Journal of Cell and Molecular Biology Volume 10 · No 1· June 2012 http://jcmb.halic.edu.tr

•

Sulfabenzamide promotes autophagy through p53/ DRAM pathway

•

MGP polymorphisms in ischemic stroke

•

Survivin -625G/C polymorphism in non-small cell lung cancer

Journal of Cell and Molecular Biology Volume 10 · Number 1 June 2012

İstanbul-TURKEY

Editor-in-Chief Nagehan ERSOY TUNALI

Haliç University Faculty of Arts and Sciences

Journal of Cell and Molecular Biology Founder Gündüz GEDİKOĞLU Our Children Leukemia Foundation Rights held by A. Sait SEVGENER Rector Correspondence Address: Journal of Cell and Molecular Biology Haliç Üniversitesi Fen-Edebiyat Fakültesi, Sıracevizler Cad. No:29 Bomonti 34381 Şişli İstanbul-Turkey Phone: +90 212 343 08 87 Fax: +90 212 231 06 31 E-mail: [email protected] Journal of Cell and Molecular Biology is indexed in ULAKBIM, EBSCO, DOAJ, EMBASE, CAPCAS, EMBiology, Socolar, Index COPERNICUS, Open J-Gate, Chemical Abstracts and Genamics JournalSeek ISSN 1303-3646 Printed at MART Printing House

Editorial Board M. Baki YOKEŞ Kürşat ÖZDİLLİ Nural BEKİROĞLU Emel BOZKAYA M.Burcu IRMAK YAZICIOĞLU Mehmet OZANSOY Aslı BAŞAR Editorial Assistance Ozan TİRYAKİOĞLU Özlem KURNAZ Advisory Board A.Meriç ALTINÖZ, Istanbul, Turkey Tuncay ALTUĞ, İstanbul, Turkey Canan ARKAN, Munich, Germany Aglaia ATHANASSIADOU, Patras, Greece E. Zerrin BAĞCI, Tekirdağ, Turkey Şehnaz BOLKENT, İstanbul, Turkey Nihat BOZCUK, Ankara, Turkey A. Nur BUYRU, İstanbul, Turkey Kemal BÜYÜKGÜZEL, Zonguldak, Turkey Hande ÇAĞLAYAN, İstanbul, Turkey İsmail ÇAKMAK, İstanbul, Turkey Ayla ÇELİK, Mersin, Turkey Adile ÇEVİKBAŞ, İstanbul, Turkey Beyazıt ÇIRAKOĞLU, İstanbul, Turkey Fevzi DALDAL, Pennsylvania, USA Zihni DEMİRBAĞ, Trabzon, Turkey Gizem DİNLER DOĞANAY, İstanbul, Turkey Mustafa DJAMGÖZ, London, UK Aglika EDREVA, Sofia, Bulgaria Ünal EGELİ, Bursa, Turkey Anne FRARY, İzmir, Turkey Hande GÜRER ORHAN, İzmir, Turkey Nermin GÖZÜKIRMIZI, İstanbul, Turkey Ferruh ÖZCAN, İstanbul, Turkey Asım KADIOĞLU, Trabzon, Turkey Maria V. KALEVITCH, Pennsylvania, USA Nevin Gül KARAGÜLER, İstanbul, Turkey Valentine KEFELİ, Pennsylvania, USA Meral KENCE, Ankara, Turkey Fatma Neşe KÖK, İstanbul, Turkey Uğur ÖZBEK, İstanbul, Turkey Ayşe ÖZDEMİR, İstanbul, Turkey Pınar SAİP, Istanbul, TURKEY Sevtap SAVAŞ, Toronto, Canada Müge TÜRET SAYAR, İstanbul, Turkey İsmail TÜRKAN, İzmir, Turkey Mehmet TOPAKTAŞ, Adana, Turkey Meral ÜNAL, İstanbul, Turkey İlhan YAYLIM ERALTAN, İstanbul, Turkey Selma YILMAZER, İstanbul, Turkey Ziya ZİYLAN, İstanbul, Turkey

Journal of Cell and Molecular Biology CONTENTS Volume 10 · Number 1 · June 2012 Review Article Production and industrial applications of laccase enzyme M. IMRAN, M.J. ASAD, S.H. HADRI, S. MEHMOOD

1

Research Articles Isolation and biochemical identification of Escherichia coli from wastewater effluents of food and beverage industry T. FARASAT, Z. BILAL, F. YUNUS

13

Investigation of the MGP promoter and exon 4 polymorphisms in patients with ischemic stroke in the Ukrainian population A.V. ATAMAN, V.Y. GARBUSOVA, Y.A. ATAMAN, O.I. MATLAJ, O.A. OBUCHOVA

19

Investigation of the association of survivin gene -625G/C polymorphism in non-small cell lung cancer Survivin geni -625G/C polimorfizminin Küçük Hücreli Dışı Akciğer Kanseri ile ilişkisinin araştırılması

27

E. AYNACI, E. COŞKUNPINAR, A. EREN, O. KUM, Y. M. OLTULU, N. AKKAYA, A. TURNA, İ. YAYLIM, P. YILDIZ Effects of prenatal and neonatal exposure to lead on white blood cells in Swiss mice R. SHARMA, K. PANWAR, S. MOGRA Sulfabenzamide promotes autophagic cell death in T-47D breast cancer cells through p53/ DRAM pathway R. MOHAMMADPOUR, S. SAFARIAN, S. FARAHNAK, S. HASHEMINASL, N. SHEIBANI Media optimization for amylase production in solid state fermentation of wheat bran by fungal strains M. IRFAN, M. NADEEM, Q. SYED Guidelines for Authors

Front cover image: “DNA strands on abstract” Shutterstock image ID: 7041025

33

41

55

65

Journal of Cell and Molecular Biology 10(1): 1-11, 2012 Haliç University, Printed in Turkey. http://jcmb.halic.edu.tr

Review Article 1



Production and industrial applications of laccase enzyme Muhammad IMRAN*1,2, Muhammad J. ASAD1, Saqib H. HADRI1 and Sajid MEHMOOD2 1

Department of Biochemistry, Pir Mehr Ali Shah Arid Agriculture University, Rawalpindi, Pakistan Department of Biochemistry and Biotechnology, University of Gujrat, Pakistan (* author for correspondence; [email protected]) 2

Received: 22 April 2011; Accepted: 15 May 2012

Abstract Laccase is an enzyme that has potential ability of oxidation. It belongs to those enzymes, which have innate properties of reactive radical production, and its utilization in many fields has been ignored because of its unavailability in the commercial field. There are diverse sources of laccase producing organisms like bacteria, fungi and plants. Textile, pulp and paper industries discharge a huge quantity of waste in the environment, and the disposal of this waste is a big problem. To solve this problem, work has done to discover such an enzyme, which can detoxify these wastes and is not harmful to the environment. Laccases use oxygen and produce water as by product. They can degrade a range of compounds including phenolic and non-phenolic compounds. They also have ability to detoxify a range of environmental pollutants. Their property to act on a range of substrates and also to detoxify a range of pollutants have made them to be usable for several purposes in many industries including paper, pulp, textile and petrochemical industries. Keywords: Laccase, solid state fermentation, oxidation, enzyme, fungi.

Lakkaz enziminin üretimi ve endüstriyel uygulamaları Özet Lakkaz, potansiyel oksidasyon yeteneği olan bir enzimdir. Reaktif radikal üretim özelliği olan enzimlere dahildir ve birçok alandaki kullanımı, ticari alanda uygun olmaması nedeniyle göz ardı edilmektedir. Bakteri, mantar ve bitki gibi lakkaz üreten çeşitli organizma kaynakları vardır. Tekstil, kağıt hamuru ve kağıt endüstrisi çevreye büyük miktarda atık salmaktadır ve bu atıkların uzaklaştırılması büyük bir problemdir. Bu sorunu çözmek üzere, atıkları detoksifiye eden ve çevreye zararlı olmayan bir enzim keşfetmek için çalışmalar yapılmıştır. Bu enzim oksijen kullanır ve yan ürün olarak su üretir. Lakkaz, fenolik ve fenolik olamayan bileşikleri içeren bir dizi bileşiği parçalayabilir. Ayrıca, bir dizi çevresel kirleticiyi detoksifiye etme yeteneği vardır. Çeşitli substratlar üzerine etki etme ve ayrıca bir dizi kirliliği detoksifiye etme özelliği, bu enzimleri çeşitli amaçlarla tekstil, kâğıt hamuru, kâğıt ve petrokimya endüstrisini kapsayan birçok endüstride kullanılabilir kılmaktadır. Anahtar kelimeler: Lakkaz, katı hal fermentasyonu, oksidasyon, enzim, mantarlar.

Introduction Laccase was first discovered in the sap of the Japanese lacquer tree Rhus vernicifera, and its characteristic as a metal containing oxidase was discovered by Bertrand in 1985 (Giardina et al., 2010). Since then, laccases have also been found in

various basidiomycetous and ascomycetous fungi and thus far fungal laccases have accounted for the most important group of multicopper oxidases (MCOs) with respect to number and extent of characterization (Giardina et al., 2010). The large quantity of laccases have been widely reported inside white-rot fungi. A number of

2Muhammad IMRAN et al.

laccase genes have been isolated and distinguished for this purpose (Mayer and Staples, 2002). The improvement in laccase appearance, characterized by an increase in protein and mRNA level, was illustrated with Picnoprus cinnabarinus, Pleurotus sajor caju and Trametes versicolor (Eggert et al. 1996, Solden and Dobson 2001, Collins and Dobson 1997). A number of species of genus Pleurotus have been explained as manufacturers of laccase (Leonowicz et al. 2001). We freshly reported that a strain of P. pulmonarius produce laccase as the main ligninolytic enzymes while cultured on wheat bran solid state medium (Souza et al. 2002). In the current study, numerous phenolic and aromatic compounds structurally related to lignin were calculated for their capability to arouse laccase production by P. pulmonarius. (Solden and Dobson, 2001). P. pulmonarius was proficient of mounting on a wide variety of phenolic and aromatic compounds. Laccase production by P. pulmonarius could be considerably improved by including an equimolar combination of ferulic acid and vanillin as inducer. The construction of different laccase isoform in reply to phenolics implicates a possible task of this enzyme in the detoxification processes (Souza et al., 2002) Numerous white-rot fungi, counting Trametes versicolor, make extra cellular copper-containing phenol oxidases (E C 1.10.3.2), named laccases (Birhanli and Yesilada, 2006). The two major likely natural functions attributed to fungal laccases are, first, their participation in lignin degradation, mutually with supplementary ligninolytic enzymes such as peroxidases, and second, their function in fungal virulence as key cause in pathogenesis in opposition to plant hosts (Gianfreda et al., 1999). As well, laccases display in vivo other functions that are the foundation of several industrial applications. For instance, in Aspergillus nidulans, laccases take action on pigment development in fungal spores (Smith et al., 1997). A number of fungi also ooze laccases to take away either potentially toxic phenols released through lignin degradation or toxins formed by others organisms. As a result, the enzyme has probable applications in the textile industries, dye, as well as for the degradation of a variety of xenobiotics, which are recognized as ecological pollutants (Rama et al. 1998, Jolivalt et al. 1999, Mougin et al., 2000). Laccase-producing fungi have also been reported to be helpful apparatus for xenobiotic removal in liquid effluents as well as in soil

bioremediation (Gianfreda et al. 1999, Jolivalt et al. 2000). Our outcomes demonstrate that the resulting alteration products themselves are likely to encourage biological effects moreover on degrading or non-target organisms. So, an entire characterization of these compounds is essential for an entire assessment of the remediation processes (Souza et al., 2002). Laccase represents a family of coppercontaining polyphenol oxidases (PPO) & are usually called multicopper oxidases (MCO) (Birhanli and Yesilada, 2006; Arora and Sharma, 2010; Giardina et al., 2010). Laccases catalyze the oxidation of various substituted phenolic compounds by using molecular oxygen as the electron acceptor (Sharma et al., 2007). These enzymes have less substrate specificity and have the ability to degrade a range of xenobiotics including industrial colored wastewaters (Souza et al., 2006). Laccases exhibit broad substrate range, which varies from one laccase to another. Although it is known to be diphenol oxidase, monophenols like 2, 6-dimethoxy phenol or guaiacol are better substrates than phenols (e.g., catechol or hydroquinone) (Baldrian, 2006; Arora and Sharma, 2010). Laccases catalyze monoelectronic oxidation of molecules to corresponding reactive radicals with the help of four copper atoms, which form the main catalytic core of the laccase, accompanied with the diminution of oxygen to water molecules and simultaneous oxidation of substrate to produce radicals (Arora and Sharma, 2010). All substrates cannot be directly oxidized by laccases, either because of their large size which restricts their penetration into the enzyme active site or because of their particular high redox potential. To overcome this hindrance, suitable chemical mediators are used which are oxidized by the laccase and their oxidized forms are then able to interact with high redox potential substrate targets (Arora and Sharma, 2010). In fungi, laccases carry out a variety of physiological roles including morphogenesis, fungal plant pathogen/host interaction, stress defense, and lignin degradation (Gianfreda et al., 1999; Giardina et al., 2010). Laccases have been found in nearly all woodrotting fungi analyzed so far (Heinzkill and Messner, 1997; Giardina et al., 2010) and are almost ubiquitary enzymes as they have been isolated from plants, from some kinds of bacteria, and from insects too (Enguita et al., 2003; Sharma et al., 2007; Giardina et al., 2010).

