Clinical Chemistry 46:8 1072–1077 (2000)

Molecular Diagnostics and Genetics

Rapid Detection of the CYP2D6*3, CYP2D6*4, and CYP2D6*6 Alleles by Tetra-Primer PCR and of the CYP2D6*5 Allele by Multiplex Long PCR Martin Hersberger,* Jacqueline Marti-Jaun, Katharina Rentsch, and Edgar Ha¨nseler

Background: Interindividual differences in CYP2D6 activity range from total absence of metabolism of certain drugs to ultrafast metabolism and can produce adverse effects or lack of therapeutic effect under standard therapy. Several mutations have been described in the CYP2D6 gene that abolish CYP2D6 activity. However, four mutations explain the majority of the poor metabolizers. We describe four single-tube assays to detect these mutations. Methods: Three tetra-primer PCR assays were developed to detect the mutations in the CYP2D6*3, *4, and *6 alleles. In these single-tube assays, the CYP2D6 locus is amplified directly, followed by the allele-specific amplification on this new template. In addition, a multiplex long PCR was developed to genotype the CYP2D6*5 allele. Two long PCR amplifications for detection of the deletion of CYP2D6 (*5) and for detection of the CYP2D6 gene region were combined in one tube. Results: Analysis of 114 alleles showed no CYP2D6*3 allele, and allele frequencies of 28.1% for CYP2D6*4, 2.6% for CYP2D6*5, and 0.9% for CYP2D6*6. Re-analysis of the DNA samples by restriction fragment length polymorphism and sequencing analysis confirmed these results. Furthermore, re-analysis of sequenced genomic DNA by tetra-primer PCR analysis (7–11 times) always showed identical results. Conclusions: Our set of single-tube assays allows rapid and reproducible genotyping of the majority of CYP2D6 poor metabolizers. © 2000 American Association for Clinical Chemistry

Institute of Clinical Chemistry, University Hospital Zurich, Raemistrasse 100, CH-8091 Zurich, Switzerland. *Author for correspondence. Fax 41-1-255-4590; e-mail [email protected]. Received January 10, 2000; accepted May 16, 2000.

The discovery of the cytochrome P450-dependent monooxygenases (CYPs)1 led to the understanding of interindividual differences in the metabolism of certain drugs. One of these monooxygenases, CYP2D6, is the ratelimiting enzyme for the metabolism of several neuroleptics, tricyclic antidepressants, selective serotonin reuptake inhibitors, and ␤-blockers (1–3 ). The majority of the population metabolizes such drugs extensively (extensive metabolizers); however, 5–10% of Caucasians and 1– 4% of most other ethnic groups have decreased CYP2D6 activities [poor metabolizers (PMs)] and risk toxic effects if they receive the routine clinical dose of a drug inactivated by CYP2D6 (1, 4, 5 ). In contrast, ⬃1–7% of the Caucasian population (4, 6 ) and up to 20% of the Middle Eastern population (7, 8 ) have increased CYP2D6 activity (ultrarapid metabolizers) and may not reach therapeutic plasma concentrations under the same treatment. The individual CYP2D6 activity can be determined by phenotyping sparteine/debrisoquine metabolism, but these studies are hampered by complicated protocols (3 ). Recent comparative studies indicate that the CYP2D6 genotype predicts the sparteine/debrisoquine phenotype with high accuracy (4, 9 ), suggesting the use of CYP2D6 genotyping for classification into ultrarapid metabolizer, extensive metabolizer, or PM. Several PM alleles have been described that lead to inactive CYP2D6; however, evaluation of four PM alleles, CYP2D6*3, *4, *5, and *6 (10 ), can predict 93–97.5% of the PM phenotypes in the white Caucasian population (4, 9, 11 ). Several methods based on PCR amplification of the CYP2D6 locus are used to genotype the PM alleles. The most widely used methods to detect PM alleles with small nucleotide mutations and deletions are restriction frag-

1 Nonstandard abbreviations: CYP, cytochrome P450-dependent monooxygenase; PM, poor metabolizer; RFLP, restriction fragment length polymorphism; and ASA, allele-specific amplification.

