Molecular and Cellular Probes 22 (2008) 324–328

Contents lists available at ScienceDirect

Molecular and Cellular Probes journal homepage: www.elsevier.com/locate/ymcpr

Short Communication

Specific real-time PCR assays for the detection and quantification of Mycoplasma mycoides subsp. mycoides SC and Mycoplasma capricolum subsp. capripneumoniae Sophie Lorenzon, Lucı´a Manso-Silva´n, François Thiaucourt* CIRAD-INRA-Bios, UMR15 ‘‘control of exotic and emerging animal diseases’’, TA A-15/G Campus International de Baillarguet, 34398 Montpellier cedex 5, France

a r t i c l e i n f o

a b s t r a c t

Article history: Received 18 April 2008 Accepted 9 July 2008 Available online 17 July 2008

Contagious bovine pleuropneumonia and contagious caprine pleuropneumonia are two severe respiratory infections of ruminants due to infection by Mycoplasma mycoides subsp. mycoides SC (MmmSC) and Mycoplasma capricolum subsp. capripneumoniae (Mccp), respectively. They are included in the OIE list of notifiable diseases. Here we describe the development of rapid, sensitive, and specific real-time PCR assays for the detection and quantification of MmmSC and Mccp DNA. MmmSC PCR primers were designed after whole genome comparisons between the published sequence of MmmSC strain type PG1T and the sequence of an M. mycoides subsp. mycoides large colony strain. For Mccp, previously published conventional PCR primers were applied. SYBR green was used as a detection agent for both assays. The assays specifically detected the targeted species in both cultures and clinical samples, and no cross-amplifications were obtained from either heterologous mycoplasma strain cultures or European field samples. The sensitivity of these new assays was estimated at 3–80 colony forming units per reaction and 4–80 fg of DNA, representing a 2–3 log increase in sensitivity compared to established conventional PCR tests. These new real-time PCR assays will be invaluable for application in various fields such as direct detection in diagnostic laboratories. Ó 2008 Elsevier Ltd. All rights reserved.

Keywords: Real-time PCR Mycoplasma mycoides subsp. mycoides SC Mycoplasma capricolum subsp.capripneumoniae

1. Introduction Contagious bovine pleuropneumonia (CBPP) and contagious caprine pleuropneumonia (CCPP) are two severe respiratory infections of cattle and goats due to infection by Mycoplasma mycoides subsp. mycoides SC (MmmSC) [1] and Mycoplasma capricolum subsp. capripneumoniae (Mccp) [2], respectively. Clinical signs and macroscopic lesions are very similar for the two diseases and consist of acute respiratory distress with extensive lesions of pneumonia and pleurisy. Because of their economic importance, they are included in the OIE list of notifiable diseases (http://www. oie.int). MmmSC and Mccp belong to the M. mycoides cluster, which groups six closely related mycoplasma subspecies and biotypes [3]. Detection of MmmSC and Mccp can be done by bacterial culture, which is relatively easy for MmmSC, as this mycoplasma grows well in adequate medium. However, culturing is quite difficult for Mccp. Since 1994, the use of specific PCR tests has made detection and identification of these two organisms much more sensitive and reliable [4–7]. However, classical PCR has a number of drawbacks, the major one being the risk of contamination during post-PCR analysis. Additionally, classical PCR does not allow quantification of

the target DNA in the sample, and may lack sensitivity when compared to newer methods. Real-time PCR (rtPCR) assays are less prone to contamination risks and their use in the detection of notifiable pathogens must be promoted. Real-time PCR assays have already been described for MmmSC [8,9]. In these previous studies, the targets were chosen in conserved sequences and specificity was based on very few nucleotide differences. Therefore, the objective of our study was to develop an MmmSC-specific rtPCR based on a specific DNA target. We performed whole genome sequence comparisons between MmmSC and its closest relative, M. mycoides subsp. mycoides LC (MmmLC). A single rtPCR assay has been described for Mccp [9] at this time. The Mccp-specific primers were designed from a pseudo-gene lppA [10] which may not ensure that all Mccp strains possess this DNA fragment. The objective of our study was to develop an alternative test based on another target. Unfortunately, no whole genome sequence data was available for Mccp, and we decided to adapt previously designed and validated primers for conventional PCR [7]. 2. Materials and methods 2.1. Mycoplasma strains and culture conditions

