers which amplify the urease B gene of H. pylori: F-5′-GGAAT TCCAGATCTATGAAAAAGAT TAGCAGAAAAG-3′; R5′GGAATTC GTCGACCTAGAAAATGCTAAAGAG TTG-3′ [43]. DNA samples (1 µl) from cats 1– 20 were added to a reaction mixture containing 400 µM dNTPs (Pharmacia Biotech, San Francisco, CA, USA), PCR buffer (Gibco BRL, Grand Island, NY, USA), 2 mM MgCl2 (Gibco BRL), 1.5 units of Taq DNA polymerase (Gibco BRL), 0.5 µM of each primer and distilled water in a total volume of 50 µl. PCR samples were heated to 95°C for 5 minutes once, followed by 57°C for 5 minutes once, then 35 cycles of denaturation at 94°C for 1 minute, primer annealing at 57°C for 2 minutes, and extension at 72°C for 1 minute, with a final extension at 72°C for 15 minutes in a Biometra personal thermocycler (Biometra, Tampa, FL, USA). PCR products were subjected to electrophoresis on an agarose gel and visualized with ethidium bromide. When visualized over UV light, a single band at 1707 bp was present when H. pylori (Cornell cat strain 1, ATCC 49503, ATCC 43504, human isolate 8826) was used. This band was absent with DNA from H. felis (ATCC 49179), H. bizzozeronii (ATCC 700030), H. heilmannii (DNA from the stomach of an infected cat), H. salomonis (CCUG 37845), H. fennelliae (ATCC 35684), H. bilis (ATCC 51630), H. hepaticus (ATCC 51450), H. canis (ATCC 51401), H. cinaedii (ATCC 35683) or Campylobacter jejuni (dog isolate) Proteus mirabilis (cat isolate) and Klebsiella.

Simpson et al. Gastric tissue samples and cultured bacterial isolates (from cats 7–20) were also examined by PCR analysis using the H. pylori urease C specific primers. Primer sequences used to amplify the H. pylori urease C gene were 5′-AAAGCT T TTAGGGGTGT TAGGGGT T T-3′ and 5′AAGCT TACT T TCTAACACTAACGC-3′ [44]. Ten microliters of the DNA preparation was added to a 100-µl reaction mixture containing 1X Taq polymerase (2.25 mM/l MgCl2), 200 µM of each deoxynucleotide, 0.5 µM of each primer and 200 µg/ml of BSA. PCR reactions were performed as follows: denaturation at 94°C for 1 minute, annealing at 58°C for 2 minutes, and extension at 72°C for 2 minutes. Thirty-five cycles were used for amplification in a MiniCycler PTC-150 (MJ Research, Inc., Watertown, MA, USA). Helicobacter-genus specific primers C97 and C05 were used to test for 16S rRNA amplicons [45] in tissues from 14 of the 19 SPF uninfected cats. One microliter of DNA was added to the PCR mix described above in a total volume of 50 µl. PCR samples were heated to 94°C for 2.5 minutes once, followed by 40 cycles of denaturation at 94°C for 1 minute, primer annealing at 55°C for 1 minute, and extension at 72°C for 1 minute, with a final extension at 72°C for 15 minutes in a Biometra personal thermocycler (Biometra, Tampa, FL, USA). A band of 1200 bp size was apparent with these primers with DNA from H. pylori (Cornell cat strain 1, ATCC 49503, ATCC 43504, human isolate 8826), H. felis (ATCC 49179), H. bizzozeronii (ATCC 700030), H. salomonis (CCUG 37845), ‘H. heilmannii’ (DNA from the stomach of an infected cat), H. fennelliae (ATCC 35684), H. bilis (ATCC 51630), H. cinaedii (ATCC 35683), H. hepaticus (ATCC 51450) and H. canis (ATCC 51401). This fragment did not amplify with DNA from Campylobacter jejuni (dog isolate) and Proteus mirabilis (cat isolate). To assess bacterial strain homogeneity, RFLP analysis was performed on DNA extracted from the stomach tissue of five H. pylori-infected cats. For RFLP analysis, primer sequences chosen for amplification were specific for the H. pylori flaA gene. These two oligonucleotides, 5′ATG GCT T T T CAG GTC AAT AC3′ and 5′GCT TAA GAT ATT TTG TTG AAC G3′, produced a product of 1.5 Kb. Twenty microliters of amplified DNA was digested with 10 µl of enzyme in the appropriate buffer recommended by the enzyme manufacturer at 37°C for 3 hours. © 2001 Blackwell Science Ltd, Helicobacter, 6, 1– 14

HEL010.fm Page 5 Thursday, March 29, 2001 4:30 PM

5

H. pylori-associated gastritis in cats Table 1 PCR primers for bovine actin and feline IL1-α, IL-1β, IL-8 and TNF-α used to amplify their respective cDNA

Primer BAC-1 BAC-2 IL-1α-F IL-1α-R2 IL-1β-F-Cat IL-1β-R2-Cat IL-8-F4-Cat IL-8-R4-Cat TNF-α-F TNF-α-R

Sequence (5–3’) ATG TTC AGG GAC TTT GGA CG ACC AGC CAT CCA GAC AAA AC TTT GAA GAC CTG AAG AAC TGT TAC GTT TTT GAG ATT CTT AGA GTC AC CAC AGT TTT CTG GGA GAT GAG G TGG CTT ATG TCT CGG AAC GTG T CTC ATT CCA CAC CTT TCA ATC C TTT TAT CTG GCA ACC AAC CC CTC TTC TGC CTG CTG CAC GCC CTT GAA GAG GAC CTG