Production and industrial applications of laccase 3 

Laccase has many applications in other fields, like medical diagnosis, pharmaceutical industry. Laccase has also applications in the agriculture area by clearing herbicides, pesticides and some explosives in soil. It is also used in the preparation of some important drugs, like anticancer drugs, and added in some cosmetics to reduce their toxicity. Laccase also has the ability to form polymers of value able importance (Couto and Herrera, 2006). Solid state fermentation (SSF) is a technique in which fungi are grown on solid substrate or substrate moistened with a low quantity of mineral salt solution and it has a great potential to produce enzyme especially where the fermented raw materials are used as a source of nutrients for the fungi. The enzymes produced by this method have several applications in several fields including food and fermentation industry. These enzymes are also used to prepare several bioactive compounds. SSF system is much better than the submerged system because a number of reasons. The benefits of SSF over SMF include the high production of the enzyme, and fewer effluent generation. Moreover, comparably simple equipment is required for SSF (Pandey, 1994). Neurospora is a genus of kingdom fungi that has become a popular experimental model organism (Davis et al., 2002). Laccases have copper atoms at their catalytic sites and are oxidative enzymes (EC 1.10.3.2) which are widely found in many species of fungi, where they are involved in lignin degradation, in higher plants where they are involved in biosynthesis of lignin (Mayer and Staples, 2002; Sharma and Kuhad, 2008), in bacteria (Claus, 2003; Liers et al., 2007), and in insects (Litthauer et al., 2007). Some species of fungi and insects produce laccases as intracellular proteins, but most of the laccases are produced as extracellular proteins by all other types of producers (Arora and Sharma, 2010).

Laccase production in various organisms Production of laccase in fungi Laccase production occurs in various fungi over a wide range of taxa. Fungi from the deuteromycetes, ascomycetes (Aisemberg et al., 1989) as well as basidiomycetes are the known producers of laccase (Sadhasivam et al., 2008). Among them, basidiomycetes are considered efficient laccase producers, especially white rot fungi (Revankar and lele, 2006; Sadhasivam et al., 2008). Laccase production has not been reported in lower fungi,

i.e., Zygomycetes and Chytridiomycetes. However, these groups have not yet been studied in detail (Arora and Sharma, 2010). Trametes versicolor, Chaetomium thermophilum and Pleurotus eryngii are well known producers of laccase. It has been reported that some Trichoderma species, including T. harzianum has the ability to produce polyphenol oxidases (Kiiskinen et al., 2004; Sadhasivam et al., 2008). Laccase has been produced by many species of soft, white rot fungi, geophilous saprophytic fungi. Laccase has also been produced by many edible mushrooms including the oyster mushroom Pleurotus ostreatus, the rice mushroom Lentinula edodes and champignon Agaricus bisporus. Other laccase producers of wood-rotting fungi include T. hirsuta (C. hirsutus), T. villosa, T. gallica, Cerrena maxima, Lentinus tigrinus, T. ochracea, Pleurotus eryngii, Trametes (Coriolus) versicolor, Coriolopsis polyzona, etc. (Morozova et al., 2007). In fungal physiology, laccases are involved in plant pathogenesis, pigmentation, detoxification, lignin degradation (Sadhasivam et al., 2008) and also in development of morphogenesis of fungi (Baldrian, 2006; Morozova et al., 2007). Laccases of wood-colonizing basidiomycetes (white rot fungi) have been thoroughly studied (not least also with respect to laccase-mediator interaction), and many of them purified and characterized on the protein and gene level (Liers et al., 2007). Mishra et al. (2008) have used cyanobacterial biomass of water bloom, groundnut shell (GNS) and dye effluent as culture medium for the production of laccase by Coriolus versicolor. They found the laccase production to be 10.15±2.21 U/ml in the medium having groundnut shell and cyanobacterial bloom in a ratio of 9:1 (dry weight basis) at initial pH 5.0 and 28±2 oC temperature. Half life of enzyme was 74 min at 60 oC. Kinetic analysis of laccase with ABTS were also determined, Km and Vmax were found to be 0.29mM and 9.49mol/min respectively. Azide and hydroxylamine exerted significant inhibition on production of thermostable laccase. It is reported that Phanerochaete chrysosporium NCIM 1197 also secretes extracellular laccase. They also studied effect of several inducers on the production of laccase. Among several inducers tested copper sulphate has the greatest tendency to enhance the produce of laccase. Laccase production increased 3.5 fold in the presence of copper sulfate

4Muhammad IMRAN et al.

as compared to control. Laccase production under SSF, batch fermentation in a laboratory scale bioreactor and static liquid culture was also compared. The maximum production of laccase was achieved after five days and it was found to be 48.89±1.82 U/L, 30.21±1.66 and 22.56±1.22 U/L, respectively (Gnanamani et al., 2006). The white-rot fungus Trametes pubescens MB 89 is a source of the laccase production at industrial level. Extracellular laccase formation is considerably enhanced by the addition of Cu (II) in the low quantities in the simple glucose medium. When using glucose, a typically repressing substrate, as the main carbon source, significant laccase formation by T. pubescens only started when glucose was completely consumed from the culture medium. In addition, the nitrogen source employed had an important effect on laccase synthesis. When using an optimized medium containing glucose (40 g/L), peptone from meat (10 g/L), and MgSO4.7H2O and stimulating enzyme formation by the addition of 2.0 mM Cu, maximal laccase activities obtained in a batch cultivation were approximately 330 U ml –l (Galhaup et al., 2002).

Production of laccase in plants Laccases are a diverse group of multi-copper proteins with broad substrate specificity, originally discovered in the exudates of Rhus vernicifera, the Japanese lacquer tree and subsequently demonstrated as a fungal enzyme as well (Sharma and Kuhad, 2008). The plants in which the laccase enzyme has been detected include lacquer, mango, mung bean, peach, pine, prune, and sycamore (Arora and Sharma, 2010). Techniques are also being developed to express laccase in the crop plants. Recently, laccase has been expressed in the embryo of maize (Zea mays) seeds (Bailey et al., 2004; Arora and Sharma, 2010). Laccase is envolved in polymerization of lignin units; p coumaryl, coniferyl, sinapyl alcohols and in the synthesis of lignin in the plants (Morozova et al., 2007). If the comparison between plant and fungal laccases is taken up, the former takes part in radical-based polymerization of lignin (Ranocha et al., 2002; Arora and Sharma, 2010), whereas fungal laccase contributes to lignin biodegradation due to which it has gained considerable significance in green technology (Arora and Sharma, 2010).

Production of laccase in bacteria Laccase in bacteria is present intracellularly and as

periplasmic protoplast (Claus, 2003; Arora and Sharma, 2010). The first bacterial laccase was found in the plant root associated bacterium, Azospirillum lipoferum (Givaudan et al., 1993; Sharma et al., 2007; Sharma and Kuhad, 2008), where it was shown to be involved in melanin formation (Faure et al., 1994; Sharma and Kuhad, 2008). Laccase has been discovered in a number of bacteria including Bacillus subtilis, Bordetella compestris, Caulobacter crescentus, Escherichia coli, Mycobacterium tuberculosum, Pseudomonas syringae, Pseudomonas aeruginosa, and Yersinia pestis (Alexandre and Zhulin, 2000; Enguita et al., 2003; Arora and Sharma, 2010). Recently, Stenotrophomonas maltophilia strain was found to be laccase producing, which was used to degrade synthetic dyes (Galai et al., 2008; Arora and Sharma, 2010). Laccase containing six putative copper binding sites were discovered in marine bacterium Marinomonas mediterranea, but no functional role was assigned to this enzyme (Amat et al., 2001; Sharma and Kuhad, 2008). Some of the reported laccases have the ability to perform the activity at very crucial conditions like in the presence of high conc. of Cl-1 and Cu+2 and even at neutral pH values. The enzyme produced by Sinorhizobium meliloti is a one of the examples of such enzymes and is a protein having two subunits with pI 6.2 and the molecular weight of the subunits is 45 kDa each (Morozova et al., 2007), whereas laccase produced by Pseudomonas putida is also an example of such enzyme and is a single subunit 59 kDa protein which works well at pH 7.0 (Morozova et al., 2007). Both enzymes can oxidize syringaldazine. Niladevi et al. (2009) used response surface methodology for the optimization of different nutritional and physical parameters for the production of laccase by the filamentous bacteria Streptomyces psammoticus MTCC 7334 in submerged fermentation. Incubation temperature, incubation period, agitationrate, concentrations of yeast extract, MgSO4.7H2O, and trace elements were found to influence laccase production significantly. A new laccase gene (cotA) was cloned from Bacillus licheniformis and expressed in Escherichia coli. The recombinant protein CotA was purified and showed spectroscopic properties typical for blue multi-copper oxidases. The enzyme has a molecular weight of ~65kDa and demonstrates activity towards canonical laccase substrates 2, 2’azino-bis (3-ethylnenzothiazoline-6sulphonic acid) (ABTS), syringaldazine (SGZ) and 2, 6-

Production and industrial applications of laccase 5 

dimethoxyphenol (2, 6-DMP). Kinetic constants Km and kcat for ABTS were of 6.5±0.2 µM and 83s-1, for SGZ of 4.3+0.2 µM and 100s-1, and for 2, 6DMP of 56.7+1.0 µM and 28 s-1. Highest oxidizing activities towards ABTS were obtained at 85 oC (Koschorreck et al., 2009).

Production of laccase in insects The laccase enzyme has also been characterized in different insects, e.g., Bombyx, Calliphora, Diploptera, Drosophila, Lucilia, Manduca, Musca, Orycetes, Papilio, Phormia, Rhodnius, Sarcophaga, Schistocerca, and Tenebrio (Arora and Sharma, 2010). In insects, laccases have been suggested to be active in cuticle sclerotization (Dittmer et al., 2004; Sharma and Kuhad, 2008). Recently, two isoforms of laccase 2 gene have been found to catalyse larval, pupal, and adult cuticle tanning in Tribolium castaneum (Arakane et al., 2005; Sharma and Kuhad, 2008)

Applications of laccase Laccases have many biotechnological applications because of their oxidation ability towards a broad range of phenolic and non-phenolic compounds (Figure 1) (Mohammadian et al., 2010). Other applications of laccase include the cleaning the industrial effluents, mostly from industries like paper industry, pulp, textile & petrochemical industries. Laccase are also used in the medical diagnostics and for cleaning herbicides, pesticides and some explosives in soil. Laccase has many applications in agricultural, medicinal and industrial areas (Arora and Sharma, 2010). Laccases are also to clean the water in many purification systems. It has also applications in medical side to prepare certain drugs like anticancer drugs and it is added in cosmetics to minimize their toxic effects. Laccase has the enormous ability to remove xenobiotic substances and produce polymeric products and that is why they are being used for many bioremediation purposes (Couto and Herrera, 2006). Now researchers are working on enzymatic synthesis of organic compounds, laccase-based biooxidation, and biotransformation and biosensor development. The yield of laccase can be increased by optimizing different cultural conditions (Arora and Sharma, 2010).