1072

1073

Clinical Chemistry 46, No. 8, 2000

ment length polymorphism (RFLP) analysis (12 ) and allele-specific amplification (ASA) (4, 13 ). To detect the deletion of the CYP2D6 gene, long PCR is used (14, 15 ). However, ASA and RFLP include several transfer steps that increase the risk of contamination and mix-up of samples, and long PCR has no internal control for PCR reliability. To facilitate genotyping of the CYP2D6 alleles that predict the majority of PMs, we developed three single-tube tetra-primer PCR assays to detect the CYP2D6*3, *4, and *6 alleles and a multiplex long PCR assay to detect the CYP2D6*5 allele.

Materials and Methods A total of 57 EDTA-supplemented blood samples from unrelated European subjects were extracted with the QIAamp® DNA Mini Kit (QIAGEN). Primers were designed with the OLIGO 4.0 software (MEDPROBE), purchased from Microsynth and were used as 10 ␮mol/L solutions in water. Primers for ASA were designed under the criteria described by Kwok et al. (16 ). The AmpliTaq GoldTM System (Perkin-Elmer) was used to amplify the tetra-primer PCR, and the ExpandTM Long Template PCR System (Roche Molecular Biochemicals) was used for the multiplex long PCR. The PCR amplifications were done on a Perkin-Elmer Gene Amp PCR System 9600. For detection of CYP2D6*3, a 25-␮L tetra-primer PCR reaction was performed. The reaction mixture contained 17.7 ␮L of water, 2.5 ␮L of buffer 1 (1.5 mmol/L MgCl2), 0.2 ␮L of Gold Taq (5 U/␮L), 0.5 ␮L of dNTP mixture (10 mmol/L), 0.3 ␮L of primer 3, 0.75 ␮L of primer 6, 0.75 ␮L of primer Awt, 0.3 ␮L of primer 4new, and 2.0 ␮L of genomic DNA (⬃50 ng/␮L), and cycling conditions were as follows: 10 min at 94 °C, followed by 20 cycles (first set) of 94 °C for 30 s, 63 °C for 30 s, and 72 °C for 60 s; 27 cycles (second set) of 94 °C for 30 s, 53 °C for 30 s, and 72 °C for 60 s; and a final extension of 7 min at 72 °C. The PCR products were then separated by 5% polyacrylamide gel electrophoresis for 2 h (17 ). DNA was detected by poststaining of the polyacrylamide gel with ethidium bromide (500 mg/L in water) and visualized under an ultraviolet transilluminator. A digital image was recorded with a charged-couple device camera and frame grabber (UV products). The genotypes of five genomic DNAs were confirmed by sequence analysis (18 ): three DNAs were heterozygous for the *3 allele (*3/wt) and two were wild type (wt/wt). These genomic DNAs were subsequently re-analyzed seven times as controls for the CYP2D6*3 analysis of the 57 DNA samples. For detection of CYP2D6*4, a 25-␮L tetra-primer PCR reaction was performed. The reaction mixture contained 17.55 ␮L of water, 2.5 ␮L of buffer 1 (1.5 mmol/L MgCl2), 0.2 ␮L of Gold Taq (5 U/␮L), 0.5 ␮L of dNTP mixture (10 mmol/L), 0.5 ␮L of primer 1new, 0.75 ␮L of primer Bmut, 0.5 ␮L of primer 7, 0.5 ␮L of primer 2new, and 2.0 ␮L of genomic DNA (⬃50 ng/␮L), and the cycling conditions were as follows: 10 min at 94 °C; 15 cycles (first set) of 94 °C for 30 s, 63 °C for 30 s, and 72 °C for 60 s; 27 cycles