* Corresponding author. Tel.: þ33 (0) 467593723; fax: þ33 (0) 467593798. E-mail address: [email protected] (F. Thiaucourt). 0890-8508/$ – see front matter Ó 2008 Elsevier Ltd. All rights reserved. doi:10.1016/j.mcp.2008.07.003

Nine homologous strains of diverse geographical origins were chosen for MmmSC and Mccp, and 27 strains were chosen from

S. Lorenzon et al. / Molecular and Cellular Probes 22 (2008) 324–328 Table 1 List of mycoplasma strains used in this study Strain

Geographical o. Supplier

MmmSC-QPCR Mccp-QPCR

M. mycoides subsp. mycoides SC Pg1 Unknown Rita Cameroon T1/44/2 Tanzania 94111 Rwanda 960021-PO/67 France 970039 Namibia 990486 Namibia 97009 Ethiopia Gladysdale Australia

Type strain LANAVET PANVAC CIRAD CIRAD CVL-N CVL-N NVI-E CIRAD

Pos Pos Pos Pos Pos Pos Pos Pos Pos

Neg Neg Neg Neg Neg Neg Neg Neg Neg

M. mycoides subsp. mycoides LC YG Australia 950010-233LP-C1 France 9096-C9415 Nigeria 99045 (55507-1) Germany Kombolcha Ethiopia 2002-054 (VP 9L) India

Type strain CIRAD U. Nigeria TiHo NVI-E IVRI

Neg Neg Neg Neg Neg Neg

Neg Neg Neg Neg Neg Neg

M. mycoides subsp. capri PG3 Turkey 960021 (L) France 2003-045-C2 India N108 Nigeria

Type strain CIRAD CIRG FDVR

Neg Neg Neg Neg

Neg Neg Neg Neg

M. capricolum subsp. capricolum California Kid USA 8086-1 France 90122-C1547 Ivory Coast 9298 (G5) Tanzania 9325 (E570) UK 960038 Greece 970058-ROC3 (O12) Morocco 2002-053 (VP 28L) India

Type strain CIRAD LPA NVI-S NVI-S Arist. U. IAV IVRI

Neg Neg Neg Neg Neg Neg Neg Neg

Neg Neg Neg Neg Neg Neg Neg Neg

Type strain NVI-E CIRAD CIRAD LRVZ NVI-S CIRAD

Neg Neg Neg Neg Neg Neg Neg

Pos Pos Pos Pos Pos Pos Pos

CIRAD NVI-E

Neg Neg

Pos Pos

M. bovine group 7 of Leach PG50 Australia 94127-940923 (Calf 1) Nigeria 94127-941006 (D424) Germany 970033 India

Type strain NVI-S NVI-S FIHPCVV

Neg Neg Neg Neg

Neg Neg Neg Neg

M. putrefaciens KS1

USA

Type strain Neg

Neg

M. agalactiae PG2

Spain

Type strain Neg

Neg

M. bovis 7702 B 8891-5/2 2002-027-2

France Turkey Saudi Arabia

CIRAD MRI Almarai

Neg Neg Neg

M. capricolum subsp. capripneumoniae F38 Kenya 9231-Abomsa Ethiopia 9081-487P Oman 95043 Niger 94156-438LP Chad 98113 Uganda 91106C550-1 United Arab Emirates LKD Tunisia 97095-C1 Ethiopia

325

closely related subspecies such as MmmLC, M. mycoides subsp. capri (Mmc), M capricolum subsp. capricolum (Mcc) and Mycoplasma sp. Bovine group 7 (Table 1). Other mycoplasma species that are frequently isolated from lung lesions in ruminants, such as Mycoplasma bovis, Mycoplasma agalactiae, and Mycoplasma putrefaciens were also included. All strains were cultivated in modified Hayflick medium containing sodium pyruvate and a percentage of horse serum adapted to each species (15% for MmmSC and 25% for Mccp). 2.2. Preparation of samples Optimum sample preparation consisted in centrifugation of 1 ml cultured cells. The resulting cell pellet was then resuspended in 200 ml distilled water and DNA was extracted with the DNeasyÒ blood and tissue kit (Qiagen) using 60 ml of final buffer for elution to maximize DNA concentration. 2.3. Titration of cultures