Figure 1. Scheme of applications of laccase (Morozova et al., 2007)

Applications of laccase in food industries Wine stabilization Laccase is used to improve the quality of drinks and for the stabilization of certain perishable products containing plant oils (Morozova et al., 2007). In food industry, wine stabilization is the main application of laccase (Duran and Esposito, 2000; Rosana et al., 2002). Polyphenols have undesirable effects on wine production and on its organoleptic characteristics, so their removal from the wine is very necessary (Rosana et al., 2002). Many innovative treatments, such as enzyme inhibitors, complexing agents, and sulfate compounds, have been proposed for the removal of phenolics responsible for discoloration, haze, and flavor changes but the possibility of using enzymatic laccase treatments as a specific and mild technology for stabilizing beverages against discoloration and clouding represents an attractive alternative (Cantarelli et al., 1989; Arora and Sharma, 2010). Since such an enzyme is not yet allowed as a food additive, the use of immobilized laccase might be a suitable method to overcome such legal barriers as in this form it may be classified as technological aid. So laccase could find application in preparation of must, wine and in fruit juice stabilization (Minussi et al., 2002; Arora and Sharma, 2010). Baking industry In the bread-making process laccases affix bread and/or dough-enhancement additives to the bread dough, these results in improved freshness of the bread texture, flavour and the improved machinability (Minussi et al., 2002). Laccase is also one of the enzymes used in the baking industry. Laccase enzyme is added in the

6Muhammad IMRAN et al.

baking process which results in the oxidizing effect, and also improves the strength of structures in dough and/or baked products. Laccase imparts many characteristics to the baked products including an improved crumb structure, increased softness and volume. A flour of poor quality can be also used in this process using laccase enzyme (Minussi et al., 2002). Applications of laccase in textile industry Synthetic dyes are widely used in such industries as textile, leather, cosmetics, food and paper printing (Forgacsa et al., 2004). Reactive dyes are coloured molecules used to dye cellulose fibres (Tavares et al., 2009). These dyes result in the production of large amounts of high-colored wastewater. A special problem is found in the application of synthetic dyes that they are resistant to biodegradation (Wesenberg et al., 2003, Moilanen et al., 2010). Normally, from 10 to 50% of the initial dye load will be present in the dyebath effluent, giving rise to a highly coloured effluent (Vandevivere et al., 1998; Moilanen et al., 2010). Therefore, the treatment of industrial effluents containing aromatic compounds is necessary prior to final discharge to the environment (Khlifia et al., 2010). Nowadays, environmental regulations in most countries require that wastewater must be decolorized before its discharge (Moilanen et al., 2010) to reduce environmental problems related to the effluent (Tavares et al., 2009). A wide range of physicochemical methods has been developed for the degradation of dye-containing wastewaters (Vandevivere et al., 1998; Tavares et al., 2009). Wastewaters from textile dying process are usually treated by physical or chemical processes, which include physical–chemical processes electrokinetic coagulation, electrochemical destruction, irradiation, precipitation, ozonation, or the Katox method that involves the use of active carbon and the mixture of certain gases (air) (Banat et al., 1996, Khlifia et al., 2010, Tavares et al., 2009). However, due to the chemical nature, molecular size and structure of the reactive dyes these classical processes can cause a problem in the environment and better treatments can be obtained using bioprocesses (Tavares et al., 2009). Recently, enzymatic treatments have attracted much interest in the decolourization/degradation of textile dyes in wastewater as an alternative strategy to conventional chemical and physical treatments, which present serious limitations (Cristovao et al., 2008, Tavares et al., 2009).

Five indigenous fungi P. ostreatus IBL-02, P. chrysosporium IBL-03, Coriolus versicolor IBL04, G. lucidum IBL-05 and S. commune IBL-06 were screened for decolorization of four vat dyes, Cibanon red 2B-MD, Cibanon golden-yellow PKMD, Cibanon blue GFJ-MD and Indanthrene direct black RBS. The screening experiment was run for 10 days with 0.01% dye solutions prepared in alkaline Kirk’s basal nutrient medium in triplicate (250 ml flasks). Every 48 h samples were read on their respective wavelengths to determine the percent decolorization. It was observed that C. versicolor IBL-04 could effectively decolorized all the four vat dyes at varying incubation times but best results were shown on Cibanon blue GFJ-MD (90.7%) after 7 days, followed by golden yellow (88%), Indanthrene direct black (79.7%) and Cibanon red (74%). P. chrysosporium also showed good decolorization potential on Cibanon blue (87%), followed by Cibanon golden-yellow (74.8%), Red (71%), and Indanthrene direct black (54.6%) (Asghar et al., 2008). Decolourization and detoxification of a textile industry effluent by laccase from Trametes trogii in the presence and the absence of laccase mediators had been investigated. It was found that laccase alone was not able to decolourize the effluent efficiently even at the highest enzyme concentration tested: less than 10% decolourization was obtained with 9 U/mL reaction mixtures. To enhance effluent decolourization, several potential laccase mediators were tested at concentrations ranging from 0 to 1mM. Most potential mediators enhanced decolourization of the effluent, with 1hydroxybenzotriazol (HBT) being the most effective (Khlifia et al., 2010). Moilanen et al. (2010) used the crude laccases from the white-rot fungi Cerrena unicolor and Trametes hirsuta for their ability to decolorize simulated textile dye baths. The dyes used were Remazol Brilliant Blue R (RBBR) (100 mg/L), Congo red (12.5 mg/L), Lanaset Grey (75 mg/L) and Poly R-478 (50 mg/L). They assessed the effect of redox mediators on dye decolorization by laccases. The result was that C. unicolor laccase was able to decolorize all the dyes tested. It was especially effective towards Congo red and RBBR with 91 and 80% of color removal in 19.5 h despite the fact that simulated textile dye baths were used.

Applications in pharmaceutical industry Laccases have been used for the synthesis of several products of pharmaceutical industry (Arora and Sharma, 2010). The first chemical of the

Production and industrial applications of laccase 7 

pharmaceutical importance that has been prepared using laccase enzyme is actinocin that has been prepared from 4-methyl-3-hydroxyanthranilic acid. This compound has anticancer capability and works by blocking the transcription of DNA from the tumor cell (Burton, 2003). Another example of the anticancer drugs is Vinblastine, which is useful for the treatment of leukemia. The plant Catharanthus roseus naturally produces vinblastine. This plant produces small amount of this compound. Katarantine and vindoline are the precursors of this pharmaceutically important compound. These precursors are produced in higher quantities and are easy to purifiy. Laccase is used to convert these precursors into vinblastine. A 40% conversion of these precursors into the final product has been obtained using laccase (Yaropolov et al., 1994). The use of laccase in such conversion reactions has made the preparation of several important compounds with useful properties, like antibiotics, possible (Pilz et al., 2003). Catechins have the antioxidant ability and Laccases can oxidize catechins. These catechins consist of small units of tannins and these are important antioxidants found in tea, herbs and vegetables. Catechins have the tendency to hunt free radicals and their property makes them useful in preventing several diseases including cancer, inflammatory and cardiovascular diseases. The catechins have less antioxidant ability; this property can be increased by using laccase and has resulted in the conversion of catechins in several products with enhanced antioxidant capability (Kurisawa et al., 2003). Laccase has applications in the synthesis of hormone derivatives. Intra et al. (2005) and Nicotra et al. (2004) have reported that laccase has the ability to seperate innovative dimeric derivatives of the β-estradiol and of the phytoalexin resveratrol. Isoeugenol oxidation coniferyl alcohol and totarol gave new dimeric derivatives (Ncanana et al., 2007) and a mixture of dimeric and tetrameric derivatives (Shiba et al., 2000) respectively, whereas the oxidation of substituted imidazole has resulted in the production of even more complex substrances. These new formed imidazoles or oligomerization products (2–4) can be used for pharmacological purposes (Kurisawa et al., 2003). Aromatic and aliphatic amines can be converted into 3-(3, 4-dihydroxyphenyl)-propionic acid using laccase based oxidation. The derivatives have the antiviral natural activity and can be used for

pharmaceutical purposes (Ncanana et al., 2007).

Conclusion Laccases are produced by various sources like fungi, bacteria and insects. They have many industrial applications because of their innate ability of oxidation of a broad range of phenolic and non-phenolic compounds. Laccase is utilized in drink industry to improve the quality of drinks and for stabilization of some perishable products having plant oils. Laccases have the potential for the synthesis of several useful drugs in pharmaceutical industry because of their high value of oxidation potential. Laccases have also tremendous ability of oxidation of harmful and industrial products and belongs to those enzymes, which have instinctive properties of immediate radical production. Laccase enzyme has the property to act on a range of substrates and to detoxify a range of pollutants, which have made them to be useful in many industries including paper, pulp, textile and petrochemical industries.

References Aisemberg GO, Grorewold E, Taccioli GE, Judewicz N. A major transcript in the response of Neurospora crassa to protein synthesis inhibition by cycloheximide. Exp Mycol. 13: 121–128, 1989. Alexandre G, and Zhulin IB. Laccases are wide spread in bacteria. Trends in Biotech. 18: 41– 42, 2000. Amat AS, Elio PL, Fernandez E, Borron JCG, Solano F. Molecular cloning and functional characterization of a unique multipotent polyphenol oxidase from Marinomonas mediterranea. Biochem Biophys Acta. 1547: 104–116, 2001. Arakane Y, Muthukrishnan S, Beeman RW, Kanost MR, Kramer KJ. Laccase 2 is the phenoloxidase gene required for beetle cuticle tanning. PNAS. 102: 11337-11342, 2005. Arora DS, Sharma RK. Ligninolytic Fungal Laccases and Their Biotechnological Applications. Appl Biochem Biotechnol. 160: 1760–1788, 2010.

8Muhammad IMRAN et al.

Asghar M, Batool S, Bhatti HN, Noreen R, Rahman SU, Asad MJ. Laccase mediated decolorization of vat dyes by Coriolus versicolor IBL-04. Int Biodet Biodeg. 62: 465-470, 2008. Bailey MR, Woodard SL, Callawy E, Beifuss K, Lundback MM, Lane J. Improved recovery of active recombinant laccase from maize seed. Appl Microbiol Biotechnol. 63: 390–397, 2004. Baldrian P. Fungal laccases occurrence and properties. FEMS Microbiol Rev. 30: 215–242, 2006. Banat IM, Nigam P, Singh D, Marchnt R. Microbial decolorization of textile dye containing effluent: a review. Bioresour Technol. 58: 217–227, 1996. Birhanli E and Yesilada O. Increased production of laccase by pellets of Funalia trogii ATCC 200800 and Trametes versicolor ATCC 200801 in repeated-batch mode. Enzy Microb Technol. 39: 1286–1293, 2006. Burton S. Laccases and phenol oxidases in organic synthesis. Curr Org Chem. 7: 1317-1331, 2003. Cantarelli C, Brenna O, Giovanelli G, Rossi M. Beverage stabilization through enzymatic removal of phenolics. Food Biotechnol. 3: 203– 214, 1989. Claus H. Laccases and their occurrence in prokaryotes. Arch Microbiol. 179: 145–150, 2003. Collins PJ and Dobson ADW. Regulation of laccase gene transcription in Trametes versicolor. Appl Environ Microbiol. 63: 3444– 3450, 1997.

Technol. 99: 4768–4774, 2008. Davis RH and Perkins DD. Timeline: Neurospora: a model of model microbes. Nat Rev Genet. 3: 397–403, 2002. Dittmer NT, Suderman RJ, Jiang H, Zhu YC, Gorman MJ, Kramer KJ, Kanost MR. Characterization of cDNA encoding putative laccase-like multicopper oxidases and developmental expression in the tobacco hornworm, Manduca sexta, and the malaria mosquito, Anopheles gambiae. Insect Biochem Mol Biol. 34: 29–41, 2004. Duran N and Esposito E. Potential applications of oxidative enzymes and phenoloxidase-like compounds in wastewater and soil treatment: a review. Appl Cataly Env. 28: 83–99, 2000. Eggert C, Temp U, Eriksson KE. The ligninolytic system of the white rot fungus Pycnoporus cinnabarinus: purification and characterization of the laccase. Appl Environ Microbiol. 62: 1151–1158, 1996. Enguita FJ, Martins LO, Henriques AO, Carrondo MA. Crystal structure of a bacterial endospore coat component. A laccase with enhanced thermostability properties. J Biol Chem. 278: 19416–19425, 2003. Faure D, Bouillant ML, Bally R. Isolation of Azospirillum lipoferum 4T Tn5 mutants affected in melanization and laccase activity. Appl Environ Microbiol. 60, 3413–3415, 1994. Forgacsa E, Cserhatia T, Oros G. Removal of synthetic dyes from wastewaters: a review. Environ Int. 30: 953–971, 2004.

Couto SR and Herrera JLT. Industrial and biotechnological applications of laccases: A review. Biotechnol Advances. 24: 500–513, 2006.

Galai S, Limam F, Marzouki MN. A new Stenotrophomonas maltophilia strain producing laccase. Use in decolorization of synthetic dyes. Appl Biochem Biotechnol. 158(2): 416-431 2009.

Cristovao RO, Tavares APM, Ribeiro A, Loureiro JM, Boaventura RAR, Macedo EA. Kinetic modelling and simulation of laccase catalyzed degradation of reactive textile dyes. Biores

Galhaup C, Wagner H, Hinterstoisser B, Haltrich D. Increased production of laccase by the wooddegrading basidiomycetes Trametes pubescens. Enz Microb Technol. 30: 529–536, 2002.