Restriction enzyme patterns for HhaI and HaeIII were compared after the digested PCR products were run on 3% agarose gels [46]. Histopathology Samples for histopathology were fixed in 10% buffered formalin, embedded in paraffin, and sectioned at 4–6 µm. Serial sections of each block were stained with hematoxylin and eosin (H & E) and modified Steiner’s stain. Samples were separated into two groups, and evaluated according to site (cardia/fundus/body and pyloric antrum). Samples were examined in a blinded fashion by one pathologist (ES), and evaluated for the presence of Helicobacter-like organisms (HLO) and degree of colonization, degree and type of inflammation, and presence of mucosal lymphoid nodules. The degree of colonization by HLO was graded as follows: 0 = no HLO seen; +1 = presence of HLO in < 5% of gastric glands; +2 = presence of HLO in 5–50% of gastric glands; +3 = presence of HLO in > 50% of gastric glands. The degree of mononuclear inflammation, fibrosis and atrophy was graded as follows: +1 = mild, +2 = moderate, +3 = severe. The number of lymphoid follicles was graded as +1 = 1 lymphoid follicle, +2 = 2–3 lymphoid follicles, +3 = > 3 lymphoid follicles per specimen. Cytokine analysis Gastric tissue samples from the pyloric antrum were collected from 14 infected and six uninfected cats (cats 7–26), snap-frozen in liquid nitrogen, and stored at –80 pending analysis. RNA was extracted from the biopsies with an RNA extraction kit according to the manufacturer’s instructions (Qiagen, Chatsworth, CA, USA). To eliminate DNA contamination, samples were treated with 1 U of DNase according to the manufacturer’s instructions (Gibco BRL, © 2001 Blackwell Science Ltd, Helicobacter, 6, 1–14

Expected fragment length 380 bp 545 bp 272 bp 326 bp 288 bp

Rockville, MD, USA). Messenger RNA expression for TNF-α, IL-1α, IL-1β and IL-8 was determined by RT-PCR as previously described [47]. PCR primers for feline IL1-α, IL-1β, IL-8, and TNF-α were used to amplify their respective cDNA (Table 1). The cat IL-8 gene has not previously been sequenced and has been submitted to Gen Bank (#AF 158598). Primers originally designed to amplify a fragment from the published bovine actin sequence amplified a homologous segment of the feline actin and were used to monitor the amount of mRNA in the reaction. PCR was performed using a GeneAmp 9600 PCR system (Perkin Elmer, Foster City, CA, USA) in 25 µl total reaction volume as previously described [47]. The amplification protocol for IL-8 included DNA denaturation at 94°C for 2 minutes, followed by 32 amplification cycles at 94°C for 1 minute, annealing temperature 60°C for 1 minute and 72°C for 1 minute, then terminated with an extension step at 72°C for 6 minutes. PCR fragments were separated in 1.5% agarose gels and visualized with ethidium bromide. Gastrin and somatostatin analysis Plasma gastrin Blood was collected into EDTAcoated tubes after an overnight fast. Blood samples were placed on ice, centrifuged at 4°C and plasma stored at –80°C until analysis. Plasma concentrations of gastrin were determined by radioimmunoassay (Gastrin125I; Becton and Dickinson, Cockeysville MD, USA) at the Department of Endocrinology, The Ohio State University. Assay of tissue somatostatin and gastrin Gastrin and somatostatin were extracted from weighed mucosal samples as described previously [47]. Somatostatin and gastrin-specific radioimmunoassays were performed as previously described [47]. The assays were performed on duplicate samples and the

HEL010.fm Page 6 Thursday, March 29, 2001 4:30 PM

6

Simpson et al.

mean hormone concentration was expressed per mg wet weight.

Table 2 H. pylori colonization in cats

Immunohistochemistry for gastrin and somatostatin cells Immunohistochemistry was performed on deparaffinized tissue from the pyloric antrum using polyclonal rabbit anti-human gastrin 2–17 (1 : 2000) (Peninsula Europe, lot number 801374) and anti-synthetic somatostatin (–14 [som-28 (15 –28)]; 1 : 2000; Genosys, batch number C1002) antibodies and streptavidin-biotin immunoperoxidase technique with aminoethylcarbazole as the chromagen. Non-immune rabbit serum at 1 : 80 was used as a negative control. Numbers of immunoreactive cells in the pyloric antrum were quantified by counting all immunoreactive cells observed in four 6 mm tissue samples from the pyloric antrum (biopsy sites 7–10). The results were expressed as the total number of each cell type and as the ratio of immunoreactive gastrin to somatostatin cells.

H. pylori (n = 20) Uninfected (n = 19)

Cats

MS

Urease

PCR

culture

20/20 0/19

20/20 0/19

20/20a 0/14b

10/20 ND

Colonization was determined by the presence or absence of gastric spiral organisms (modified-Steiner stain – MS), urease production and aH. pylori or bHelicobacter spp. DNA (PCR) in gastric biopsies. The combined results of gastric tissue taken from the pyloric antrum, body, cardia and fundus are presented.

colonization density and histopathology was evaluated using the Kendall correlation coefficient. The effect of gender (M or F) on acid secretion, plasma gastrin, bacterial colonization density and histopathology was evaluated with the Mann– Whitney U-test. Statistical analyses were performed using Statview software (Abacus Concepts, Inc. Berkeley, CA, USA). Significance was set at p < .05.

Measurement of acid secretion

Results

Gastric acid secretion was evaluated in anesthetized cats as described previously [47]. Basal (30 minutes) and pentagastrin-stimulated (Bachem Bioscience Inc, King of Prussia PA: 8 µg/kg/h in 0.9% NaCl, 0.1% albumin) fractions (30–45, 45–60 and 60 – 75 minutes) were collected on ice. Acid secretion was determined by pH measurement, and titration to pH = 7.0 with 0.1 M NaOH, at room temperature. Maximal acid output was calculated using values from the 15-minute period with the highest acidity, and acid output was expressed as peak pH, mM HCl/ml and mM HCl/kg.75/h.

Evaluation of infection status

Statistical analysis Differences in acid secretion, plasma gastrin, gastrin and somatostatin content of pyloric tissue and the number of immunoreactive somatostatin and gastrin cells in infected and uninfected cats were evaluated in infected and uninfected cats using the Mann–Whitney U-test. Differences in gastric bacterial colonization density, inflammation, lymphoid follicles, atrophy and fibrosis between infected and uninfected cats were also evaluated with the Mann–Whitney U-test. Differences in those variables between gastric region (pylorus vs. cardia/body/fundus) were evaluated with the Wilcoxon signed rank test. The effect of age on acid secretion, plasma gastrin, bacterial