Neg Neg Neg

Abbreviations: Pos: positive; Neg: negative; Almarai, Dr H. Ali; Arist. U.: Aristotle University, hessaloniki, Greece; Dr K. Sarris; CIRG: Central Institute for Research on Goats, Mathura, India, Dr R. Ranah; CVL-N: Central Veterinary Laboratory, Namibia, Windhoek, Dr O. Hu¨bschle; FDVR: Federal department of veterinary research, Vom, Nigeria; FIHPCVV: Federal Institute for Health and Protection of Consumers and Veterinary Medicine, Jena, Germany, Dr K. Sachse; IAV: Institut Agronomique et Ve´te´rinaire, Rabat, Dr A. Benkirane; IVRI: Indian Veterinary Research Institute, Izatnagar, Dr Singh; LANAVET:Laboratoire Central Veterinaire, Garoua, Cameroun, Dr Abdoulkadiri, Dr Yaya; LNIV: Laboratorio National Investigaçaˆo Veterinaria, Lisbon, Portugal. Dr. Machado; LPA: Laboratoire Central de Pathologie Animale, Bingerville, Ivory Coast. Dr. Domenech; LRVZ: Laboratoire de Recherches Ve´te´rinaires et Zootechniques de Farcha, N’Djamena,Chad. Dr. Hendrikx; MRI: Moredun Research Institute, Edimburgh, UK. Dr. Jones; NVI-E: National Veterinary Institute, Debre Zeit, Ethiopia. Dr. Fikre´, Dr Berhe; NVI-S: National Veterinary Institute, Uppsala, Sweden. Dr. Bo¨lske; PANVAC: Pan-African Veterinary Vaccine Centre, Addis Ababa, Ethiopia. Dr Litamoi; TiHo: Tiera¨rztliche Hochschule, Hannover, Germany. Dr Schmidt; U.

mycoplasma cultures were titrated by performing 10-fold primary dilutions in liquid medium and by seeding 20 ml drops of each dilution onto a suitable agar plate that was incubated in a CO2 incubator. For titrations, colony counts were then performed on the dilution giving no less than 15 individual colonies. 2.4. Targets for rtPCR The selection of appropriate target DNA for MmmSC was made by extensive mycoplasma whole genome sequence comparisons between the PG1 genome sequence (NC_005364.2) and the whole genome sequence of MmmLC strain 95010-C1, which is available in our laboratory. Primers for rtPCR and SYBR green detection were designed with Vector NTI advance 10 software (Invitrogen) according to specifications given by the manufacturer (Introduction to QPCR, Stratagene [11]). No whole genome sequence was available for Mccp, so we decided to test previously published primers for conventional PCR [7] (Table 2). 2.5. Real-time PCR amplification Amplification was performed in 25 ml reaction volume containing 1 Brilliant SYBR Green QPCR Master Mix (Stratagene), 300 nM of each primer, and 2 ml of template. Cycle parameters consisted of three steps. The initial step was denaturing at 95  C for 10 min, followed by an amplification step consisting in 40 cycles of denaturation at 95  C (30 s), annealing at 56  C for MmSC and at 47  C for Mccp (1 min), and amplification at 72  C (1 min). The final step consisted of two plateaus at 55 and 95  C with continuous fluorescence measurement every 0.25  C to record melting temperature. Amplification was performed in a Stratagene Mx3000P QPCR thermocycler and the amplified products were analyzed by the dedicated software MxPro v3.20. Amplification curves were represented with an adaptative baseline and an amplification-based threshold. The threshold cycle (Ct) was determined accordingly. The graphical representation of the melting temperature (Tm) was obtained with a moving average calculated with three points and a graphical temperature resolution of 0.25  C (Fig. 1).

Nigeria: Department of Veterinary Pathology & Microbiology, University of Nigeria, Nsukka, Nigeria. Dr. Shoyinka. This list of strains was established to obtain a representative number of strains according to intra-species variability. The rtPCR results are indicated as positive (pos) or negative (neg).

326

S. Lorenzon et al. / Molecular and Cellular Probes 22 (2008) 324–328

Table 2 Primers used for rtPCR amplification Primer Name Mccp-spe-F Mccp-spe-R MSC-382F MSC-382R

Sequence

Positions

ATCATTTTTAATCCCTTCAAG TACTATGAGTAATTATAATATATGCAA ATGCAAGAAGTTATTAATGTTTATCATTC CGTAATATATTTGTTTAACATATGGAATAA

50 4935 5226 435006 434929

AY529462.1 NC_005364.2

30 4956 5252 435034 434958

Size of amplified product

Reference

316

[7]

106

This study

For the Mccp-specific primers, the bolded and underlined bases correspond to polymorphic sites with the closest relatives in Mycoplasma capricolum subsp. capricolum.