Production and industrial applications of laccase 9 

Gianfreda L, Xu F, Bollag JM. Laccases: a useful group of delignification and possible industrial applications. Multi-Copper Oxidases. Messerschmidt A (Ed). Singapore: World Scientific. 201–224, 1999. Giardina P, Faraco V, Pezzella C, Piscitelli A, Vanhulle S, Sannia G. Laccases: a never-ending story. Cell Mol Life Sci. 67: 369–385, 2010. Givaudan A, Effose A, Faure D, Potier P, Bouillant ML, Bally R. Polyphenol oxidase in Azospirillum lipoferum isolated from rice rhizosphere: evidence for laccase activity in non-motile strains of Azospirillum lipoferum. FEMS Microbiol Lett. 108: 205–210, 1993. Gnanamani A, Jayaprakashvel M, Arulmani M, Sadulla S. Effect of inducers and culturing processes on laccase synthesis in Phanerochaete chrysosporium NCIM 1197 and the constitutive expression of laccase isozymes. Enz Microb Technol. 38: 1017-1021, 2006. Heinzkill M, Messner K. The ligninolytic system of fungi. Fungal biotechnology. Anke T (Ed). Chap Hall Weinheim. 213–226, 1997. Intra A, Nicotra S, Riva S, Daniel B. Significant and unexpected solvent influence on the selectivity of laccase-catalyzed coupling of tetrahydro-2-naphthol derivatives. Adv Synth Catal. 347: 973-977, 2005. Jolivalt C, Brenon S, Caminade E, Mougin C, Pontie M. Immobilization of laccase from Trametes versicolor on a modified PVDF microfiltration membrane: characterization of the grafted support and application in removing a phenylurea pesticide in wastewater. J Membr Sci. 180: 103–113, 2000. Jolivalt C, Raynal A, Caminade E, Kokel B, Le Goffic F, Mougin C. Transformation of N,N dimethyl-N-(hydroxyphenyl)ureas by laccase from the white rot fungus Trametes versicolor. Appl Microbiol Biotechnol. 51: 676–681, 1999. Khlifia R, Belbahria L, Woodwarda S, Ellouza M, Dhouiba A, Sayadia S, Mechichia T.

Decolourization and detoxification of textile industry wastewater by the laccase-mediator system. J Hazard Mater. 175: 802–80, 2010. Kiiskinen LL, Ratto M, Kruus K. Screening for novel laccase-producing microbes. J Appl Microbiol. 97: 640–646, 2004. Koschorreck K, Schmid RD, Urlacher VB. Improving the functional expression of a Bacillus licheniformis laccase by random and site-directed mutagenesis. J Biotechnol. 9(12): 1-10, 2009. Kurisawa M, Chung JE, Uyama H, Kobayashi S. Laccase-catalyzed synthesis and antioxidant property of poly(catechin). Macromol Biosci. 3: 758-764, 2003. Leonowicz A, Cho NS, Luterek J, Wilkolazka A, Wotjas-Wasilewska M, Matuszewska A, Hofrichter M, Wesenberg D, Rogalski J. Fungal laccase: properties and activity on lignin. J Bas Microbiol. 41: 185–227, 2001. Liers C, Ullrich R, Pecyna M, Schlosser D, Hofrichter M. Production, purification and partial enzymatic and molecular characterization of a laccase from the woodrotting ascomycete Xylaria polymorpha. Enz Microb Technol. 41: 785–793, 2007. Mayer AM. Polyphenol oxidases in plant: recent progress. Phytochem. 26: 11–20, 1987. Mayer AM, Staples RC. Laccase: new functions for an old enzyme. Phytochem. 60: 551–565, 2002. Minussi RC, Pastore GM, Duran N. Potential applications of laccase in the food industry. Trends in Food Scien Technol. 13: 205–216, 2002. Mishra A, Kumar S, Kumar S. Application of BoxBenhken experimental design for optimization of laccase production Coriolus versicolor MTCC138 in solid-state fermentation. J Sci Indust Res. 67: 1098-1107, 2008.

10Muhammad IMRAN et al.

Mohammadian M, Roudsari MF, Mollania N, Dalfard AB, Khajeh K. Enhanced expression of a recomninant bacterial laccase at low temperature and microacrobic conditions: purification and biochemical characterization. J Ind Microbiol Biotechnol. 5: 41-45, 2010. Moilanen U, Osma JF, Winquist E, Leisola M, Couto SR. Decolorization of simulated textile dye baths by crude laccases from Trametes hirsute and Cerrena unicolor. Eng Life Sci. 10(3): 1–6, 2010. Morozova OV, Shumakovich GP, Gorbacheva MA, Shleev SV, Yaropolov AI. “Blue” Laccases. J Biochem. 72(10): 1136-1150, 2007. Mougin, C., Boyer, F. D., Caminade, E., Rama, R. Cleavage of the diketonitrilederivative of the herbicide isoxaflutole by extra cellular fungal oxidases. J Agric Food Chem. 48: 4529–4534, 2000. Ncanana S, Baratto L, Roncaglia L, Riva S, Burton SG. Laccase mediated oxidation of totarol. Adv Synth Catal. 349 : 1507-1513, 2007. Nicotra S, Cramarossa MR, Mucci A, Pagnoni UM, Riva S, Forti L. Biotransformation of resveratrol: synthesis of trans-dehydrodimers catalyzed by laccases from Myceliophtora thermophyla and from Trametes pubescens. Tetrahedron. 60: 595-600, 2004. Niladevi KN, Sukumaran RK, Jacob N, Anisha GS, Prema P. Optimization of laccase production from a novel strain-Streptomyces psammoticus using response surface methodology. Microbiol Res. 164: 105-113, 2009. Pandey A. Solid State Fermentation. Pandey A (Ed). Wiley Eastern Publishers, New Delhi. 3– 10, 1994. Pilz R, Hammer E, Schauer F, Krag U. Laccasecatalyzed synthesis of coupling products of phenolic substrates in different reactors. Appl Microbiol Biotechnol. 60: 708-712, 2003. Rama R, Mougin C, Boyer FD, Kollmann A, Malosse C and Sigoillot JC. Biotransformation

of benzo[a]pyrene in bench scale reactor using laccase of Pycnoporus cinnabarinus. Biotechnol Lett. 20: 1101–1104, 1998. Ranocha P, Chabannes M, Chamayou S, Danoun S, Jauneau A, Boudet AM. Laccase downregulation causes alteration in phenolic metabolism and cell wall structure in poplar. Plant Physiol. 129:1–11, 2002. Rosana C, Minussi Y, Pastore GM, Durany N. Potential applications of laccase in the food industry. Trends in Food Sci Technol. 13: 205216, 2002. Savoie JM, Mata G, Billette C. Extracellular laccase production during hyphal interactions between Trichoderma sp. and Shiitake, Lentinula edodes. Appl Microbiol Biotechnol. 49: 589-593, 1998. Sadhasivam S, Savitha S, Swaminathan K, Lin FH. Production, purification and characterization of mid-redox potential laccase from a newly isolated Trichoderma harzianum WL1. Process Biochem. 43: 736-742, 2008. Sharma KK and Kuhad RC. Laccase: enzyme revisited and function redefined. Ind J Microbiol. 48: 309–316, 2008. Sharma P, Goel R, Caplash N. Bacterial laccases. World J Microbiol Biotechnol. 23: 823-832, 2007. Shiba T, Xiao L, Miyakoshi T, Chen CL. Oxidation of isoeugenol and coniferyl alcohol catalyzed by laccase isolated from Rhus vernicifera Stokes and Pycnoporus coccineus. J Mol Catal Enzym. 10: 605-615, 2000. Smith M, Thurston F, Wood DA. Fungal laccases: role in oxidoreductive enzymes. Bioremed J. 3: 1–25, 1997. Solden DM and Dobson DW. Differential regulation of laccase gene expression in Pleurotus sajor-caju. Microbiol. 147: 1755– 1763, 2001. Souza D and Peralta RM. Production of laccase

Production and industrial applications of laccase 11 

isoforms by Pleurotus pulmonarius in response to presence of phenolic and aromatic compounds. J Basic Microbiol. 44(2): 129–136, 2004. Souza CGM, Zilly A, Peralta RM. Production of laccase as the sole phenoloxidase by a Brazilian strain of Pleurotus pulmonarius in solid state fermentation. J Bas Microbiol. 42: 83–90, 2002. Souza DDT, Tiwari R, Sah AK, Raghukumara C. Enhanced production of laccase by a marine fungus during treatment of colored effluents and synthetic dyes. Enz Microb Technol. 38: 504511, 2006. Tavares APM, Cristovao RO, Gamelas JAF, Loureiro JM, Boaventuraa RAR, Macedoa EA. Sequential decolourization of reactive textile dyes by laccase mediator system. J Chem Technol Biotechnol. 84: 442–446, 2009. Vandevivere PC, Bianchi R, Verstraete W. Treatment and reuse of wastewater from the textile wet-processing industry: review of emerging technologies. J Chem Technol Biotechnol. 72: 289–302, 1998. Wesenberg D, Kyriakides I, Agathos N. White-rot fungi and their enzymes for the treatment of industrial dye effluents. Biotechnol Adv. 22: 161–187, 2003. Yaropolov AI, Skorobogatko OV, Vartanov SS, Varfolomeyev SD. Laccase: Properties, catalytic mechanism and applicability. Appl Biochem Biotechnol. 49: 257–280, 1994.

Journal of Cell and Molecular Biology 10(1):13-18, 2012 Haliç University, Printed in Turkey. http://jcmb.halic.edu.tr

Research Article 13

Isolation and biochemical identification of Escherichia coli from wastewater effluents of food and beverage industry Tasnim FARASAT*, Zubia BILAL, Fakhar-un-Nisa YUNUS Department of Zoology, Lahore College for Women University, Lahore, Pakistan. (* author for correspondence; [email protected]) Received: 20 May 2011; Accepted: 11 May 2012

Abstract The aim of this study was the isolation and biochemical identification of E. coli from industrial wastewater effluents. Sixty samples were collected from different sources in Lahore. The results revealed that E.coli was found in higher concentration in wastewater of food and beverage industries. Wastewater is an important reservoir for E.coli and presented significant acute toxicity if released into the receiving water body without being adequately treated. Results revealed the presence of both gram negative and positive bacteria. There was nonsignificant variation among all the samples of wastewater. The highest concentration of E.coli was observed in wastewater of food industry Site A (Rettigon road) and beverage industry Site F (Wahdat road). Biochemical and serological tests confirmed the presence of E.coli.

Keywords: E .coli, wastewater, food industry, beverage industry, effluent. Yiyecek ve içecek endüstrisi atıksu deşarjlarından Escherichia coli eldesi ve biyokimyasal tanımlanması Özet Bu çalışmanın amacı endüstriyel atıksu deşarjlarından E. coli eldesi ve biyokimyasal tanımlanmasıdır. Lahor’da farklı kaynaklardan 60 örnek toplandı. Sonuçlar yiyecek ve içecek endüstrisi atıksularında daha fazla konsantrasyonda E. coli bulunduğunu gösterdi. Atıksu önemli bir E.coli deposudur ve yeterli olarak muamele edilmeden alıcı su kaynağına salınırsa ileri derecede toksik olabilir. Sonuçlar hem gram pozitif, hem de gram negatif bakteri varlığını gösterdi. En yüksek E. coli konsantrasyonu A bölgesi (Rettigon yolu) yiyecek endüstrisinin ve F bölgesi (Wahdat yolu) içecek endüstrisinin atıksularında gözlemlendi. Biyolojik ve serolojik testler E. coli varlığını doğruladı.

Anahtar kelimeler: E.coli, atıksu, yiyecek endüstrisi, içecek endüstrisi, atıksu deşarjı.

Introduction Industrial waste is the most common source of water pollution in the present day (Ogedengbe and Akinbile, 2004) and it increases yearly due to the fact that industries are increasing as most countries are getting industrialized. Industries produce wastes which are peculiar in terms of type, volume and frequency depending on the type of industry and population that uses the product (Odumosu, 1992). Water and wastewater management constitutes a

practical problem for the food and beverage industry. In spite of significant improvement over the last 20 years, water consumption and disposal remain critical from environmental and economic standpoint (Fillaudeau et al., 2005). A food processing industry is involved with the total environment from the farm to the customer. Water is absolutely necessary for many steps in the food processing industry. At present, there is no economical substitute of water. Consequently water conservation and water reuse are necessary. By

14 Tasnim FARASAT et al.

practicing conservation and reuse, the amount of liquid waste and pollution potential from the food processing is reduced (Mercer, 1964). On a global scale, contamination of drinking water by pathogenic bacteria causes the most significant health risk to humans, and there have been countless numbers of disease outbreaks and poisonings resulting from exposure to untreated or poorly treated drinking water. However, significant risks to human health may also result from exposure to toxic contaminants that are often globally ubiquitous in waters from which drinking water is derived. The presence of E. coli is a definite indication of fecal contamination (WHO, 2004). Some E. coli strains can cause a wide variety of intestinal and extra-intestinal diseases, such as diarrhea, urinary tract infections, septicemia, and neonatal meningitis (Orskov and Orskov, 1992). The magnitude of the problem of bacterial contamination deserves more elaborative studies from the point of production of waste effluents to the point of consumption at all intermediary levels. The aim of the present research was isolation and biochemical identification of E.coli from industrial effluents of food and beverage industries in Lahore.