Gastric spiral organisms consistent in appearance with H. pylori were visualized in modified Steiner stained sections from 20 cats (numbers 1– 20) ( Table 2). When the density and site of colonization of H. pylori was assessed by light microscopy, it was apparent that the pylorus and body/cardia were similarly colonized (median, range: pylorus 2.0, 1–3; body/cardia 3.0, 1–3). Helicobacter-like organisms were most frequently observed in the superficial gastric mucus layer and in the lumen of gastric glands but were also occasionally observed within parietal cells. Transmission electron microscopy confirmed the presence of H. pylori-like bacteria that were free in gastric mucus and tightly adherent to gastric epithelial cells (Fig. 1), where they were associated with effacement of microvilli. Urease activity tests were positive in all gastric tissue samples from cats 1–20 with similar scores (median 2.0; range 1–3) in the cardia, body and pylorus. PCR of gastric biopsies using primers for the H. pylori urease B gene were positive in all samples from cats 1–20 (Fig. 2). Samples from infected cats (numbers 7–20) were additionally positive by PCR analysis of gastric biopsies using primers for the H. pylori urease C gene. Culture recovered H. pylori from 10/20 infected cats. The 16S rRNA sequence from one © 2001 Blackwell Science Ltd, Helicobacter, 6, 1– 14

HEL010.fm Page 7 Thursday, March 29, 2001 4:30 PM

7

H. pylori-associated gastritis in cats Gastric histopathology

No gastric erosions or ulcers were observed in any cat during upper gastrointestinal endoscopy or necropsy. Blinded evaluation of tissue specimens revealed significantly more mononuclear inflammation, lymphoid follicles, atrophy and fibrosis in the stomachs of H. pylori-infected cats (Table 3). Neutrophilic infiltrates were detected in the pylorus of 6/20, and the body/cardia of 1/20 infected cats, and eosinophilic infiltrates in the pylorus or body/cardia of 4/20 infected cats ( Fig. 3). The degree of mononuclear inflammation, lymphoid follicle hyperplasia, atrophy and fibrosis was always higher in the pylorus than in the body/cardia. Areas of dysplastic or hyperplastic epithelium were detected in the pylorus of the two oldest (10 and 11 years) infected cats (Fig. 4). Minimal histological abnormalities were detected in gastric tissue from uninfected cats. However, there was significantly more mononuclear inflammation and fibrosis in the pylorus of uninfected cats than in the body/cardia. Lymphoid follicles were only detected in 1/19 uninfected cats, and neutrophilic and eosinophilic infiltrates, and epithelial dysplasia, were not observed in tissue from uninfected cats. There was no effect of age or gender on H. pylori colonization density or the degree of mucosal abnormalities in either infected or uninfected cats.

Figure 1 Electron micrograph of a gastric biopsy from an H. pylori-infected cat (number 2). Note the ‘lazy-S’ shape, close proximity to gastric epithelial cells and effacement of microvilli.

Figure 2 Detection of H. pylori urease B gene in gastric tissue by PCR. Lane M = DNA ladder; Lanes 1– 8 = cats 13– 20; Lane 9 = negative control; Lane 10 = DNA from H. pylori.

Gastric cytokines Analysis of gastric tissue by RT-PCR showed actin amplification in 14/20 samples. Actin amplification was inconsistent in the endoscopic biopsies obtained from six infected cats (cats 7– 12). Further analysis of the 14 samples with actin amplification (Fig. 5) showed appropriate reactions for positive (cat bronchial macrophages) and negative control samples and no evidence of up-regulation of IL-1α, IL-1β, IL-8 or TNF-α mRNA in uninfected cats. Up-regulation of IL1β and IL-8 was observed in 1/8 and 6/8

isolate was identical to the sequence of H. pylori cat strain DO1 (GenBank HPU08906). HhaI and HaeIII restriction enzyme patterns for the H. pylori flaA gene amplified from DNA extracted from gastric tissue in five infected cats were identical. Helicobacter-like organisms were not visualized in tissue samples from the SPF cats (cats 21–39) and gastric tissue from those cats was uniformly negative for urease activity and Helicobacter DNA using Helicobacter genus-specific primers.

Table 3 Histopathological findings in cats with H. pylori infection Mononuclear inflammation Pylorus Infected (n = 20) Uninfected (n = 19)

1.0ac (0 –3) 0d (0 –1)

Body/cardia 0b (0–2) 0 (0–1)

Lymphoid follicles Pylorus 2.0ac (0–3) 0 (0–2)

Body/cardia 0b (0–1) 0 (0–0)

Atrophy Pylorus 1.0ac (0 – 2) 0 (0–1)

Body/cardia 0b (0–2) 0 (0–0)

Fibrosis Pylorus 2.0ac (1– 2) 1.0d (0–2)

Body/cardia 0a (0–2) 0 (0–0)

Mononuclear inflammation, lymphoid follicles, atrophy and fibrosis were graded on a scale of increasing severity from 0 to 3 (Median (range) ). Infected vs. uninfected a = p < .008, b = p < .05; Pylorus vs. body/cardia, c = p < .005, d = p < .01. © 2001 Blackwell Science Ltd, Helicobacter, 6, 1–14

HEL010.fm Page 8 Thursday, March 29, 2001 4:30 PM

8

Simpson et al.

Figure 3 Mononuclear and neutrophilic infiltrates (grade 3) in the pyloric antrum of a 6-month-old cat infected with H. pylori. H & E.

Figure 4 Epithelial dysplasia in the pyloric antrum of an 11-year-old cat infected with H. pylori. H & E.

H. pylori-infected cats, respectively. Concurrent up-regulation of IL-1β and IL-8 was present in the cat with the strongest up-regulation of IL-8. This cat was an 11-year-old cat with the most severe grade of inflammation and dysplastic/ hyperplastic epithelial cells on histopathology.

(37, 18–60) cats. There was no correlation between the density of bacterial colonization or mucosal inflammation in the pylorus or the cardia/body and serum gastrin. An effect of age or gender on gastrin concentration was not observed. Antral somatostatin and gastrin

Plasma gastrin There was no significant difference in fasting plasma gastrin concentrations (pM/ml; median, range) between H. pylori-infected (25, 18 – 62) and uninfected

The amount of somatostatin (fM/ mg) in antral tissue was lower ( p < .01) in uninfected (n = 6, median, range: 66.2, 19–243) than in H. pyloriinfected (n = 14, median 394.2, range 67 –701)

Figure 5 Detection of mRNA for actin, IL1-α, IL1-β, IL-8 and TNF-α in endoscopic biopsy specimens by RT-PCR. Agarose gel electrophoresis of DNA products. Lanes i–vi = uninfected cats, Lanes 1–8 = infected cats, Lane + = positive control (cat bronchial macrophages). P = pylorus, B = body, C = cardia. © 2001 Blackwell Science Ltd, Helicobacter, 6, 1– 14