(second set) of 94 °C for 30 s, 53 °C for 30 s, and 72 °C for 60 s; and a final extension of 7 min at 72 °C. The PCR products were analyzed directly by 1.5% agarose gel electrophoresis for 1.25 h (17 ), followed by ethidium bromide staining and ultraviolet detection as described for the polyacrylamide gel. The genotypes of eight genomic DNAs were confirmed by sequence analysis: two DNAs were homozygous for the *4 allele (*4/*4), four were heterozygous (*4/wt), and two were wild type (wt/wt). These genomic DNAs were subsequently reanalyzed 11 times as controls for the CYP2D6*4 analysis. For detection of CYP2D6*6, a 25-␮L tetra-primer PCR reaction was performed. The reaction mixture contained 17.3 ␮L of water, 2.5 ␮L of buffer 1 (1.5 mmol/L MgCl2), 0.2 ␮L of Gold Taq (5 U/␮L), 0.5 ␮L of dNTP mixture (10 mmol/L), 0.5 ␮L of primer 1new, 0.75 ␮L of primer Tmut, 0.75 ␮L of primer 11, 0.5 ␮L of primer 2new, and 2.0 ␮L of genomic DNA (⬃50 ng/␮L), and cycling conditions were as follows: 10 min at 94 °C; 15 cycles (first set) of 94 °C for 30 s, 63 °C for 30 s, and 72 °C for 60 s; 27 cycles (second set) of 94 °C for 30 s, 53 °C for 30 s, and 72 °C for 60 s; and a final extension of 7 min at 72 °C. The PCR products were then analyzed directly by 2.5% agarose gel electrophoresis for 1.5 h. The genotype of six genomic DNAs was confirmed by sequence analysis: two DNAs were heterozygous for the *6 allele (*6/wt) and four were wild type (wt/wt). These genomic DNAs were subsequently reanalyzed nine times as controls for the CYP2D6*6 analysis. For detection of CYP2D6*5, a 50-␮L long PCR reaction was performed. The reaction mixture contained 36.1 ␮L of water, 5.0 ␮L of buffer 3 (2.25 mmol/L MgCl2), 0.75 ␮L of Enzyme Mix (3.5 U/␮L), 1.75 ␮L of dNTP mixture (10 mmol/L), 0.4 ␮L of primer Dup, 0.4 ␮L of primer Dlow, 0.8 ␮L of primer DPKup, 0.8 ␮L of primer DPKlow, and 4.0 ␮L of genomic DNA (⬃50 ng/␮L), and the cycling conditions were as follows: 1 min at 94 °C, followed by 35 cycles of 94 °C for 60 s, 65 °C for 30 s, 68 °C for 5 min, and a final extension of 7 min at 68 °C. The PCR products were then analyzed directly by 0.8% agarose gel electrophoresis for 2 h.

Results A tetra-primer PCR assay (Fig. 1) (19 ) was developed to analyze the CYP2D6*3 allele. Two primers complementary to unique intronic sequences of CYP2D6 (primers 3 and 4new) and two primers designed for ASA of the wild-type (primer Awt) and the *3 allele (primer 6) were combined in one tetra-primer PCR assay (13, 20, 21 ). During the first set of cycles, a 1106-bp region of CYP2D6 amplified with primers 3 and 4new (Table 1) served as internal control for the quality of the PCR amplification and as template for the subsequent ASA (Fig. 2, control). During the second set of cycles, ASA (primers 6 and Awt) produced the 580-bp PCR product specific for the *3 allele and the 553-bp PCR product specific for the wild-type allele. Because the wild-type and *3 alleles were analyzed

1074

Hersberger et al.: Single-Tube CYP2D6 Allele Detection

Fig. 1. Scheme of tetra-primer PCR analysis. Four primers are combined with genomic DNA in a single-tube PCR reaction. The two gene-specific primers (P1 and P2) amplify the region of interest from both alleles in the first set of cycles (control). This control fragment indicates that the PCR was successful and serves as template for the ASA in the second set of cycles. The subsequent ASA (second set of cycles) produces a specific PCR product for allele A (left) if this allele is present and primer A anneals and amplifies in combination with primer P1. A specific product of different size is generated in the presence of the allele G (right) when primer G amplifies in combination with primer P2. Separation of the different sized products by gel electrophoresis (bottom) allows genotyping of the DNA sample: lane 1, homozygous DNA for allele A (A/A); lane 2, heterozygous DNA (A/G); lane 3, homozygous DNA for allele G (G/G).