Material and methods Sample collection Sampling was completed in two successive months from March to April for the microbial assessment of waste effluents from food and beverage industries. Total of sixty samples were collected. In March, effluents of food industries were collected from industries near Rettigon road, Township industrial area, Township industrial estate. In April, effluents of beverage industries were collected from industries near Multan road and Wahdat road. Data from each sample was collected and recorded in the data book. Samples were collected in hermetically sealed, sterilized falcon tubes and were kept at 4ºC until analysis. Sample processing The technique described by Theodor Escherich, 1885 was used for isolation of E.coli (Escherich, 1885). To prevent contamination, the area was swabbed with 70% ethanol prior to opening any sample container. Samples (0.5 ml) were taken in 10 ml LB (Luria Bertani) broth medium in test tube, and vortexed for one minute and left for thirty minutes at room temperature. Then supernatant (1ml) was taken from this test tube and a 2-fold serial dilution was prepared (Reddy, 2007). After

this, 500 ml from the final dilution tube was spreaded on the petri dishes (Pyrex) of MacConkey medium and LB medium. Petri dishes were kept in the incubator for 24 hours at 37ºC (Hajna and Perry, 1939). After 24 hours, plates were studied for the colonies of microbes grown on the media. Microorganisms grown on MacConkey agar are capable of metabolizing lactose which produces acid by-products that lower the pH of the media which causes the neutral red indicator to turn red, and if sufficient acid is produced, a zone of precipitated bile develops around the colony (Koneman, 2005). Different biochemical tests (Werkman, 1930; O'Meara, 1931; Vaughn et al., 1939; Silva et al., 1980) were performed for the identification of E. coli in the waste effluents of food and beverage industry (Table 1). Serological tests Commercial latex kits are available for O157, O26, and H7 strains of E. coli. O157 antiserum has been shown to cross-react with other organisms including E. hermanii (frequently found in foods) (Hopkins and Hilton, 2000; Law, 2000). Tests incorporated positive and negative control organisms and control latex. Test was performed by a slide agglutination test using somatic (O) or flagella (H) antisera. Some pathogenic bacteria were nonmotile.

Results E. coli was cultured on LB medium and MacConkey medium for morphological characterization. After 24 hrs, two types of colonies were isolated under microscopic examination. All the isolated colonies were pink on MacConkey medium, while creamy yellow on LB medium. E. coli was observed in highest concentration from wastewater samples of industry (Site A) whereas in wastewater samples of industry (Site B) six samples indicated the presence of E. coli which was confirmed by biochemical and serological test. Four samples were of gram positive bacteria which may be Bacillus subtilus or Bacillus thuringiensis. In industrial effluent (Site C) eight samples were of gram negative while two samples were of gram positive bacteria. It was observed that waste effluents of food industry (Site A) revealed greater percentage of gram negative bacteria. In wastewater samples of industry (Site D) five were gram negative, while five were gram positive bacteria. Six samples in industrial effluent (Site E)

Identification of E. coli from wastewater 15

Table 1. Biochemical identification of E. coli in industrial wastewaters Samples Sources

Indole Test

Spot Indole Test

Kovacs Indole Test

Methyl Red Test

Voges Proskeur Test

Industrial effluent (A)

+

+

+

+

Industrial effluent(B)

+

+

+

+

+

+

Industrial effluent(C) Industrial effluent(D) Industrial effluent(E) Industrial effluent(F)

Simmon's Test Ammonium acetate Test

Ammonium Citrate Test

-

+

-

+

-

+

-

+

+

-

+

-

+

+

+

-

+

-

+

+

+

+

-

+

-

+

+

+

+

-

+

-

were gram negative and four were gram positive bacteria. In the wastewater samples of beverage industry (Site F) all samples were of gram negative bacteria (Figure 1 and 2). The average value of gram negative bacteria in wastewater of food industry (Site A) was 5.10 ± 0.34. The average value of gram negative bacteria in wastewater of food industry (Site B) was 4.66 ± 0.66 while in wastewater of food industry (Site C)

was 4.50 ± 0.50. The average value of gram negative bacteria in wastewater of beverage industry (Site D) was 5.0 ± 0.70, whereas in the wastewater of beverage industry (Site E) was 3.8 ± 0.60 and in the wastewater of beverage industry (Site F) was 4.0 ± 0.33. Student’s t-test revealed a non significant difference (P >0.05) between gram positive and gram negative bacteria.

Figure 1. Percentage of gram negative bacteria in all industrial wastewater samples. Food Industry A: Rettigon road; Food Industry B: Township industrial area; Food Industry C: Township industrial estate; Beverage industry D: Multan Road; Beverage industry E: Multan road; Beverage industry F: Wahadat road

16 Tasnim FARASAT et al.

Figure 2. Number of E.coli colonies (mean ±SE) in wastewater samples of industries. Sites A, B, C: Food industries at Rettigon road, Township industrial area, Township industrial Estate Sites D, E, F: Beverage industries at Multan Road and Wahadat road.

Discussion The bacterium E. coli is one of the best and most thoroughly studied free-living organisms. It is also a remarkably diverse species because some E.coli strains live as harmless commensals in animal intestines. E. coli is a widely used indicator of fecal contamination in water bodies. External contact and subsequent ingestion of bacteria from fecal contamination can cause detrimental health effects (Money et al., 2009). Stomach cramps, nausea and vomiting are the symptoms caused by E. coli, however serious complications can also occur. Water samples were the only nonfecal samples that tested positive for E. coli. Water has been implicated in human outbreaks and the studies revealed that water may be an important source of 0157:H7 on farms (Karmali, 1989). The present research work was conducted to isolate E. coli from food and beverage industrial effluents. Effluents are good primary reservoir for E. coli. Sixty different samples from food and beverage industries were processed for the isolation of E. coli. The food and beverage industries uses large volume of water as it is suitable, clean, and a quite inexpensive resource, both as a constituent of many products, and for other production requirements. Microbial growth in drinks due to

contaminated water supplies or sugar syrups can cause discoloration, off flavors and shortened shelflife, as well as increasing the risk of infection to consumers (Noronha et al., 2002). However, selective media are universally used in water monitoring and were employed in the United States Environmental Protection Agency epidemiological investigations, suggesting that culturable fecal indicator counts are valid predictors of disease risk (Sinton et al., 1994). Sewage can serve as a vehicle for entering into human and nonhuman hosts either by direct contact or through contamination of drinking water supplies (Boczek et al., 2007). The results revealed that the highest percentage of E. coli was observed in the waste effluents of industries (A and F). ANOVA showed non significant (P > 0.05) variation. Student’s t-test also revealed non significant difference between gram positive and gram negative bacteria. According to Boczek and colleagues (2007) the occurrence of clonal group in wastewater demonstrates a potential mode for the dissemination of this clonal group in the environment, with possible secondary transmission to human or animal hosts. Chalmers and colleagues (2000) demonstrated that the effluent had a significant pollution potential, mainly due to the low pH and high concentration of E. coli. The results also

Identification of E. coli from wastewater 17

demonstrated that the wastewater presented significant acute toxicity, and could cause diseases if released into the receiving body without being adequately treated. This represents a dangerous public health risk, which needs future evaluation and control. Culture-independent analysis in various environmental samples has been used to catalog this species and also to assess the impact of human activity and interactions with microbes on natural microbial communities. According to Barreto-Rodrigues and colleagues (2008), the objective of the work was to characterize the effluent originating from a Brazilian TNT production industry. Analyses were performed using physical, chemical, spectroscopic and ecotoxicological assays, which demonstrated that the effluent had a significant pollution potential, mainly due to the low pH and high concentration of TNT (156 ± 10 mg L−1). The results also demonstrated that the effluent causes significant acute toxicity, and could cause countless damages if released into the rivers without being properly treated. The observed pollution potential justifies studies to evaluate treatment technologies or recover the residue generated in the TNT industry. From a total of 149 E. coli strains, 87 E. coli strains were from raw wastewater and 62 strains from treated wastewater by stabilization ponds. Within these strains two and four positive serological reaction to E. coli 0157 were found for raw and treated wastewater, respectively. In the same direction, Muller and his colleagues (2001) carried out a study on E.coli 0157:H7 strains in water sources in South Africa and they did not find any evidence of EHEC 0157 while virulence factors present in the 96% of analyzed samples (196), however 8 isolates from 8 samples demonstrated the presence of Stx1 and Stx2.

Chalmers RM, Aird H, Bolton FJ. Waterborne Escherichia coli 0157. J Appl Microbiol. 88: 124-132, 2000.

References Barreto-Rodrigues M, Silva FT, Paiva TCB. Characterization of wastewater from the Brazilian TNT industry. J Haz Mat. 164: 385388, 2008.

Money ES, Carter GP, Serre ML. Modern space/time geo statistics using river distances: data integration of turbidity and Escherichia coli measurements to assess fecal contamination along the Raritan River in New Jersey. Environ Sci Technol. 43: 3736-3742, 2009.

Boczek LA, Rice EW, Johnston B, Johnson JR. Occurrence of antibiotic-resistant uropathogenic Escherichia coli clonal group A in wastewater effluents. Appl Environ Microbiol. 73: 41804184, 2007.

Müller EE, Ehlers MM, Grabow, WOK. The occurrence of E. coli 0157:H7 in South Africa water sources intended for direct and indirect human consumption. Wat Res. 35: 3085 -3088, 2001.

Escherich T. Die Darmbakterien des Neugeboren und Sauglings Fortschr. Med. 3: 515-522, 1885. Fillaudeau L, Blanpain-Avet P, Daufin G. Water, wastewater and waste management in brewing industries. J Cle Pro. 14: 463-471, 2005. Hajna AA, Perry CA. Optimum Temperature for Differentiation of Escherichia coli from Other Coliform Bacteria. J Bacteriol. 38: 275-283, 1939. Hopkins KL, Hilton AC. Methods available for the sub-typing of Escherichia coli O157. World J Microbiol Biotechnol. 16: 741-748, 2000. Karmali MA. Infection by verocytotoxin-producing Escherichia coli. Clin Microbiol Rev. 2: 15-38, 1989. Koneman EW. Color Atlas and Textbook of Diagnostic Microbiology, Lippincott, JB. (Ed), Philadelphia. 313-317, 2005. Law D. Virulence factors of Escherichia coli O157 and other Shiga toxin-producing E. coli. J Appl Microbiol. 88: 729-745, 2000. Mercer WA. Physical Characteristics of Recirculated Water as Related to Sanitary Conditions. Food Technol. 335: 111-115, 1964.

18 Tasnim FARASAT et al.

Noronha M, Britz T, Mavrov V, Janke HD, Chmiel H. Treatment of spent process water from a fruit juice company for purposes of reuse: hybrid process concept and on-site test operation of a pilot plant. Desalination. 143: 183-196, 2002. Odumosu AOT. Management of liquid industrial waste. Ind Waste Manage. 55: 6-7, 1992. Ogedengbe K, Akinbile CO. Impact of industrial pollutants on quality of ground and surface waters at Oluyole Industrial Estate, Ibadan, Nigeria. J Technol Develop. 4: 139-144, 2004. O'Meara RAQ. A simple delicate and rapid method of detecting the formation of acetylmethylcarbinol by bacteria fermenting carbohydrate. J Pathol Bacteriol. 34: 401-406, 1931. Orskov F, Orskov I. Escherichia coli serotyping and disease in man and animals. J Microbiol. 38: 699-704, 1992. Reddy CA. Methods for general and molecular microbiology (Ed). ASM Press, Washington. 447-521, 2007. Silva RM, Toledo MR, Trabulsi LR. Biochemical and cultural characteristics of invasive Escherichia coli. J Clin Microbiol. 11: 441- 444, 1980. Sinton LW, Davies-Colley RJ, Bell RG. Inactivation of enterococci and fecal coliforms from sewage and meatworks effluents in seawater chambers. Appl Environ Microbiol. 60: 2040-2048, 1994. Vaughn RH, Mitchell, NB, Levine, M. The VogesProskauer and methyl red reactions in the coliaerogenes group. J Am Water Works Assoc. 31: 993-1001, 1939. Werkman CH. An improved technic for the VogesProskauer test. J Bacteriol. 20: 121-125, 1930. World Health Organization- WHO. Guidelines for Drinking Water Quality: Recommendations (Ed). Switzerland. 1: 229-243, 2004.

Journal of Cell and Molecular Biology 10(1):19-26, 2012 Haliç University, Printed in Turkey. http://jcmb.halic.edu.tr

Research Article 19

Investigation of the MGP promoter and exon 4 polymorphisms in patients with ischemic stroke in the Ukrainian population Alexander V. ATAMAN*1, Victoria Y. GARBUSOVA2, Yuri A. ATAMAN3, Olga I. MATLAJ4, Olga A. OBUCHOVA1 1

Sumy State University, Department of Physiology, Pathophysiology and Medical Biology, Sumy, Ukraine Sumy State University, Scientific Laboratory of Molecular Genetic Research, Sumy, Ukraine 3 Sumy State University, Department of Internal Medicine, Sumy, Ukraine 4 Sumy Clinical Hospital No.5, Sumy, Ukraine (*author for correspondence; [email protected] ) 2

Received: 13 February 2012; Accepted: 18 May 2012

Abstract Matrix γ-carboxyglutamic acid protein (MGP) is a vitamin K-dependent protein playing a pivotal role in preventing arterial calcification. In the present study, we aimed to investigate the relation between three single nucleotide polymorphisms of MGP gene and ischemic stroke (IS) in the Ukrainian population. 170 IS patients and 124 healthy controls were recruited to the study. MGP SNPs were examined by PCR-RFLP methodology. The distribution of homozygous carriers of the major allelic variant, and heterozygous and homozygous minor allele variants of the T-138C MGP promoter polymorphism (rs1800802) in patients with IS was 61.2%, 31.2% and 7.6%, respectively. The corresponding distributions of the variants in the control group were 59.7%, 35.6%, 4.8%. With regard to the G-7A promoter polymorphism (rs1800801), the respective distributions were 35.9%, 48.8% and 15.3%, compared to 43.5%, 50% and 6.5% in the control group. Finally, the respective distributions according to the Thr83Ala exon 4 polymorphism (rs4236) were 39.4%, 48.8% and 11.8%, compared to 34.7%, 53.2% and 12.1% in the control group. Using logistic regression analysis, it was estimated that A/A genotype (G-7A polymorphism) was significantly (P=0.016) associated with IS (OR=2.943; 95% CI: 1.218–7.109) in the Ukrainian population. A-allele homozygotes of female sex had a risk of IS more than 7 times higher compared with carriers of G/G genotype. Keywords: Matrix Gla protein, single nucleotide polymorphism, ischemic stroke, arterial calcification, Ukrainian population.