HEL010.fm Page 9 Thursday, March 29, 2001 4:30 PM

9

H. pylori-associated gastritis in cats cats. The number of immunoreactive somatostatin cells in antral biopsies also tended to be (p = .06) lower in uninfected (median 34, range 0–256) than H. pylori-infected (median 142, range 13–998) cats. An association (n = 20, Ro = 0.660, p < .02) between tissue somatostatin and the number of immunoreactive somatostatin cells was observed. The amount of gastrin and the number of immunoreactive gastrin cells in antral tissue was not significantly different in uninfected (n = 6, tissue gastrin pM/mg, median 20.2, range 0.69 – 45; immunoreactive cells, median 770, range 256 – 1028) and infected (n = 14, tissue gastrin pM/ mg, median 46, range 0.39–441: immunoreactive cells 155, range 38–2035) cats. There was no correlation (n = 20, Ro = –0.26, p = .92) between the number of immunoreactive gastrin cells and the tissue content of gastrin. The ratio of gastrin : somatostatin product was similar in uninfected (179, 36–2000) and infected (median, range; 152, 5.8–891) cats. The ratio of immunoreactive gastrin : somatostatin cells was higher (p < .001) in uninfected (median 18.7, range 3 – 64) than infected (median 1.6, range 0.3–6.2) cats. Acid secretion Gastric secretion during the basal period (0–30 minutes) was low in volume, and titratable acidity could not be reliably determined. Pentagastrin stimulated acid output was usually maximal during the 60–75-minute period. Total acid output (mM/kg.75/hr), and the acidity of gastric juice during maximal output (pH, mM HCl/ml), was similar in H. pylori-infected and uninfected cats (Table 4). There was no effect of age on total acid output, but there was an effect of age on the acidity of gastric juice (pH Ro –0.671, p = .003; mM HCl/ ml Ro – 0.534, p = .02). However, comparison of 12 age-matched infected and uninfected cats showed similar acidity of gastric juice in both groups. There was no effect of gender on total

acid output in infected cats, although female infected cats had lower pH of gastric juice ( p = .006) than infected males. Conversely, infected females had lower titratable acidity ( p = .02) than infected males. Comparison of infected and uninfected males showed similar acid output and titratable acidity, but lower pH ( p = .04) in uninfected males. There was no relationship of bacterial colonization density or mucosal inflammation to acid output or gastric acidity in infected cats. Discussion

This study has evaluated the relationship of H. pylori infection to gastric colonization, inflammation and function in cats. The infected cats in the present study were obtained from a commercial colony known to be infected with H. pylori [37–39]. Infection was confirmed by light and electron microscopy, urease activity tests and by PCR with H. pylori urease B and C specific primers, culture and 16S rRNA sequence. The genetic homogeneity of the H. pylori strain infecting cats from this closed colony was demonstrated by the restriction enzyme digestion patterns of the H. pylori flaA gene. The 16S rRNA sequence of one of the H. pylori isolates in the present study was also identical to the original isolate from the same colony of cats five years previously (H. pylori DO1 GenBank HPU08906), that is 99.7% similar to the type strain of H. pylori [37]. While the exact duration of infection in each cat is not known, we know that the colony has been infected since 1992 [37], and every cat we have obtained from the colony has been infected. Infection in this colony is acquired at a young age, with cats as young as 6 – 8 weeks infected. In the present study cats as young as 6 months old were colonized in a similar fashion to cats up to 11 years old. The original source of the infection is unknown, but it may have been acquired from a human [48].

Table 4 Acid secretion in cats with H. pylori infection

mM/kg.75/hr All H. pylori infected Uninfected

(n = 20) Male (n = 9) Female (n = 11) Male (n = 19)

1.4 (0.4–2.1) 1.3 (0.4–1.9) 1.4 (0.8–2.1) 1.2 (0.6–2.7)

pH 1.0 (0.8–1.4) 1.1 (0.9–1.4) 0.9 (0.8–1.0)** 0.9 (0.9–1.1)*

mM HCl/ml 0.14 (0.08 – 0.16) 0.15 (0.08 – 0.16) 0.13 (0.12 – 0.14)* 0.15 (0.11– 0.22)

Pentagastrin-stimulated gastric acid secretion (median, range) during the 15-minute period with the highest acidity in Helicobacter pylori infected and uninfected cats. Compared with infected male cats **p < .01, *p < .05. © 2001 Blackwell Science Ltd, Helicobacter, 6, 1–14

HEL010.fm Page 10 Thursday, March 29, 2001 4:30 PM

10 The pangastric colonization, mucosal localization and predominantly mononuclear inflammatory response observed in the present study are similar to previous reports of H. pylori infection in cats [37,38]. In the present study atrophy and fibrosis were also more severe in H. pylori-infected cats, and the pylorus was more severely affected than the cardia or body region, despite similar bacterial colonization density at all sites. The degree of gastritis was higher in the H. pylori-infected cats in the present study than in cats infected with H. felis [47]. The similar colonization density in the fundus and pylorus of H. pylori-infected cats, and their tight adherence to the gastric mucosa that was associated with effacement of microvilli and collapse of glandular structure is comparable with H. pylori infection in people [49–51]. The pattern of gastric colonization in H. pylori-infected cats is also similar to that observed in non-human primates and contrasts with the marked antral dominance of colonization in both the gerbil and C57BL6 SS1 mouse models of H. pylori infection [52–54]. The spectrum of mucosal abnormalities observed in H. pylori-infected cats closely resembles findings in children, in whom gastritis is characterized by mononuclear cells and lymphoid follicles with less severe polymorphonuclear cell infiltrates than adult humans [55–57]. The antral predominant effects of H. pylori on gastric histopathology in cats is similar to its effects in gerbils and non-human primates but not C57BL6 mice, where pathological abnormalities are mostly observed in the fundus [36,53,54]. The predominantly mononuclear gastritis and absence of peptic ulcers in H. pylori-infected cats compared to many adult humans may relate to differences in bacterial or host-associated factors or the duration of infection. In this respect the situation is likely similar to H. pylori and H. felis infection in other animal species, where the species and strain of the host can determine the density of bacterial colonization, and the degree and type of inflammation observed in response to infection [53,54,58–60]. As gastritis in human adults colonized with cagA−picB− strains is characterized by a limited degree of neutrophil infiltration compared to those infected with cagA+picB+ strains, the predominantly mononuclear gastritis observed in cats in the present study may be caused by colonization with a strain lacking cagA and picB [46,51,61]. Initial testing of this hypothesis by infecting cats with a