on the coding and the noncoding DNA strands, respectively, both amplifications could occur simultaneously in one tube (19 ). Separation by 5% polyacrylamide gel electrophoresis allowed the distinction of the three PCR products and the interpretation of the CYP2D6*3 genotype (Fig. 2). Analysis of 57 genomic DNA samples revealed no CYP2D6*3 alleles (Table 2). To confirm the accuracy of our new method, we re-analyzed the DNAs for CYP2D6*3 by RFLP analysis (12 ) and obtained identical results (data not shown). The CYP2D6*4 allele was detected by tetra-primer PCR. Preamplification of the 750-bp CYP2D6 region (primers 1new and 2new) ensured the specificity of the subsequent ASA for CYP2D6*4 (Fig. 3, control) (13, 20 ). ASA (primers Bmut and 7) produced a 217-bp PCR product for the *4 allele and a 560-bp PCR product for the wild-type allele. The PCR products were separated by 1.5% agarose gel electrophoresis. Thirty-two CYP2D6*4 alleles were identified among 57 DNA samples analyzed,

including 3 individuals homozygous for CYP2D6*4 (Table 2). Identical results were obtained by RFLP analysis (12 ). The CYP2D6*6 allele was analyzed by tetra-primer PCR. The same preamplification of the 750-bp CYP2D6 region was used as for the *4 allele (primers 1new and 2new). The subsequent ASA (primers Tmut and 11) specifically amplified a 421-bp PCR product for the wildtype allele and a 356-bp PCR product for the CYP2D6*6 allele (Fig. 4). The PCR products were separated by 2.5% agarose gel electrophoresis. One CYP2D6*6 allele (Table 2) was detected within the 57 DNAs analyzed and was confirmed by sequencing (data not shown). The CYP2D6*5 allele was detected by multiplex long PCR. We multiplexed two long PCR amplifications (14, 15 ) to detect the deletion of CYP2D6 (*5) and to simultaneously control for the long PCR amplification (Fig. 5). In this multiplexed long PCR, the 3.2-kb product indicated the deletion of CYP2D6 (primers Dup and Dlow) and the 5.1-kb product indicated the wild-type

1075

Clinical Chemistry 46, No. 8, 2000

Table 1. Oligonucleotides used in this study. Primer 5ⴕ positiona

1new 2new 3 4new 6 7 11 Awt Bmut Tmut Dlow Dup DPKup DPKlow

1388 2137 2098 3203 2624 1947 1808 2650 1921 1782 7846 43 ⫺259 4844

Table 2. CYP2D6 allele frequencya in the study population.

Sequenceb

3ⴕ positiona

Allele

Number of alleles (n ⴝ 114)

Allele frequency, %

TCCCAGCTGGAATCCGGTGTCG GGAGCTCGCCCTGCAGAGACTCCT GCGGAGCGAGAGACCGAGGA GGTCCGGCCCTGACACTCCTTCT GCTAACTGAGCACGc CGAAAGGGGCGTCC TCCTCGGTCACCCA TCCCAGGTCATCCT TCTCCCACCCCCAA GTCGCTGGAGCAGG CAGGCATGAGCTAAGGCACCCAGAC CACACCGGGCACCTGTACTCCTCA GTTATCCCAGAAGGCTTTGCAGGCTTCA GCCGACTGAGCCCTGGGAGGTAGGTA

1409 2114 2117 3181 2637 1934 1795 2637 1934 1795 7822 66 ⫺232 4819

*3 *4 *5 *6

0/114 32/114 3/114 1/114

0 28.1 2.6 0.9

a Positions are given according to the CYP2D6 gene sequence (GenBank Accession No. M33388) with the exception of primer DUP, which is located in the intergenic region between CYP2D7 and CYP2D6 (GenBank Accession No. X90926). b Sequences are shown 5⬘ to 3⬘. c Nucleotides that correspond to the target point mutation are in bold.

CYP2D6 allele (primers DPKup and DPKlow) (15 ). Within the 57 genomic DNAs analyzed, we detected 3 *5 alleles. Identical results were obtained with the original long PCR method in two tubes (14, 15 ).

Discussion Individuals homozygous for one of the CYP2D6 PM alleles or who have a combination of two PM alleles

a

The number of detected alleles and the allele frequencies are shown.