Ukrayna popülasyonunda iskemik inme hastalarında MGP promotör ve ekzon 4 polimorfizminin araştırılması Özet Matris γ–karboksiglutamik asit proteini (MGP) vitamin-K bağımlı protein olup arteriyal kalsitleşmeyi önlemede önemli rol oynar. Bu çalışmada, MGP geninin üç tek nükleotit polimorfizmi (TNP) ile Ukrayna popülasyonunda iskemik inme (İİ) arasındaki ilişkiyi araştırmayı hedefledik. Çalışmaya 170 İİ hastası ve 124 sağlıklı kontrol katıldı. MGP TNP’leri PCR-RFLP metodolojisi ile test edildi. İH hastalarında T-138C MGP promoter polimorfizminin (rs1800802) majör alel varyantının homozigot taşıyıcılarının ve heterozigot ve homozigot minör alel varyantlarının dağılımları sırası ile, %61.2, %31.2 ve %7.6’dır. Kontrol grubunda ilgili varyant dağılımları %59.7, %35.6 ve %4.8’dir. G-7A promoter polimorfizminde (rs1800801) ise ilgili dağılımlar %43.5, %50 ve %6.5 olan kontrol grubu ile karşılaştırıldığında %35.9, %48.8 ve %15.3’dir. Son olarak, Thr83Ala ekzon 4 polimorfizmine (rs4236) göre dağılımlar %34.7, %53.2 ve %12.1 olan kontrol grubu ile karşılaştırıldığında %39.4, %48.8 ve %11.8’dir. Lojistik regresyon analizi kullanarak, Ukrayna popülasyonunda İİ ile A/A genotipinin (G-7A polimorfizmi) anlamlı (P=0.016) olarak ilişkili olduğu (OR=2.943; 95% CI: 1.218–7.109) tahmin edilmiştir. Anahtar kelimeler: Matris Gla protein, tek nükleotid polimorfizmi, iskemik inme, arteriyal kalsifikasyon, Ukrayna popülasyonu.

20 Alexander V. ATAMAN et al.

Introduction Ischemic stroke (IS) is, in many instances, the consequence of a thrombus forming on a ruptured atherosclerotic plaque. Extracellular matrix calcification is considered to be a novel marker of atherosclerosis and related to both coronary artery and cerebrovascular disease. It has been shown that arterial calcification in major vessel beds is associated with vascular brain disease (Bos et al., 2011). Recent studies suggest that in addition to modifiable risk factors, such as hypertension, hyperlipidemia, and cigarette smoking, there is a strong genetic component to the development of arterial calcification. For instance, the heritability of the presence of coronary artery calcification has been estimated to be up to 50% (Post et al., 2007). Key genes known to be involved in the regulation of the complex process of ectopic soft tissue mineralization are those acting as calcification inhibitors such as matrix γcarboxyglutamic acid protein (MGP), osteocalcin (BGP), osteoprotegerin (Opg), and fetuin (Abedin et al., 2004; Doherty et al., 2004; Giachelli, 2004; Guzman, 2007; Weissen-Plenz et al., 2008). Among those, MGP, a vitamin K-dependent protein, is widely accepted as playing a pivotal role in preventing local mineralization of the vascular wall (Luo et al., 1997; Schurgers et al., 2005; Proudfoot and Shanahan, 2006). It has been shown that the anticalcifying activity of MGP depends upon the γ-carboxylation of specific glutamic acid (Glu) residues in MGP. This vitamin K-dependent reaction yields γ-carboxyglutamic acid (Gla) residues, which are then able to bind calcium (Murshed et al., 2004). The human MGP gene is located on chromosome 12p (Cancela et al., 1990). Among the large number of identified MGP single nucleotide polymorphisms (SNPs) eight are under the most intensive investigation: two SNPs are located in exons, and six in the upstream region of the MGP gene. In vitro studies suggest that SNPs in MGP are associated with altered promoter activity (Herrmann et al., 2000; Farzaneh-Far et al., 2001; Kobayashi et al., 2004). In addition, there is some evidence that MGP SNPs are associated with arterial calcification (Herrmann et al., 2000; Brancaccio et al., 2005; Crosier et al., 2009), although these results are not consistent (Kobayashi et al., 2004; Taylor et al., 2005).

There are a large number of studies in which the association of varies gene polymorphisms with IS has been investigated (Kubo, 2008; Debette and Seshadri, 2009; Matarin et al., 2009; Wang et al., 2009; Low et al., 2011), but only in one of them the MGP SNPs were a subject of interest (del RioEspinola et al., 2010). The purpose of the present study was to investigate the association of three MGP SNPs (T138C, G-7A, Thr83Ala) with IS in the Ukrainian population. Materials and methods Study groups The study recruited 170 IS patients (57,6% men and 42,4% women) 40 to 85 years of age (mean age [± SE] 64,7±0,7) admitted to Sumy Clinical Hospital No.5. A final diagnosis of IS was established on the basis of clinical, computed tomography and magnetic resonance imaging examinations. Each case of IS was assessed according to TOAST criteria (Adams et al., 1993). The patients with IS of cardioembolic origin and undetermined etiology were excluded from the study group. The control group consisted of 124 clinically healthy individuals with the absence of cardio- and cerebrovascular pathologies, as confirmed by medical history, ECG, and measurement of arterial pressure and biochemical data. The study had been previously approved by the Ethic Committee of the Medical Institute of Sumy State University. Appropriate informed consent was obtained from all patients and control subjects. The participants were unrelated Ukrainian people from the northeastern region of Ukraine. Blood sampling for genotyping was performed under sterile conditions into 2.7 ml tubes (SMonovette [Sarstedt, Germany]) containing EDTA potassium salt as an anticoagulant, samples were frozen and stored at -20ºC. Genotyping of SNPs DNA for genotyping was extracted from the venous blood using commercially available kits (Isogene Lab Ltd, Russia) according to the manufacturer’s protocol. To identify MGP SNPs the polymerase chain reaction (PCR) with subsequent restriction fragment length polymorphism (RFLP) analysis was performed as previously described (Garbuzova et al., 2012). Briefly, specific regions of the MGP gene were amplified using pairs of specific primers.

MGP polymorphisms in ischemic stroke 21

For T-138C polymorphism (rs1800802) they were (F) 5`AAGCATACGАТGGCCAAAACTTCTGCA-3` and (R) 5`GAACTAGCAТТGGAACTTTTCCCAACC-3`; for G-7A polymorphism (rs1800801): (F) 5`CTAGTTCAGTGCCAACCCTTCCCCACC-3` and (R) 5`TAGCAGCAGTAGGGAGAGAGGCTCCCA-3`; for Thr83Ala polymorphism (rs4236): (F) 5`TCAATAGGGAAGCCTGTGATG-3` and (R) 5`AGGGGGATACAAAATCAGGTG -3`. PCR products were digested using restriction enzymes: BseNI (for T-138C), NcoI (for G-7A), and Eco477 (for Thr83Ala). The restriction fragments were separated by electrophoresis and analysed on an ethidium bromide-stained 2.5% agarose gel visualized using ultraviolet transillumination. Statistical analysis Using the Pearson χ2 test, allelic frequencies in healthy controls and IS patients were found to be in Hardy-Weinberg equilibrium. Statistical analysis was performed to assess the independent main and

joint effects of all analyzed SNPs. To detect the strongest main effect of three MGP SNPs the logistic regression method was applied by using SPSS 17.0. A comparison of variables between the IS subgroups was performed using ANOVA. Differences were considered statistically significant with a P-value < 0.05.

Results Genotypes of three studied MGP polymorphisms are summarized in Table 1. As shown, major allele homozygous and heterozygous, and minor allele homozygous T-138C polymorphisms of the MGP promoter were detected in 61.2%, 31.2% and 7.6% of the IS group, respectively (control group: 59.7, 35.5% and 4.8%). Analysis of the G-7A promoter polymorphism yielded respective figures of 35.9%, 48.8% and 15.3% (control group: 43.5%, 50% and 6.5%). The distribution of genotypes when analyzing Thr83Ala polymorphism (exon 4) was 39.4%, 48.8% and 11.8% in IS group (control group: 34.7%, 53.2% and 12.1).

Table 1. Genotypes of MGP polymorphisms in patients with ischemic stroke (IS) and control subjects. Data presented as n (%). A – major allele; a – minor allele

Genotype AA

Promoter T-138C Control group IS group (n=124) (n=170) 74 (59.7) 104 (61.2)

Aa

44 (35.5)

53 (31.2)

aa

6 (4.8)

13 (7.6)

Promoter G-7A Control group IS group (n=124) (n=170) 54 (43.5) 61 (35.9) 62 (50.0)

83 (48.8)

Exon 4 Thr83Ala Control group IS group (n=124) (n=170) 43 (34.7) 67 (39.4) 66 (53.2)

83 (48.8)

8 (6.5) 26 (15.3) 15 (12.1) 20 (11.8) 7.109). Respective analysis for male and female subjects is presented in Table 4. Women who were The differences in the distribution of allelic minor A-allele homozygotes had a risk of IS more variants between the control and IS groups were then 7 times higher compared with female carriers close to the level of statistical significance only for of G/G genotype. the G-7A promoter polymorphism (P=0,051). In Some clinical characteristics of IS patients with women, but not in men, the differences between Gvarious MGP genotypes are presented in Table 5. 7A genotypes frequency in IS and controls were There were no differences in the studied parameters significant as shown in Table 2. between major allele homozygotes, heterozygotes, Using logistic regression analysis (Table 3), it and minor allele homozygotes for all three was estimated that A/A genotype (G-7A polymorphisms (with the exception of sex polymorphism) was significantly (P=0.016) distribution for G-7A polymorphism). associated with IS (OR=2.943; 95% CI, 1.218 –

22 Alexander V. ATAMAN et al.

Table 2. Genotypes of G-7A MGP promoter polymorphism in female and male patients with ischemic stroke (IS) and control subjects. Data presented as n (%). Women

Genotype

Men

Control

IS

Control

IS

G/G

18 (40.0)

21 (29.2)

36 (45.6)

40 (40.8)

G/A

25 (55.6)

34 (47.2)

37 (46.8)

49 (50.0)

A/A

2 (4.4)

17 (23.6)

6 (7.6)

9 (9.2)

Total

45

72

79

98

P-value

0.022

0.798

Table 3. Results of logistic regression analysis of association between MGP polymorphisms and ischemic stroke.Homozygotes by major allele were considered as a reference group. SE – standard error, OR – odds ratio, CI – confidential interval

T/C

Coefficient of regression -0.186

0.258

Wald statistic 0.521

Pvalue 0.470

C/C

0.382

0.526

0.527

G/A

0.193

0.253

A/A

1.079

Thr/Ala Ala/Ala

SNP

Genotype

Promoter T-138C Promoter G-7A Exon 4 Thr83Ala

0.830

%95 CI Lower 0.500

%95 CI Upper 1.377

0.468

1.465

0.522

4.107

0.584

0.445

1.213

0.739

1.991

0.450

5.752

0.016

2.943

1.218

7.109

-0.235

0.259

0.824

0.364

0.790

0.476

1.313

-0.265

0.402

0.435 0.510 0.767 0.349 1.687 atherosclerosis (myocardial infarction in particularly) are contradictory. Farzaneh et al. (2001) did not find any relationship between the G-7A polymorphism and serum MGP level in healthy persons (Netherlands), but did detect the significant association of T-138C polymorphism with above-mentioned parameter. The highest level of serum MGP was revealed in the C/C homozygotes and the lowest one – in T/T homozygotes. In contrast to the above study, Crosier et al. (2009) found no association of the T-138C polymorphism with serum MGP concentration, but they showed a significant relationship between the other two polymorphisms (G-7A, Tht83Ala) and serum MGP levels in the healthy men and women (USA). In minor allele homozygotes, the serum MGP concentration was the lowest, in major allele homozygotes the highest, in heterozygotes the intermediate values were registered. In the same study, it was shown that all three MGP SNPs (T-138C, G-7A, Thr83Ala) are related to the coronary artery calcification (CAC) in men, but not in women (Crosier et al., 2009).