Simpson et al. nominally cagA+picB+ H. pylori strain revealed similar histological findings in cats infected with cagA−picB− and cagA+picB+ over a 15-week period [46] and suggests that it may be host factors, rather than the bacterial strain, that are important. However, as infection in children is rarely associated with disease, despite colonization by H. pylori strains associated with disease in adults [55–57], perhaps it is the duration of infection that is important. In this respect it is noteworthy that the cat with the highest histological grade of gastritis, that also expressed IL-1β and IL-8, was the oldest infected cat (11 years). Areas of hyperplastic or dysplastic epithelium were also detected in gastric tissue from the two oldest infected cats. The development of assays to measure IL-1α, IL-1β, IL-8 and TNF-α mRNA up-regulation in cats enabled us to evaluate the relationship of infection to antral mucosal cytokine/chemokine induction and gastric function. Up-regulation of IL-8 was detected in the antrum of 6/8 infected cats and was absent from uninfected cats. Concurrent up-regulation of IL-1β and IL-8 was present in the cat with the strongest up-regulation of IL-8. This cat was an 11-year-old cat with the most severe grade of inflammation and dysplastic / hyperplastic epithelial cells on histopathology. The antral predominance of gastritis, and the association of H. pylori infection with the upregulation of antral IL1-β and IL-8 is similar to humans infected with H. pylori that develop hypersecretion of gastric acid and peptic ulcer [8–10,51,61]. The detection of IL-8 in the gastric mucosa of cats is highly relevant to the use of animal models of H. pylori infection, as IL-8, which is thought to play a major role in promoting neutrophil infiltration in the stomachs of infected people, does not appear to be present in mice [62,63]. As picB/cagE is required for the induction of IL-8 in cultured gastric epithelial cells [64,65], it is interesting that the expression of IL-8 in the present study was associated with infection with the cagA–picB– strain of H. pylori isolated from cats (46, Simpson and Berg, unpublished observations]. Our observations are consistent with in vivo findings in humans with H. pylori infection, in whom there is an overlap in the degree of IL-8 induction, the severity of gastritis, and the clinical outcome of patients infected with cagA– and cagA+ strains [10,51,61,66]. Although the absence of cagA does not ensure the absence of the PAI [66], the IL-8 induction in these patients © 2001 Blackwell Science Ltd, Helicobacter, 6, 1– 14

HEL010.fm Page 11 Thursday, March 29, 2001 4:30 PM

H. pylori-associated gastritis in cats [10,51,61] and cats may arise from epithelial cells by alternate mechanisms such as that mediated by HP0638 outer inflammatory protein (oipA) [67] and TNFα [65], or from non-epithelial cells such as macrophages [68]. Other virulence independent factors, such as antral colonization density, may also have an important influence on antral cytokine induction in H. pylori-infected people [51]. The marked lymphoid follicular hyperplasia in the antrum of H. pylori-infected cats in the present study is similar to previous reports of cats experimentally infected with H. pylori or H. felis [37,38,47] and cats with naturally acquired infection with HLO [69,70]. Our observations support those of others who described an absence of lymphoid follicles in uninfected cats [69,70]. These observations are of importance with respect to the development of mucosa-associated lymphoid tissue (MALT)lymphoma. H. pylori infection in people is strongly associated with the development of gastric MALT, and MALT-lymphoma, and the eradication of Helicobacter has caused remission of MALT-lymphoma in people [3,4]. H. felis and H. mustelae infection have also been associated with lymphoid follicular hyperplasia, MALToma-like lesions and alimentary lymphoma [47,71]. In cats, lymphoma accounts for 26–33% of malignant tumors, and alimentary lymphoma is the most common anatomic form [72,73]. Given the marked lymphoid follicular hyperplasia in cats in response to infection with a variety of Helicobacter spp., and the high prevalence of infection with Helicobacter spp. in pet cats, the relationship of these bacteria to gastric lymphoma merits further investigation. The absence of abnormalities in pentagastrinstimulated gastric acid secretion in clinically healthy cats that were densely colonized with H. pylori with antral dominant gastritis but no evidence of gastroduodenal ulceration, parallels findings in asymptomatic people with H. pylori infection [12,13]. In contrast to asymptomatic infected humans in whom fasting serum gastrin is elevated, serum gastrin concentrations were similar in infected and uninfected cats [13,18]. These differences may relate to the techniques used. For example, the measurement of fasting, rather than meal stimulated, gastrin, may have failed to expose hypergastrinemia in clinically healthy infected cats [12,74]. The evaluation of acid secretion in response to pentagastrin in the present study, rather than bombesin or GRP, © 2001 Blackwell Science Ltd, Helicobacter, 6, 1–14

11 may also have limited our ability to detect gastric hypersecretion [74]. Additionally, anaesthesia may have influenced acid output. Although we have previously demonstrated that pentagastrinstimulated acid output is a reproducible technique in anaesthetized cats [47], we were concerned that anaesthetized cats may have a markedly lower acid output than conscious cats. Comparison of gastric acid output in the anaesthetized H. pylori-infected cats in the present study (median 0.9 mM/15 minutes) is, however, comparable to conscious cats of unknown Helicobacter-infection status with gastric fistulae, where acid output (mean ± SD) in response to pentagastrin (8 µg/kg/hr) ranged from 1.2 mM/15 minutes to 1.4 ± 0.5 mM/15 minutes [75,76]. While pentagastrin stimulation may have affected our ability to detect gastric hypersecretion, it is highly unlikely that achlorhydria was present in H. pylori-infected cats as pentagastrin is the most sensitive method for detecting hypochlorhydria [17,74]. Thus the findings of the present study argue against a significant inhibitory effect of urease, ammonia, or acid inhibitory factors produced by these bacteria [31,32] on the gastric acid secretion in the cat. Our findings are comparable to those in rats infected with either H. felis or H. heilmannii, and to those in cats infected with H. felis where fasting or stimulated gastrin, and acid secretion, were similarly unchanged in the face of dense colonization [47,77]. In a similar vein, only eight of 91 H. pylori-infected gerbils with dense antral colonization and antrum dominant gastritis had changes in fasting gastrin [53]. In conclusion, the pattern of colonization and the mucosal inflammatory response in cats with naturally acquired H. pylori are broadly similar to those in infected people, particularly children, and non-human primates. The upregulation of IL-8 was restricted to infected cats and was independent of cagA and picB. Our findings argue against a direct acid-suppressing effect of H. pylori on the gastric secretory-axis in chronically infected cats. This study was supported by grants from the Winn Feline Foundation, the Cornell Feline Health Center and NIH RO1AIRR37740. We thank Bruce Paster for 16S rRNA sequencing, Brent Howe for gastrin analysis, Anita Alisio and Shannon Caldwell for electron microscopy, Robert P. Marini for assistance with anaesthesia and endoscopy and Hollis Erb for statistical advice.