(transheterozygous) show decreased CYP2D6 activity and risk adverse effects under routine therapy with certain drugs (4, 9 ). Four of these alleles, *3, *4, *5, and *6, cause 93–97% of the PM phenotypes in the Caucasian population (4, 9 ). Here we report four single-tube PCR-based assays to genotype CYP2D6*3, *4, *5, and *6. Three tetra-primer PCRs (Fig. 1) (19 ) were developed and evaluated to detect the single nucleotide polymorphisms of CYP2D6*3, *4, and *6. For each assay, four primers are combined in a single tube for the initial amplification of the CYP2D6 locus and the subsequent ASA. In the first set of cycles, preamplification of the CYP2D6 gene region is ensured by the higher annealing temperature of the primers used to amplify the CYP2D6 locus relative to the primers used for the ASA (19 ). Decreasing the annealing temperature in the second set of cycles then allows ASA on the newly synthesized CYP2D6 gene region. The tetra-primer PCRs described here are reliable and robust assays for detecting the CYP2D6*3, *4, and *6 alleles. The analysis of 57 human DNA samples yielded frequencies for these alleles (Table 2) that were in agreement with previous studies in Europeans (4, 9 ). Reanalysis of the DNAs for CYP2D6*3 and *4 alleles by

Fig. 3. Analysis of the CYP2D6*4 allele. Fig. 2. Analysis of the CYP2D6*3 allele. Approximately 100 ng of genomic DNA was used for tetra-primer PCR, and the products were separated by 5% polyacrylamide gel electrophoresis for 2 h. The analysis of five genomic DNAs is shown: three homozygous for the wild-type (wt) allele, and two heterozygous for the CYP2D6*3 allele (wt/*3). The first set of cycles in the PCR produces the allele-nonspecific amplification of 1106 bp of the CYP2D6 locus (control). ASA produces a 580-bp product for the CYP2D6*3 allele (*3) and a 553-bp product for the wild-type allele (wt).

Approximately 100 ng of genomic DNA was used for tetra-primer PCR, and the products were separated on a 1.5% agarose gel for 1.25 h. The analysis of three genomic DNAs is shown: one homozygous for the CYP2D6*4 allele (*4/*4), one homozygous for the wild-type allele (wt), and one heterozygous for the CYP2D6*4 allele (wt/*4). The first set of cycles in the PCR produces the allele-nonspecific amplification of 750 bp of the CYP2D6 locus (control). ASA produces a 560-bp product for the wild-type allele (wt) and a 217-bp product for the CYP2D6*4 allele (*4).

1076

Hersberger et al.: Single-Tube CYP2D6 Allele Detection

Fig. 4. Analysis of the CYP2D6*6 allele. Approximately 100 ng of genomic DNA was used for tetra-primer PCR, and the products were separated on a 2.5% agarose gel for 1.5 h. The analysis of four genomic DNAs is shown: two homozygous for the wild-type allele (wt), and two heterozygous for the CYP2D6*6 allele (wt/*6). The first set of cycles in the PCR produces the allele-nonspecific amplification of 750 bp of the CYP2D6 locus (control). ASA produces a 421-bp product for the wild-type allele (wt) and a 356-bp product for the CYP2D6*6 allele (*6).

RFLP (12 ) confirmed the results. Furthermore, we amplified the specific regions for the *3, *4, and *6 alleles of five to eight genomic DNAs each and determined the genotype by sequence analysis (see Materials and Methods). All sequences confirmed the results of the tetra-primer analysis. These genomic DNAs were then re-analyzed 7–11 times by tetra-primer PCR with identical results (data not shown), demonstrating that the tetra-primer PCR assays for the *3, *4, and *6 allele are reproducible. These

Fig. 5. Analysis of the CYP2D6*5 allele. Approximately 200 ng of genomic DNA was used for the multiplex long PCR, and products were separated on a 0.8% agarose gel for 2 h. The analysis of three genomic DNAs is shown: two heterozygous for the CYP2D6*5 allele (wt/*5), and one homozygous for the wild-type allele (wt). ASA produces a 5.1-kb product for the wild-type allele (wt) and a 3.2-kb product for the CYP2D6*5 allele (*5).