2.6. Sensitivity and specificity evaluation

3. Results

The sensitivity of the rtPCR was assessed by evaluating the number of colony forming units (CFU) it was able to detect. This was performed by analyzing 10-fold dilutions of MmmSC vaccine strain T1/44 and Mccp 97095-C1 cultures in the exponential phase of growth. At this stage of the culture the great majority of mycoplasma cells is viable, and there is a correlation between number of CFU and available DNA. The relative sensitivity of rtPCR versus conventional PCR [5,7] was evaluated by testing 10-fold dilutions of reference DNA samples. The specificity of the two tests was assessed by testing each strain listed in Table 1 with the two rtPCR protocols specific for MmmSC or Mccp.

3.1. Target for rtPCR and primer selection For MmmSC rtPCR, a suitable locus was found on MSC_382 that was annotated as a 52 amino acid (AA) hypothetical protein with no similarity by BLAST analysis. This CDS is located downstream from three adjacent IS1634 copies (AH1, CF and AH2) that stretch from position 430980–434794 (NC_005364.2) and upstream of a 500 AA hypothetical protein that is conserved in MmmLC (98%similarity) and Mcc (91% similarity). The sequence of the primers is given in Table 2.

3.2. Melting temperature (Tm) of the real-time PCR products 2.7. Direct detection from field samples Lung samples from cattle (N ¼ 9) and goats (N ¼ 6) were obtained from the ‘‘Agence Française de se´curite´ sanitaire des aliments’’ (AFSSA, France) and used as negative field samples because France is free of CBPP and CCPP. In addition, pleural fluid samples received previously from the veterinary services of Central African Republic for the confirmation of a CBPP outbreak were used as positive controls for the rtPCR of MmmSC. For rtPCR of Mccp, field samples consisted of freeze-dried pleural fluid from Eritrea that were received in 1999 and kept at 20  C. Pleural fluids were first centrifuged at low speed (1000g for 10 min) to eliminate inflammatory cells, and mycoplasma DNA was extracted from the supernatant with the DNeasyÒ blood and tissue kit according to the manufacturers instructions. Lung samples were treated according to manufacturer’s instructions.

The Tm of the MmmSC-rtPCR was calculated using 40 replicates on four different occasions: mean Tm ¼ 67.9  C and SD ¼ 0.09  C, yielding a confidence interval of 67.7–68  C. These values were calculated with amplification curves showing a plateau of fluorescence. The Tm for the Mccp-rtPCR was calculated with 34 replicates also on four different days: mean Tm ¼ 75.0  C and SD ¼ 0.16  C, yielding a confidence interval of 74.7–75.3  C.

3.3. Sensitivity and specificity Real-time PCR for MmmSC allowed the detection of 7–13 CFU per 2 ml included in the reaction. For Mccp the sensitivity seemed even greater, with a detection limit of 3 CFU. However, this value may be over-estimated; the titration of a fastidious mycoplasma may not be as reliable as for fast and easy-growing bacteria. When the DNA samples were tested in parallel by PCR [5,7] or rtPCR, the rtPCR proved more sensitive by an order of 2–3 logs (Table 3). All homologous strains gave positive results in their respective rtPCR tests. Conversely, all heterologous strains yielded negative results in spite of the high DNA concentrations that were used. This demonstrated the strict specificity of the tests (Table 1)

3.4. Direct detection from field samples

Fig. 1. Correlation between mycoplasma titer in culture and the threshold cycle (Ct) of rtPCR for Mycoplasma mycoides subsp. mycoides SC. There is a linear decrease of Ct value according to culture titer. A minimum was reached for titers above 6  108 CFU/ ml, which correspond approximately to the saturating limit of the DNA extraction column. For higher concentrations of mycoplasmas, initial samples should be diluted.

DNA extracted from cattle and goat lungs of French origin yielded negative results to these rtPCRs. On the contrary, positive results were obtained from samples of African origin. For the MmmSC rtPCR, the three samples from a field outbreak in the Central African Republic yielded positive results by rtPCR, while classical PCR yielded only one clearly positive result, a faint band with the second and a negative result with the third sample. For the Mccp rtPCR, two samples out of three yielded positive results. Again, this demonstrated the applicability and superiority of rtPCR over classical PCR when testing field samples.