HEL010.fm Page 12 Thursday, March 29, 2001 4:30 PM

12 References 1 Warren JR, Marshall B. Unidentified curved bacilli on gastric epithelium in active chronic gastritis. Lancet 1983;1:1273–5. 2 Parsonnet J, Friedman GD, Vandersteen DP. Helicobacter pylori infection and the risk of gastric carcinoma. N Engl J Med 1991;325: 1127–31. 3 Parsonnet J, Hansen S, Rodriguez L, Gelb AB, Warnke RA, Jellum E, Orentreich N, Vogelman JH, Friedman JD. Helicobacter pylori infection and gastric lymphoma. N Engl J Med 1994;330: 1267– 71. 4 Wotherspoon AC, Doglioni C, Diss TC, Pan LX, Moschini A, Debomi M, Isaacson PG. Regression of primary low-grade B-cell gastric lymphoma of mucosa-associated lymphoid tissue type after eradication of Helicobacter pylori. Lancet 1993;342:575–7. 5 Lee A, Fox JG, Hazell S. Pathogenicity of Helicobacter pylori. A Perspective. Inf Immun 1993; 61:1601–10. 6 NIH Consensus Conference. Helicobacter pylori in peptic ulcer disease. J Am Med Assoc 1994;272:65–9. 7 Tompkins LS, Falkow S. The new path to preventing ulcers. Science 1995;267:1621–2. 8 Lindholm C, Quiding-Jarbrink M, Lonroth H, Hamlet A, Svennerholm AM. Local cytokine response in Helicobacter pylori-infected subjects. Inf Immun 1998;66:5964–71. 9 Noach LA, Bosma NB, Jansen J, Hoek FJ, van Deventer SJH, Tytgat GNJ. Mucosal tumor necrosis factor-α, Interleukin-1β, and interleukin-8 production in patients with Helicobacter pylori infection. Scand J Gastroenterol 1994;29:425–9. 10 Peek RM, Miller GG, Tham KT, Perez-Perez GI, Zhao X, Atherton JC, Blaser MJ. Heightened inflammatory response and cytokine expression in vivo to cagA+ Helicobacter pylori strains. Laboratory Invest 1995;71:760–70. 11 Moss SF, Calam J. Acid secretion and sensitivity to gastrin in patients with duodenal ulcer: effect of eradication of Helicobacter pylori. Gut 1993;34:888–92. 12 El-Omar E, Penman I, Ardill JES, McColl KEL. A substantial proportion of non-ulcer dyspepsia patients have the same abnormality of acid secretion as duodenal ulcer patients. Gut 1995;36: 534–8. 13 El-Omar E, Penman ID, Ardill JES, Chittajallu RS, Howie C, McColl KEL. Helicobacter pylori infection and abnormalities of acid secretion in patients with duodenal ulcer disease. Gastroenterology 1995;109:681–91. 14 Morris A, Nicholson G. Ingestion of Campylobacter pyloridis causes gastritis and raised fasting gastric pH. Am J Gastroenterology 1987;82: 192–9.

Simpson et al. 15 Sobala GM, Crabtree J, Dixon MF, Schorah CJ, Taylor JD, Rathbone BJ, Heatley RV, Axon ATR. Acute Helicobacter pylori infection: clinical features, local and systemic immune response, gastric mucosal histology, and gastric juice ascorbic acid concentrations. Gut 1991;32:1415–8. 16 McGowan CG, Cover TL, Blaser MJ. Helicobacter pylori and gastric acid: biological and therapeutic implications. Gastroenterology 1996; 110: 926–38. 17 El-Omar EM, Oien K, El-Nujumi A, Gillen D, Wirz A, Dahill S, Williams C, Ardill JES, McColl KEL. Helicobacter pylori infection and chronic gastric acid hyposecretion. Gastroenterology 1997;113:15–24. 18 Gillen D, El-Omar EM, Wirz AA, Ardill JES, McColl KEL. The acid response to gastrin distinguishes duodenal ulcer patients from Helicobacter pylori-infected healthy subjects. Gastroenterology 1998;114:50–7. 19 Watson SA, Morris TM, Varro A, Michaeli D, Smith AM. A comparison of the therapeutic effectiveness of gastrin neutralisation in two human gastric cancer models: relation to endocrine and autocrine/paracrine gastrin mediated growth. Gut 1999;45:812–7. 20 Moss SF, Legon S, Davies J, Calam J. Cytokine gene expression in Helicobacter pylori associated antral gastritis. Gut 1994;35:1567–70. 21 Moss SF, Legon S, Bishop AE, Polak JM, Calam J. Effect of Helicobacter pylori on gastric somatostatin in duodenal ulcer disease. Lancet 1992;340: 930–2. 22 Quieroz DMM, Mendes EN, Rocha GA, et al. Effect of Helicobacter pylori eradication on antral gastrin- and somatostatin-immunoreactive cell density and gastrin and somatostatin concentrations. Scand J Gastroenterol 1993;28:858–64. 23 Beales ILP, Calam J. Interleukin-1β and tumour necrosis factor-α inhibit acid secretion in cultured rabbit parietal cells by multiple pathways. Gut 1998;42:227–34. 24 Beales ILP, Post L, Calam J, Yamada T, Delvalle J. Tumour necrosis factor alpha stimulates gastrin release from canine and human antral G cell: possible mechanism of the Helicobacter pylori-gastrin link. European J Clin Invest 1996;26:609–11. 25 Beales I, Blaser MJ, Srinivasan S, Calam J, PerezPerez GI, Yamada T, Scheiman J, Post L, Del Valle J. Effect of Helicobacter pylori products and recombinant cytokines on gastrin release from cultured canine G cells. Gastroenterology 1997; 113: 465–71. 26 Lehmann FS, Golodner EH, Wang J, Chen MCY, Avedian D, Calam J, Walsh JH, Dubinett S, Soll AH. Mononuclear cells and cytokines stimulate gastrin release from canine antral cells in primary culture. Am J Physiol 1996;270: G783–G788. © 2001 Blackwell Science Ltd, Helicobacter, 6, 1– 14