SE

Discussion Arterial calcification is an abnormal process that can greatly increase morbidity and mortality (Lehto et al., 1996). MGP is considered one of the most relevant physiological inhibitors of soft tissue mineralization known today. In mice, targeted deletion of the MGP gene causes extensive calcification of the elastic lamellae of the abdominal aorta (Luo et al., 1997). Extensive vascular calcification is also induced when γcarboxylation of MGP is inhibited using the vitamin K-antagonist, warfarin (Price et al., 1998). In the present study, we explored association between genetic variation in the MGP gene and the risk of IS development. Analysing MGP SNPs, we found the G-7A promoter polymorphism to be associated with IS in Ukrainian population. We did not revealed statistically significant relation between the other two studied polymorphisms (T138C, Thr83Ala) and IS. Published data on the MGP SNPs association with MGP serum concentration and artery calcification, and the consequences of

OR

MGP polymorphisms in ischemic stroke 23

Table 4. Logistic regression analysis of association between G-7A MGP promoter polymorphism and ischemic stroke in male and female subjects. OR – odds ratio, CI – confidential interval Sex Allele OR (CI) P-value Women

Men

A/A vs. G/G

7.286 (1.479-35.895)

0.015

G/A vs. G/G

1.166 (0.516-2.632)

0.712

A/A vs. G/G

1.350 (0.437-4.166)

0.602

G/A vs. G/G

1.192 (0.641-2.217)

0.579

Table 5. Clinical characteristics of ischemic stroke patients with respect to genotypes. Data are mean ± SE. A/A A/a a/a P T-138C polymorphism n

104

53

13

Age, years

65.4±0.92

63.0±1.39

64.7±2.13

0.288

Gender, M/F

58/46

35/18

5/8

0.162*

2

BMI (M), kg/m

27.8±0.56

27.4±0.64

28.1±1.22

0.862

2

BMI (F), kg/m

29.1±0.74

29.4±0.93

29.0±1.17

0.789

Systolic BP, mmHg

168±2.9

165±3.6

168±9.8

0.780

96±1.7 94±1.8 5.9±0.15 5.9±0.2 G-7A polymorphism

93±3.8 6.1±0.53

0.628 0.916

Diastolic BP, mmHg Fasting glucose, mmol/L n

61

83

26

Age, years

63.0±1.15

65.3±1.04

66.8±2.09

0.164

Gender, M/F

40/21

49/34

9/17

0.026*

2

27.2±0.45

27.9±0.68

28.6±1.53

0.536

2

BMI (F), kg/m

28.3±0.8

29.9±0.86

28.2±1.13

0.315

Systolic BP, mmHg

167±3.7

167±3.3

167±5.2

0.996

Diastolic BP, mmHg 97±2.0 94±1.8 Fasting glucose, mmol/L 5.8±0.18 6.0±0.17 Thr83Ala polymorphism

97±2.4 6.2±0.35

0.593 0.481

BMI (M), kg/m

n

67

83

20

Age, years

65.1±1.2

64.4±1.0

64.7±2.1

0.912

Gender, M/F

44/23

45/38

9/11

0.176*

2

BMI (M), kg/m

27.6±0.47

27.6±0.67

28.3±1.9

0.891

2

BMI (F), kg/m

29.4±0.84

28.6±0.78

29.9±1.53

0.668

Systolic BP, mmHg

163±3.7

171±3.0

163±6.6

0.252

Diastolic BP, mmHg Fasting glucose, mmol/L

95±1.8 5.9±0.2

96±1.7 6.0±0.17

95±4.4 5.9±0.3

0.812 0.859

24 Alexander V. ATAMAN et al.

In some studies, MGP polymorphisms were also shown to be associated with arterial calcification and myocardial infarction (MI) (Herrmann et al., 2000; Brancaccio et al., 2005), while in others (Kobayashi et al., 2004; Taylor et al., 2005) no association between MGP SNPs and cardiovascular events was found. Moreover, in the studies in which such associations were reported, the relationship between the type of MGP polymorphism and arterial calcification was different. For example, in the AXA study, the minor alleles -7A and 83Ala were associated with increased femoral artery calcification (Herrmann et al., 2000), while in the above-mentioned study by Crosier et al. (2009), the same alleles were linked to a decreased level of CAC. It should be noted that the majority of studies cited here was devoted to the relation of MGP to CAC and MI. As to cerebral artery atherosclerosis and its severe events such as IS, the role of arterial calcification in this disease and the association of MGP with cerebrovascular pathology were the subject of investigation and discussion only in a few publications. In particular, Bos et al. (2011) established a close relationship between calcification in the various vessel beds outside the brain and imaging markers of vascular brain disease. Calcification in each vessel bed was shown to be associated with the presence of cerebral infarcts and with larger volume of white matter lesions (WMLs). The most prominent associations were found between the intracranial carotid calcification and WML volume and between the extracranial carotid calcification and infarcts. Acar et al. (2012) studied a relationship of serum MGP levels to the development of intracerebral hemorrhages (ICH) and found that in patients with ICH, serum MGP concentration was much lower than in control group. Moreover, in the non-survivors, the serum MGP levels were statistically significantly lower in comparison to the survivors. According to the authors, measurement of this parameter may be of value to estimate mortality. At present, there are only a few publications concerning relation of the MGP SNPs to cerebrovascular disease. Analysing 236 polymorphisms, del Rio-Espinola et al. (2010) showed that only two of them (G-7A of MGP and T-1C of CD40) were related to the brain vessel reocclusion after fibrinolysis in IS patients. In our study, it was shown that the G-7A polymorphism of MGP was associated with IS. In our previous

investigation (Harbusova et al., 2011), this variant of the MGP promoter polymorphism was found to be in association with the acute coronary syndrome (ACS). Minor allele homozygotes (A/A) had significantly higher risk of ACS as well as IS. This could means that there are some common mechanisms of pathogenesis in both ACS and IS concerning to MGP. Those may be atherosclerosis, arterial calcification, and thrombosis. The relation of MGP to blood vessels calcification is well known (see above). With respect to coagulation and thrombi formation, it can be suggested that MGP is somehow connected with these processes (Krueger et al., 2009). Such an assumption is based on the fact that MGP belongs to vitamin K-dependent proteins, a large number of which are procoagulants (prothrombin, factor V, etc) and can influence blood clotting and thrombi formation in the coronary and cerebral arteries. In some papers (Wallin et al., 2008), an antagonistic relationship between calcification and coagulation is discussed. Therefore, MGP can be considered as a connecting link between these two processes. Certainly, this assumption requires experimental as well as clinical proofs, and research in this direction should be continued.

References Abedin M, Tintut Y, Demer LL. Vascular calcification. Mechanisms and clinical ramifications. Arterioscler Thromb Vasc Biol. 24: 1161-1170, 2004. Acar A, Cevik MU, Arıkanoglu A, Evliyaoglu O, Basarılı MK, Uzar E, Ekici F, Yucel Y, Tasdemir N. Serum levels of calcification inhibitors in patients with intracerebral hemorrhage. Int J Neurosci. 122: 227232, 2012. Adams HP, Bendixen BH, Kappelle LJ, Biller J, Love BB, Gordon DL, Marsh EE. Classification of subtype of acute ischemic stroke. Definitions for use in a multicenter clinical trial. TOAST. Trial of Org 10172 in Acute Stroke Treatment. Stroke. 24: 35-41, 1993. Bos D, Ikram MA, Elias-Smale SE, Krestin GP, Hofman A, Witteman JC, van der Lugt A, Vernooij MW. Calcification in major vessel beds relates to vascular brain disease. Arterioscler Thromb Vasc Biol. 31: 2331-2337, 2011.

MGP polymorphisms in ischemic stroke 25

Brancaccio D, Biondi ML, Gallieni M, Turri O, Galassi A, Cecchini F, Russo D, Andreucci V, Cozzolino M. Matrix Gla protein gene polymorphisms: clinical correlates and cardiovascular mortality in chronic kidney disease patients. Am J Nephrol. 25: 548-552, 2005. Cancela L, Hsiehg CL, Francket U, Price PA. Molecular structure, chromosome assignment, and promoter organization of the human matrix Gla protein gene. J Biol Chem. 265: 1504015048, 1990. Crosier MD, Booth SL, Peter I, Dawson-Hughes B, Price PA, O'Donnell CJ, Hoffmann U, Wiilliamson MK, Ordovas JM. Matrix Gla protein polymorphisms are associated with coronary artery calcification. J Nutr Sci Vitaminol. 55: 59-65, 2009. Debette S, Sechardi S. Genetics of atherothrombotic and lacunare stroke. Circ Cardiovasc Gen. 2: 191-198, 2009. del Río-Espínola A, Fernández-Cadenas I, Rubiera M, Quintana M, Domingues-Montanari S, Mendióroz M, Fernández-Morales J, Giralt D, Molina CA, Alvarez-Sabín J, Montaner J. CD40-1C>T polymorphism (rs1883832) is associated with brain vessel reocclusion after fibrinolysis in ischemic stroke. Pharmacogenomics. 11: 763-772, 2010. Doherty TM, Fitzpatrick LA, Inoue D, Qiao JH, Fishbein MC, Detrano RC, Shah PK, Rajavashisth TB. Molecular, endocrine, and genetic mechanisms of arterial calcification. Endocrine Rev. 25: 629-672, 2004. Farzaneh-Far A, Davies JD, Braam LA, Spronk HM, Proudfoot D, Chan SW, O'Shaughnessy KM, Weissberg PL, Vermeer C, Shanaham CM. A polymorphism of the human matrix γcarboxyglutamic acid protein promoter alters binding of an activating protein-1 complex and is associated with altered transcription and serum levels. J Biol Chem. 276: 32466-32473, 2001. Garbuzova VYu, Gurianova VL, Story DA, Dosenko VE, Parkhomenko AN, Ataman AV Association of matrix Gla protein gene allelic polymorphisms (G-7→A, T-138→C and Thr83→Ala) with acute coronary syndrome in the Ukrainian population. Exp Clin Cardiol. 17: 30-33, 2012.

Giachelli CM. Vascular calcification mechanisms. J Am Soc Nephrol. 15: 2959-2964, 2004. Guzman RJ. Clinical, cellular, and molecular aspects of arterial calcification. J Vasc Surg. 45 (Suppl A): A57-A63, 2007. Harbusova VYu, Hurianova VL, Parkhomenko OM, Dosenko VE, Ataman OV. The frequency of allelic polymorphism of matrix Gla-protein gene in acute coronary syndrome patients. Fiziol Zh. 57: 16-24, 2011. Herrmann SM, Whatling C, Brand E, Nikaud V, Gariepy J, Simon A, Evans A, Ruidavets LB, Arveiler D, Luc G, Tiret L, Henney A, Cambien F. Polymorphisms of the human matrix Gla protein (MGP) gene, vascular calcification, and myocardial infarction. Arterioscler Thromb Vasc Biol. 20: 2386-2393, 2000. Kobayashi N, Kitazawa R, Maeda S, Schurgers LJ, Kitazawa S. T-138C polymorphism of matrix Gla protein promoter alters its expression but is not directly associated with atherosclerotic vascular calcification. Kobe J Med Sci. 50: 6981, 2004. Krueger T, Westenfeld R, Schurgers LJ, Brandenburg VM. Coagulation meets calcification: The vitamin K system. Int J Artif Organs. 32: 67-74, 2009. Kubo M. Genetic risk factors of ischemic stroke identified by a genome-wide association study. Brain Nerve. 60: 1339-1346, 2008. Lehto S, Niskanen L, Suhonen M, Rönnemaa T, Laasko M. Medial artery calcification. A neglected harbinger of cardiovascular complications in non-insulin-dependent diabetes mellitus. Arterioscler Thromb Vasc Biol. 16: 978-988, 1996. Low HQ, Chen CP, Kasiman K, Thalamuthu A, Ng SS, Foo JN, Chang HM, Wong MC, Tai ES, Liu J. A comprehensive association analysis of homocysteine metabolic pathway genes in Singaporean Chinese with ischemic stroke. PLoS One. 6: e24757, 2011. Luo G, Ducy P, McKee MD, Pinero GJ, Loyer E, Behringer RR, Karsenty G. Spontaneous calcification of arteries and cartilage in mice lacking matrix Gla protein. Nature. 386: 78-81, 1997.