S. Lorenzon et al. / Molecular and Cellular Probes 22 (2008) 324–328

327

Table 3 Real-time and conventional PCR sensitivity comparisons MmmSC, CFU per sample rtPCR Ct Value Conventional PCR result

1.3  106 18 D

1.3  105 23 D

1.3  104 27 D

1300 31 L

130 34.5 L

13 39 L

1.3 no Ct L

MmmSC DNA quantity in reaction rtPCR Ct Value Conventional PCR result

400 pg 17 D

40 pg 21 D

4.0 pg 25.5 D

400 fg 30 D

40 fg 34.5 L

4.0 fg 39 L

0.4 fg no Ct L

Mccp, CFU per sample rtPCR Ct Value

nd

nd

1.3  104 22

1300 26.5

130 30.5

30 35

3 40

Mccp DNA quantity in reaction rtPCR Ct Value Conventional PCR result

800 pg 17.4 D

80 pg 21.8 D

8.0 pg 27.1 D

800 fg 31.9 L

80 fg 36.1 L

8.0 fg >40 L

nd

The sensitivity of the rtPCR assays were compared with the conventional PCR for Mycoplasma mycoides subsp. mycoides SC and Mycoplasma capricolum susbp. capripneumoniae detection. Samples were obtained from serial dilutions of a titrated MmmSC or Mccp culture (titers expressed as CFU per PCR sample) or with serial diluted DNA samples (DNA quantity per PCR sample). The rtPCR assays proved more sensitive than classical PCR by an order of 2–3 log dilutions. The rtPCR results are indicated as positive (þ) or negative ().

4. Discussion and conclusion

Acknowledgments

To date, relatively few rtPCR assays have been developed for mycoplasmas. The first were developed for the detection of the human pathogens Mycoplasma pneumoniae [12] and Mycoplasma genitalium [13,14]. Real-time PCR for pathogenic mycoplasmas of animal origin was then developed for the detection of Mycoplasma gallisepticum [15], Mycoplasma haemofelis [16], or M. bovis [17]. These tests usually targeted 16S rRNA genes, for which there was a wealth of sequences available for comparison and also because these were, by and large, the only available sequences for noncultivable organisms such as hemotropic mycoplasmas. Today, rtPCR is routinely used to assess the prevalence of such non-cultivable mycoplasmas [18]. Although CBPP and CCPP are notifiable diseases, there have been few rtPCR assays designed to detect their causative agents. The first rtPCR assay for the detection of MmmSC is based on the Taqman technique and targets various locations on the MmmSC genome [8]. However, this technique was validated with only four heterologous reference strains of the M. mycoides cluster. Considering the high intraspecies heterogeneity existing within these species four strains were certainly not enough. Other protocols have been described more recently [9] that target the various species of the M. mycoides cluster and are based on conserved genes that present sufficient inter-species variability to design species-specific primers. In the case of MmmSC the target is epsG, a gene that is highly similar to its orthologue, MmmLC. In the case of Mccp, the target is a pseudo-gene that also has a high level of similarity with the MmmLC homologous gene. For this reason we felt it was necessary to develop alternative tests to ensure that rtPCR can be used for the confirmation of new outbreaks in emergency situations with no need to isolate the causative agent. In our study, the search for specific primers for MmmSC was based on a different rationale: whole genome sequence comparisons between closely related subspecies to find subspecies-specific sequences. The two new rtPCR assays for the specific detection of MmmSC and Mccp presented here were extensively validated on representative numbers of homologous and heterologous mycoplasma strains from the M. mycoides cluster. Additionally, other mycoplasma strains that are often isolated from bovine lungs in many parts of the world, such as M. bovis, were included in the study. It has also been recently demonstrated that despite their small genome size, mycoplasmas may be prone to horizontal gene transfer between distantly related species that share the same habitat [19]. For this reason, it was important to include M. bovis strains and lungs from a CBPP-free country in the validation. This ensured that the two tests were both specific and universal. Furthermore, these two rtPCR tests have demonstrated greater sensitivity than classical PCR techniques when performed on the same samples.

We are greatly indebted to Vale´rie Barbe, Genoscope, Evry, France; Alain Blanchard at INRA, Bordeaux, France; and Daniel Jacob, CBIB, Bordeaux, France, respectively, for genome sequencing, annotation facilities and bioinformatics regarding M. mycoides subsp. mycoides LC. We are also indebted to P. Mercier and F. Poumarat, AFSSA, France for the supply of cattle and goat lungs. This work was supported by the EU Network of Excellence, EPIZONE (Contract No FOOD-CT-2006-016236)