HEL010.fm Page 13 Thursday, March 29, 2001 4:30 PM

H. pylori-associated gastritis in cats 27 Dial EJ, Hall LR, Romero JJ, Lichtenberger LM. Rats with gastritis have increased sensitivity to the gastrin stimulatory effects of luminal ammonia. Gastroenterology 1996;110:801–8. 28 Lichtenberger LM, Dial EJ, Romero JJ, Lechago J, Jarboe LA, Wolfe MM. Role of luminal ammonia in the development of gastropathy and hypergastrinemia in the rat. Gastroenterology 1995;108: 320–9. 29 Beales ILP, Calam J. The H3 histamine receptor agonist Nα-methylhistamine produced by Helicobacter pylori does not alter somatostatin release from cultured rabbit fundic d-cells. Gut 1998;43:176–81. 30 Prinz C, Neumayer N, Mayr S, Classen M, Scepp W. Functional impairment of rat enterochromaffinlike cells by interleukin-1β. Gastroenterology 1997;112:364–5. 31 Cave DR. Helicobacter pylori and its interaction with chief and parietal cells. Yale J Biol Med 1996;69:91–8. 32 Vargas M, Lee A, Fox JG, Cave DR. Inhibition of acid secretion from parietal cells by non-humaninfecting Helicobacter species: a factor in colonization of gastric mucosa? Infect Immun 1991;59: 3694–9. 33 Fox JG, Lee A. The role of Helicobacter species in newly recognized gastrointestinal tract diseases of animals. Lab Anim Sci 1997;47:222–55. 34 Nedrud JG. Animal models for gastric Helicobacter immunology and vaccine studies. FEMS Immunol Med Mic 1999;24:243–50. 35 Baskerville A, Newell DG. Naturally occurring chronic gastritis and C. pylori infection in the rhesus monkey: a potential model for gastritis in man. Gut 1988;29:465–72. 36 Dubois A, Berg DE, Incecik ET, Fiala N, Heman-Ackah LM, Del Valle J, Yang M, Wirth HP, Perez-Perez GI, Blaser MJ. Host specificity of Helicobacter pylori strains and host responses in experimentally challenged nonhuman primates. Gastroenterology 1999;116:1–8. 37 Handt LK, Fox JG, Dewhirst FE, Fraser GJ, Paster BJ, Yan LL, Rozmiarek H, Rufo R, Stalis H. Helicobacter pylori isolated from the domestic cat: public health implications. Infect Immun 1994;62:2367–74. 38 Fox JG, Batchelder M, Marini R, Yan L, Handt L, Li X, Shames B, Hayward A, Campbell J, Murphy JC. Helicobacter pylori-induced gastritis in the domestic cat. Infect Immun 1995;63: 2674–81. 39 Fox JG, Perkins S, Yan L, Shen Z, Attardo L, Pappo J. Local immune response in Helicobacter pylori- infected cats and identification of H. pylori in saliva, gastric fluid and faeces. Immunol 1996;88:400–6. 40 Lee A, Krakowka S, Fox JG, Otto G, Eaton KA, Murphy JC. Role of Helicobacter felis in chronic canine gastritis. Vet Pathol 1992;29:487–94. © 2001 Blackwell Science Ltd, Helicobacter, 6, 1–14

13 41 Radin MJ, Eaton KA, Krakowka S, Morgan DR, Lee A, Otto G, Fox JG. Helicobacter pylori gastric infection in gnotobiotic beagle dogs. Infect Immun 1990;58:2606–12. 42 Fox JG, Yan L, Dewhirst FE, Paster BJ, Shames B, Murphy JC, Hayward A, Belcher JC, Mendes EN. Helicobacter bilis sp-nov, a novel Helicobacter species isolated from bile, livers, and intestines of aged inbred mice. J Clin Micro 1995;33: 445–54. 43 Neiger R, Dieterich C, Burnens A, Waldvogel A, Corthesy-Theulaz I, Halter F, Lauterburg B, Schmassman A. Detection and prevalence of Helicobacter infection in pet cats. J Clin Micro 1998;36:634–7. 44 Bickley J, Owen RJ, Frazer AG, Pounder RE. Evaluation of the polymerase chain reaction for detecting the urease C gene of Helicobacter pylori in gastric biopsy samples and dental plaque. J Med Microbiol 1993;39:338–44. 45 Fox JG, Dewhirst FE, Shen Z, Feng Y, Taylor NS, Paster BJ, Ericson RL, Lau CN, Correa P, Araya JC, Roa I. Hepatic Helicobacter species identified in bile and gallbladder tissue from Chileans with chronic cholecystitis. Gastroenterology 1998;114: 755–63. 46 Perkins SE, Fox JG, Marini RP, Shen Z, Dangler CA, Ge Z. Experimental infection in cats with a cagA+ human isolate of Helicobacter pylori. Helicobacter 1998;3:225–35. 47 Simpson KW, Strauss-Ayali D, Scanziani E, Straubinger RK, McDonough PL, Straubinger AF, Chang Y-F, Domeneghini C, Arebi N, Calam J. Helicobacter felis infection is associated with lymphoid follicular hyperplasia and mild gastritis but normal gastric secretory function in cats. Infect Immun 2000;68:779–90. 48 El-Zaatari FAK, Woo JS, Badr A, Osato MS, Serna H, Lichtenberger LM, Genta RM, Graham DY. Failure to isolate Helicobacter pylori from stray cats indicates that H. pylori in cats may be an anthroponosis-an animal infection with a human pathogen. J Med Microbiol 1997;46: 372–6. 49 Noach LA, Rolf TM, Tytgat GNJ. Electron micrsocopic study of the association between H. pylori and gastric and duodenal mucosa. J Clin Pathol 1994a;47:699–704. 50 Taniguchi Y, Kimura K, Satoh K, Yoshida Y, Tajimoto T, Saifuku K, Ido K, Ookawara S, Mato M. Helicobacter pylori detected deep in gastric glands: an ultrastructural quantitative study. J Clin Gastroenterol 1995;21:169–73. 51 Yamaoka Y, Kodama T, Kita M, Imanishi J, Kashima K, Graham DY. Relation between clinical presentation, Helicobacter pylori density, interleukin 1 beta and 8 production, and cagA status. Gut 1999;45:804–11. 52 Lee CK, Soike K, Hill J, et al. Immunization with recombinant Helicobacter pylori urease decreases