findings seem to contrast the lack of confidence in ASA that led to the use of RFLP to detect CYP2D6 polymorphisms (4 ). It is known that ASA assays can give falsepositive results because of contamination and false-negative results because of unsuccessful PCR (22 ). However, the tetra-primer PCR assays presented here are less prone to contamination because they are single-tube assays and do not require transfer of amplified PCR products, and the risk for false-negative results are omitted because the assays include an internal control for PCR amplification. Furthermore, recent improvement in DNA extraction and PCR amplification increased the reliability of PCR in general. Several DNA extraction kits that yield highquality genomic DNA from blood and several PCR amplification kits that allow standardization assure reliable and robust results. To complete the set of single tube assays for genotyping the majority of the PMs, we developed a multiplex long PCR to simultaneously detect the deletion of CYP2D6 (*5 allele) and the CYP2D6 gene. In the former long PCR assay for CYP2D6*5 (14, 15 ), misinterpretation could occur if the long PCR failed or if the genomic DNA was not added. This is omitted in the multiplex long PCR by inclusion of the simultaneous amplification of the CYP2D6 gene as an internal control for the reliability of the PCR. Detection of the CYP2D6*5 allele is not necessary unless the *5 allele is homozygous. Any PM allele that is transheterozygous with CYP2D6*5 would be genotyped as homozygous in the tetra-primer PCRs and would give the correct PM classification. However, in the absence of amplification in the tetra-primer PCRs, the multiplex long PCR is necessary to exclude handling errors or unsuccessful DNA extraction from misinterpretation as homozygous CYP2D6*5. The four presented single-tube PCR assays allow genotyping of the majority of PMs in Caucasians. In addition to the wild-type allele, at least 52 different CYP2D6 alleles are known that are associated with deficient, decreased, normal, or increased enzyme activity (4, 9, 10 ). However, the four most common inactivating CYP2D6 alleles, *3, *4, *5, and *6, are associated with 93–97% of the PM phenotypes, whereas other inactivating mutations contribute ⬍1% (4, 9 ). Therefore, testing of the CYP2D6*3, *4, *5, and *6 alleles seems reasonable and sufficient to routinely screen for inactivating mutations in CYP2D6. The tetra-primer PCRs can be done during a typical work day in two thermal cyclers, whereas the multiplex long PCR to detect the *5 allele and the long PCR to detect ultrarapid metabolizers (23, 24 ) can be performed together overnight. This combination allows genotyping of CYP2D6 within 2 days. In conclusion, we present three tetra-primer PCRs for genotyping the CYP2D6*3, *4, and *6 alleles, and a multiplex long PCR for genotyping the *5 allele. These singletube PCR assays reduce the risk for handling errors and contamination, and facilitate genotyping of CYP2D6.

Clinical Chemistry 46, No. 8, 2000

We are grateful for the generous donation of genomic DNA with CYP2D6*3 and CYP2D6*6 alleles by Dr. A. Daly, Department of Pharmacological Sciences, University of Newcastle, UK.

13.

References 1. Coutts RT, Urichuk LJ. Polymorphic cytochromes P450 and drugs used in psychiatry. Cell Mol Neurobiol 1999;19:325–54. 2. Ingelman-Sundberg M, Oscarson M, McLellan RA. Polymorphic human cytochrome P450 enzymes: an opportunity for individualized drug treatment. Trends Pharmacol Sci 1999;20:342–9. 3. Linder MW, Prough RA, Valdes R Jr. Pharmacogenetics: a laboratory tool for optimizing therapeutic efficiency. Clin Chem 1997;43: 254 – 66. 4. Sachse C, Brockmoller J, Bauer S, Roots I. Cytochrome P450 2D6 variants in a Caucasian population: allele frequencies and phenotypic consequences [see comments]. Am J Hum Genet 1997;60: 284 –95. 5. Alvan G, Bechtel P, Iselius L, Gundert-Remy U. Hydroxylation polymorphisms of debrisoquine and mephenytoin in European populations. Eur J Clin Pharmacol 1990;39:533–7. 6. Agundez JA, Ledesma MC, Ladero JM, Benitez J. Prevalence of CYP2D6 gene duplication and its repercussion on the oxidative phenotype in a white population. Clin Pharmacol Ther 1995;57: 265–9. 7. Aklillu E, Persson I, Bertilsson L, Johansson I, Rodrigues F, Ingelman-Sundberg M. Frequent distribution of ultrarapid metabolizers of debrisoquine in an Ethiopian population carrying duplicated and multiduplicated functional CYP2D6 alleles. J Pharmacol Exp Ther 1996;278:441– 6. 8. McLellan RA, Oscarson M, Seidegard J, Evans DA, IngelmanSundberg M. Frequent occurrence of CYP2D6 gene duplication in Saudi Arabians. Pharmacogenetics 1997;7:187–91. 9. Marez D, Legrand M, Sabbagh N, Guidice JM, Spire C, Lafitte JJ, et al. Polymorphism of the cytochrome P450 CYP2D6 gene in a European population: characterization of 48 mutations and 53 alleles, their frequencies and evolution. Pharmacogenetics 1997; 7:193–202. 10. Daly AK, Brockmoller J, Broly F, Eichelbaum M, Evans WE, Gonzalez FJ, et al. Nomenclature for human CYP2D6 alleles. Pharmacogenetics 1996;6:193–201. 11. Sachse C, Brockmoller J, Hildebrand M, Muller K, Roots I. Correctness of prediction of the CYP2D6 phenotype confirmed by genotyping 47 intermediate and poor metabolizers of debrisoquine. Pharmacogenetics 1998;8:181–5. 12. Douglas AM, Atchison BA, Somogyi AA, Drummer OH. Interpreta-