References [1] Provost A, Perreau P, Breard A, Le Goff C, Martel JL, Cottew GS. Contagious bovine pleuropneumonia. Rev Sci Tech 1987;6:625–79. [2] Thiaucourt F, Bolske G. Contagious caprine pleuropneumonia and other pulmonary mycoplasmoses of sheep and goats. Rev Sci Tech 1996;15:1397– 414. [3] Cottew GS, Breard A, DaMassa AJ, Erno H, Leach RH, Lefevre PC, et al. Taxonomy of the Mycoplasma mycoides cluster. Isr J Med Sci 1987;23:632–5. [4] Bashiruddin JB, Nicholas RA, Santini FG, Ready RA, Woodward MJ, Taylor TK. Use of the polymerase chain reaction to detect mycoplasma DNA in cattle with contagious bovine pleuropneumonia. Vet Rec 1994;134:240–1. [5] Dedieu L, Mady V, Lefevre PC. Development of a selective polymerase chain reaction assay for the detection of Mycoplasma mycoides subsp. Mycoides S.C. (contagious bovine pleuropneumonia agent). Vet Microbiol 1994;42:327–39. [6] Bascunana CR, Mattsson JG, Bolske G, Johansson KE. Characterization of the 16S rRNA genes from Mycoplasma sp. strain F38 and development of an identification system based on PCR. J Bacteriol 1994;176:2577–86. [7] Woubit S, Lorenzon S, Peyraud A, Manso-Silvan L, Thiaucourt F. A specific PCR for the identification of Mycoplasma capricolum subsp. capripneumoniae, the causative agent of contagious caprine pleuropneumonia (CCPP). Vet Microbiol 2004;104:1256132. [8] Gorton TS, Barnett MM, Gull T, French RA, Lu Z, Kutish GF, et al. Development of real-time diagnostic assays specific for Mycoplasma mycoides subspecies mycoides small colony. Vet Microbiol 2005;111:51–8. [9] Fitzmaurice J, Sewell M, Manso-Silvan L, Thiaucourt F, McDonald WL, O’Keefe JS. Real-time polymerase chain reaction assays for the detection of members of the mycoides cluster. N Z Vet J 2008;56:40–7. [10] Monnerat MP, Thiaucourt F, Nicolet J, Frey J. Comparative analysis of the lppA locus in Mycoplasma capricolum subsp. capricolum and Mycoplasma capricolum subsp. capripneumoniae. Vet Microbiol 1999;69:157–72. [11] Anon. Introduction to quantitative PCR: method and application guide. In: Stratagene, editor. LaJolla. p. 50. [12] Hardegger D, Nadal D, Bossart W, Altwegg M, Dutly F. Rapid detection of Mycoplasma pneumoniae in clinical samples by real-time PCR. J Microbiol Methods 2000;41:45–51. [13] Deguchi T, Yoshida T, Yokoi S, Ito M, Tamaki M, Ishiko H, et al. Longitudinal quantitative detection by real-time PCR of Mycoplasma genitalium in first-pass urine of men with recurrent nongonococcal urethritis. J Clin Microbiol 2002;40:3854–6. [14] Yoshida T, Deguchi T, Ito M, Maeda S, Tamaki M, Ishiko H. Quantitative detection of Mycoplasma genitalium from first-pass urine of men with urethritis and asymptomatic men by real-time PCR. J Clin Microbiol 2002;40:1451–5. [15] Carli KT, Eyigor A. Real-time polymerase chain reaction for Mycoplasma gallisepticum in chicken trachea. Avian Dis 2003;47:712–7.

328

S. Lorenzon et al. / Molecular and Cellular Probes 22 (2008) 324–328

[16] Willi B, Boretti FS, Cattori V, Tasker S, Meli ML, Reusch C, et al. Identification, molecular characterization, and experimental transmission of a new hemoplasma isolate from a cat with hemolytic anemia in Switzerland. J Clin Microbiol 2005;43:2581–5. [17] Cai HY, Bell-Rogers P, Parker L, Prescott JF. Development of a real-time PCR for detection of Mycoplasma bovis in bovine milk and lung samples. J Vet Diagn Invest 2005;17:537–45.

[18] Wengi N, Willi B, Boretti FS, Cattori V, Riond B, Meli ML, et al. Real-time PCR-based prevalence study, infection follow-up and molecular characterization of canine hemotropic mycoplasmas. Vet Microbiol 2008;126:132–41. [19] Sirand-Pugnet P, Lartigue C, Marenda M, Jacob D, Barre A, Barbe V, et al. Being pathogenic, plastic, and sexual while living with a nearly minimal bacterial genome. PLoS Genet 2007;3:e75.