HEL010.fm Page 14 Thursday, March 29, 2001 4:30 PM

14

53

54

55

56

57

58

59

60

61

62

63

64

Simpson et al. colonization levels following experimental infection of rhesus monkeys. Vaccine 1999;17:1493–505. Peek RM, Wirth HP, Moss SF, Yang M, Abdalla AM, Tham KT, Zhang T, Tang LH, Modlin IM, Blaser MJ. Helicobacter pylori alters gastric epithelial cell cycle events and gastrin secretion in mongolian gerbils 2000;118:48–59. Lee AO, Rourke J, DeUngria MC, Robertson B, Daskalopoulos G, Dixon MF. A standardized mouse model of Helicobacter pylori infection: introducing the Sydney strain. Gastroenterology 1997;112:1386–97. Mitchell HM, Bohane TD, Tobias V, Bullpitt P, Daskalopoulos G, Carrick J, Mitchell JD, Lee A. Helicobacter-pylori infection in children – potential clues to pathogenesis. J Ped Gastro Nut 1993;16:120–5. Mitchell HM, Hazell SL, Bohane TD, Hu PJ, Chen MH, Li YY. The prevalence of antibody to CagA in children is not a marker for specific disease. J Pediatric Gastr Nutr 1999;28:71–5. Elitsur Y, Neace C, Werthamer MC, Triest WE. Prevalence of CagA, VacA antobodies in symptomatic and asymptomatic children with Helicobacter pylori Infection. Helicobacter 1999;2:100–5. Fox JG, Lee A, Otto G, Taylor NS, Murphy JC. Helicobacter felis gastritis in gnotobiotic rats: an animal model of Helicobacter pylori gastritis. Infect Immun 1991;59:785–91. Mohammadi M, Redline R, Nedrud J, Czinn S. Role of the host in pathogenesis of Helicobacterassociated gastritis: H. felis infection of inbred and congenic mouse strains. Infect Immun 1996; 64:238–45. Sakagami T, Dixon ME, O’Rourke J, Howlett R, Alderuccio F, Vella J, Shimoyama T, Lee A. Atrophic gastric changes in both Helicobacter felis and Helicobacter pylori-infected mice are host dependent and separate from antral gastritis. Gut 1996;39:639–48. Yamaoka Y, Kodama T, Kita M, Imanishi J, Kashima K. Induction of various cytokines and development of severe mucosal inflammation by cag A gene positive Helicobacter pylori strains. Gut 1997;41:442–51. Cacalano G, Lee J, Kikly K, Ryan AM, Pitts-Meek S, Hultgren B, Wood WI, Moore MW. Neutrophil and B cell expansion in mice that lack the murine IL-8 receptor homolog. Science 1994;265:682–4. Morgan SJ, Moore MW, Cacalano G, Ley K. Reduced leukocyte adhesion response and absence of slow leukocyte rolling in interleukin-8 receptordeficient mice. Microvascular Res 1997;54: 188–91. Tummuru MKR, Sharma SA, Blaser MJ. Helicobacter pylori picB, a homologue of the Bordetella pertussis toxin secretion protein, is required for induction of IL-8 in gastric epithelial cells. Mol Microbiol 1995;18:867–76.

65 Li SDD, Kersulyte D, Lindley IJD, Neelam B, Berg DE, Crabtree JE. Multiple genes in the left half of the cag pathogenicity island of Helicobacter pylori are required for tyrosine kinase-dependent transcription of interleukin-8 in gastric epithelial cells. Infect Immun 1999;67:3893–9. 66 Jenks P, Megraud F, Labigne A. Clinical outcome after infection with Helicobacter pylori does not appear to be reliably predicted by the presence of any of the genes of the cag pathogenicity island. Gut 1998;43:752–8. 67 Yamaoka Y, Kwon DH, Graham DY. A Mr 34,000 proinflammatory outer membrane protein (oipA) of Helicobacter pylori. PNAS, 2000;97: 7533–7538. 68 Harris PR, Ernst PB, Kawabata S, Kiyono H, Graham MF, Smith PD. Recombinant Helicobacter pylori urease activates primary mucosal macrophages. J Infectious Dis 1998;178:1516–20. 69 Happonen I, Saari S, Castren L, Tyni O, Hanninen ML, Westermarck E. Occurrence and topographical mapping of gastric Helicobacter-like organisms and their association with histological changes in apparently healthy dogs and cats. J Vet Med A 1996;43:305–15. 70 Hermanns W, Kregel K, Breuer W, Lechner J. Helicobacter-like organisms: histopathological examination of gastric biopsies from dogs and cats. J Comp Path 1995;112:307–18. 71 Enno A, O’Rourke JL, Howlett CR, Jack A, Dixon MF, Lee A. MALToma-like lesions in the murine gastric mucosa after long-term infection with Helicobacter felis. Am J Pathol 1995;147: 217–22. 72 Mahony OM, Moore AS, Cotter SM, Engler SJ, Brown D, Penninck DG. Alimentary lymphoma in cats: 28 Cases 1988–93. J. Am. Vet. Med. Assoc. 1995;207:1593–8. 73 Vail DM, Moore AS, Ogilvie GK, Volk LM. Feline lymphoma (145 cases): Proliferation indices, cluster of differentiation 3 immunoreactivity, and their association with prognosis in 90 cats. J Vet Intern Med 1998;12:349–54. 74 McColl KEL, El-Omar E. Review article: gastrin releasing peptide and its value in assessing gastric secretory function. Aliment Pharmacol Ther 1995;9:341–7. 75 Dinbar A, Grossman MI. Interaction of stimulants of acid secretion in cat. Gastroenterology 1972;62:242–6. 76 Vagne M, Gelin ML, McDonald TJ, Chayvialle JA, Minaire Y. Effect of bombesin on gastric secretion and motility in the cat. Digestion 1982;24:5–13. 77 Danon SJ, Moss ND, Larsson H, Arvidsson S, Dixon MF, Lee A. Gastrin release and gastric acid secretion in the rat infected with either Helicobacter felis or Helicobacter heilmannii. J Gastroenterol 1998;13:95–103. © 2001 Blackwell Science Ltd, Helicobacter, 6, 1– 14