14.

15.

16.

17.

18.

19. 20.

21.

22.

23.

24.

1077

tion of a simple PCR analysis of the CYP2D6(A) and CYP2D6(B) null alleles associated with the debrisoquine/sparteine genetic polymorphism. Pharmacogenetics 1994;4:154 – 8. Heim MH, Meyer UA. Genetic polymorphism of debrisoquine oxidation: restriction fragment analysis and allele-specific amplification of mutant alleles of CYP2D6. Methods Enzymol 1991; 206:173– 83. Steen VM, Andreassen OA, Daly AK, Tefre T, Borresen AL, Idle JR, Gulbrandsen AK. Detection of the poor metabolizer-associated CYP2D6(D) gene deletion allele by long-PCR technology. Pharmacogenetics 1995;5:215–23. Johansson I, Lundqvist E, Dahl ML, Ingelman-Sundberg M. PCRbased genotyping for duplicated and deleted CYP2D6 genes. Pharmacogenetics 1996;6:351–5. Kwok S, Kellogg DE, McKinney N, Spasic D, Goda L, Levenson C, Sninsky JJ. Effects of primer-template mismatches on the polymerase chain reaction: human immunodeficiency virus type 1 model studies. Nucleic Acids Res 1990;18:999 –1005. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning, 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press, 1989. Hersberger M, Patarroyo-White S, Arnold KS, Innerarity TL. Phylogenetic analysis of the apolipoprotein B mRNA-editing region. Evidence for a secondary structure between the mooring sequence and the 3⬘ efficiency element. J Biol Chem 1999;274: 34590 –7. Ye S, Humphries S, Green F. Allele specific amplification by tetra-primer PCR. Nucleic Acids Res 1992;20:1152. Kimura S, Umeno M, Skoda RC, Meyer UA, Gonzalez FJ. The human debrisoquine 4-hydroxylase (CYP2D) locus: sequence and identification of the polymorphic CYP2D6 gene, a related gene, and a pseudogene. Am J Hum Genet 1989;45:889 –904. Heim M, Meyer UA. Genotyping of poor metabolisers of debrisoquine by allele-specific PCR amplification [see comments]. Lancet 1990;336:529 –32. Nollau P, Wagener C. Methods for detection of point mutations: performance and quality assessment. The IFCC Scientific Division, Committee on Molecular Biology Techniques. J Int Fed Clin Chem 1997;9:162–70. Steijns LSW, Van Der Weide J. Ultrarapid drug metabolism: PCR-based detection of CYP2D6 gene duplication. Clin Chem 1998;44:914 –7. Lovlie R, Daly AK, Molven A, Idle JR, Steen VM. Ultrarapid metabolizers of debrisoquine: characterization and PCR-based detection of alleles with duplication of the CYP2D6 gene. FEBS Lett 1996;392:30 – 4.