26 Alexander V. ATAMAN et al.

Matarin M, Brown WM, Dena H, Britton A, De Vrieze FW, Brott TG, Brown RD, Worrall BB, Case LD, Chanock SJ, Metter EJ, Ferruci L, Gamble D, Hardy JA, Rich SS, Singleton A, Meschia JF. Candidate gene polymorphisms for ischemic stroke. Stroke. 40: 3436-3442, 2009. Murshed M, Schinke T, McKee MD, Karsenty G. Extra cellular matrix mineralization is regulated locally: different roles of two Gla-containing proteins. J Cell Biol. 165: 625-630, 2004. Post W, Bielak LF, Ryan KA, Cheng YC, Shen H, Rumberger JA, Sheedy PF, Shuldiner AR, Peyser PA, Mitchell BD. Determinants of coronary artery and aortic calcification in the Old Order Amish. Circulation. 115: 717-724, 2007. Price PA, Faus SA, Williamson MK. Warfarin causes rapid calcification of the elastic lamellae in rat arteries and heart valves. Arterioscler Thromb Vasc Biol. 18: 1400-1407, 1998. Proudfoot D, Shanahan CM. Molecular mechanisms mediating vascular calcification: role of matrix Gla protein. Nephrology (Carlton). 11: 455-461, 2006. Schurgers LJ, Teunissen KJF, Knapen MHJ, Kwaijtaal M, van Diest R, Appels A, Reutelingsperger CP, Cleutjens JPM, Vermeer

C. Novel conformation-specific antibodies against matrix gamma-carboxyglutamic acid (Gla) protein. Arterioscler Thromb Vasc Biol. 25: 1629-1633, 2005. Taylor BC, Schreiner PJ, Doherty TM, Fornage M, Carr JJ, Sidney S. Matrix Gla protein and osteopontin genetic associations with coronary artery calcification and bone density: the CARDIA study. Hum Genet. 116: 525-528, 2005. Wallin R, Schurgers L, Wajih N. Effects of the blood coagulation vitamin K as an inhibitor of arterial calcification. Thromb Res. 122: 411417, 2008. Wang X, Cheng S, Brophy VH, Erlich HA, Mannhalter C, Berger K, Lalouschek W, Browner WS, Shi Y, Ringelstein EB, Kessler C, Luedemann J, Lindpaintner K, Liu L, Ridker PM, Zee RY, Cook NR. A meta-analysis of candidate gene polymorphisms and ischemic stroke in 6 study populations: association of lymphotoxin-alpha in nonhypertensive patients. Stroke. 40: 683-695, 2009. Weissen-Plenz G, Nitschke Y, Rutsch F. Mechanisms of arterial calcification: spotlight on the inhibitors. Adv Clin Chem. 46: 263-293, 2008.

Journal of Cell and Molecular Biology 10(1):27-32, 2012 Haliç University, Printed in Turkey. http://jcmb.halic.edu.tr

Research Article 27



Survivin geni -625G/C polimorfizminin Küçük Hücreli Dışı Akciğer Kanseri ile ilişkisinin araştırılması Engin AYNACI1, Ender COŞKUNPINAR2, Ayşe EREN2, Onur KUM1, Yasemin MÜŞTERİ OLTULU2, Nergiz AKKAYA2, Akif TURNA3, İlhan YAYLIM2, Pınar YILDIZ*1. 1

Yedikule Chest Diseases and Thoracic Surgery Training Hospital, Istanbul, Turkey Department of Molecular Medicine, Institute of Experimental Medicine, Istanbul University, Istanbul, Turkey 3 Cerrahpaşa Medicine Faculty, Department of Thoracic Surgery, Istanbul University, Istanbul, Turkey (*author for correspondence; [email protected]) 2

Received: 14 February 2012; Accepted: 21 May 2012

Özet Akciğer kanseri tüm kanser türleri arasında görülme sıklığı olarak ikinci sırada, kanser sebepli ölümler arasında ise ilk sırada gelmektedir. Survivin geni 17q25 kromozomal bölgesinde lokalizedir ve 142 amino asitten oluşan bir protein kodlar. Survivin (BIRC5) apoptozu düzenleyen önemli bir protein ailesi olan apoptoz proteinlerinin inhibitörü (IAPs) olarak ilk bulunan inhibitörlerden biridir ve özellikle kanser hücrelerinde ifadesi gerçekleşir. Survivin genindeki polimorfizm survivin üretimi ve aktivitesine etki edebilir, bu nedenle akciğer kanserine hassasiyet sağlar. Survivin genindeki aşırı ifadenin çok çeşitli maligniteleri içeren kanser türlerinde hastalık gelişimi, nüksü ve prognozu ile ilişkili olduğu bilinmektedir. Bu çalışmada bir Türk popülasyonunda survivin geni promotör bölgesi üzerinde bulunan -625G/C gen polimorfizmi ile küçük hücreli dışı akciğer kanseri arasında, hastalığın gelişimi ile ilgili olası ilişkilerin araştırılması amaçlandı. Çalışmaya 146 hasta, 98 kontrol olgu dahil edildi. Yöntem olarak PCR-RFLP tekniği kullanıldı. Sonuç olarak survivin -625G/C genotip dağılımları incelendiğinde hasta ve kontrol grupları arasında istatistiksel olarak anlamlı fark olmadığı tespit edilmiştir. Anahtar kelimeler: Küçük hücreli dışı akciğer kanseri, survivin, gen polimorfizmi, PCR-RFLP, biyobelirteç.

Investigation of the association of survivin gene -625G/C polymorphism in non-small cell lung cancer Abstract Lung cancer is the second most common cancer type diagnosed and first in cancer related deaths among all cancers worldwide. The survivin gene is located on human chromosome 17q25, encoding a protein consisting of 142 amino acids. Survivin is one of the first reported inhibitors of apoptosis proteins, which is an important family of proteins that regulate apoptosis. Survivin gene polymorphism may affect the survivin production and activity, thus providing sensitivity for the development of lung cancer. The overexpression of survivin gene was found to be associated with disease development, recurrence and prognosis in various malignancies, including cancers. In this study the demonstration of the prognosis related associations between the -625G/C gene polymorphism located on the survivin promoter region and non small cell lung cancer in a Turkish population was aimed. 146 patients and 98 control subjects included to the study. PCRRFLP technique was used as the method. According to survivin -625G/C genotype distribution analysis, no statistically significant difference between patients and controls were found. Keywords: Non small cell lung cancer, survivin, gene polymorphism, PCR-RFLP, biomarker.

28 Engin AYNACI et al.

Giriş Akciğer kanseri tüm dünyada kansere bağlı ölümlerin önde gelen sebebi olarak bilinmektedir. Bununla birlikte özellikle Amerika’da kansere bağlı ölüm oranları arasında akciğer kanseri sıklığı gitgide azalmakta, fakat Çin gibi sigara tüketiminin özellikle son 20 yılda arttığı bazı ülkelerde akciğer kanseri sebepli ölüm oranının arttığı gözlenmektedir. Amerika’da 2008 yılında 215.020 yeni vaka belirlenirken, 161.840 kişinin bu hastalık sebebiyle öldüğü, kayıtlarda yer almaktadır. Akciğer kanserinin küçük hücreli (KHAK) ve küçük hücreli dışı (KHDAK) olmak üzere iki tipi vardır. Son 60 yıldır akciğer kanserinde hastalık gelişiminin kalıtsal bir temele oturduğu belirtilmektedir. (Julian et al., 2008). Programlanmış hücre ölümü olarak bilinen apoptoz, önemli bir hücre büyüme kontrol mekanizmasıdır (Yuan-Hung et al., 2009; Thompson, 1995). Survivin (BIRC5 olarak da bilinir) apoptozu düzenleyen önemli bir protein ailesi olan apoptoz proteinlerinin inhibitörü (IAP) olarak ilk bulunan inhibitörlerden biridir ve özellikle kanser hücrelerinde ifadesi gerçekleşir (Reed,1997). Survivin terminal tetikleyici kaspaz-3 ve kaspaz-9 aktivitesini inhibe ederek her iki apoptoz yolunun baskılanmasını bloke eder (Nicholson and Thornberry, 1997). Ayrıca survivin apoptotik uyarıcıyla indüklenen interlökin (IL-3), Fas (CD95), Bax, tümör nekroz faktörü α, kaspazlar ve antikanser ilaçlarınının etkisini yok eder (Chan et al., 2009; Yun-Hong et al., 2004). Mitozda düzenleyici rol oynadığı da çeşitli yayınlarda (Chan et al., 2009) bildirilmiş olan survivin geni 17q25 kromozomal bölgesinde lokalizedir ve 142 amino asitten oluşan bir protein kodlar (Chiou et al., 2003; Deveraux et al., 1997; Uren et al., 1998). Survivin ayrıca mikrotübül dinamiklerinin düzenlenmesinde de önemli rol oynar (Li et al., 1998; Li and Altieri, 1999; Altieri, 2006; Giodini et al., 2002). Survivin geni promotör bölgesindeki polimorfizmler genin transkripsiyonuna etki ettiği için gen aktivitesini ve ekspresyonunu değiştirerek akciğer kanserine yatkınlık sağlayabilir (Jin Sung et al., 2008). Survivin hücre döngüsünde G2/M fazında bol miktarda eksprese olur ve G1 fazında hızlı regülasyon sergiler (Li et al., 1998). Bu durum transkripsiyonel basamakta kontrol edilir ve hücre döngüsüne bağlı elementler (CDE) ve hücre döngüsü homoloji bölgeleri (CHR) survivin promotörünün proksimal bölgesinde lokalize olur (Masayuki et al., 2000; Li and Altieri, 1999).

Survivin geni ekspresyon düzeylerindeki artışın bazı hastalıklar için prognostik belirteç olabileceği düşünülmektedir (Chun-Hua et al., 2010). Survivin genellikle embriyonik dokularda ifade olur ve görülen homozigot mutasyonların erken embriyonik dönemde ölümle sonuçlanması bu gen ailesinin hücre gelişimi, farklılaşması ve homeostaz sürecinde çok önemli rol oynadığını göstermektedir (Chan et al., 2009). Çeşitli tek-nükleotit polimorfizmleri survivin gen bölgesi promotöründe tespit edilmiştir. Bunlardan en çok bilineni ve literatürde en fazla çalışması yapılmış olan CDE/CHR reseptör bağlayıcı bölgede lokalize olan -31G/C gen polimorfizmidir. Survivin geninin promotör bölgesindeki bu mutasyon sonucu hücre döngüsünden bağımsız olarak genin transkripsiyonu ve bunun sonucunda da aşırı ifadesi görülür (Xu et al., 2004). Bu çalışmada KHDAK hastalarında PCR-RFLP tekniği kullanılarak survivin geni promotör bölgesindekiki -625G/C (rs8073069) polimorfizminin bir Türk popülasyonunda KHDAK hastalığına yatkınlığı araştırılmıştır. Akciğer kanseri ile ilgili olarak eldeki verilerin doğru olarak kullanılması ve buna ek olarak hastalık oluşumu ya da gelişiminin anlaşılmasına yönelik belirteçlerin ve genetik mekanizmaların anlaşılması özellikle hastalığın erken tanısı ve tedavi sürecinde bu hastalar için anlamlı olacaktır.

Materyal ve metod Örneklerin tanımı Çalışma ile ilgili olarak öncelikle İstanbul Üniversitesi İstanbul Tıp Fakültesi Etik Değerlendirme Komisyonu’ndan 09.06.2010 tarih ve 2010/228-36 dosya numarası ile etik kurul onayı alındı. Çalışmaya Yedikule Göğüs Hastalıkları ve Göğüs Cerrahisi Eğitim ve Araştırma Hastanesi 3. Klinikte ve İstanbul Üniversitesi Cerrahpaşa Tıp Fakültesi Göğüs Cerrahisi Kliniğinde tanı konulan toplam 146 KHDAK olgusu ile yine aynı kliniklerde tetkik edilen ve kronik hastalık veya malignite bulgusu saptanmayan 98 sağlıklı kontrol olgusu alındı. Çalışmaya girmeyi kabul edenlere gönüllü olur imzaladıktan sonra 1 adet EDTA’lı tüpe 10 ml kanları alınarak soğuk zincirle laboratuvara ulaştırıldı.

DNA izolasyonu Gönüllülerden alınan kanlardan High Pure PCR Template Preparation Kit (Roche, Manheim) protokolüne uygun olarak genomik DNA

KHDAK’de survivin polimorfizmi 29

izolasyonu yapıldı ve daha sonra Nano Drop Spektrofotometre kullanılarak, elde edilen DNA’ların konsantrasyonları ölçüldü. DNA’lar konsantrasyonları 100 ng/μl olacak şekilde seyreltildi.

PCR Survivin geni promotör bölgesindeki -625G/C polimorfizmine özgü primerler (Tablo 1) dizayn edildi. PCR, total hacim 25 µl ve 10X PCR Buffer (MBI Fermentas), 1mM MgCl2, 0.2 mM dNTP,

0.375 mM her bir primer, 100 ng genomik DNA ve 1 U Taq DNA polimeraz (MBI Fermentas) olacak şekilde dizayn edildi. Amplifikasyon şartları, 95°C’de 10 dakika ilk denatürasyondan sonra 95°C’de 45 saniye, 72°C’de 60 saniye 5 döngü, takiben 94°C’de 45 saniye, 60°C’de 45 saniye ve 72°C’de 60 saniye 30 döngü, uzama aşamasında da 10 dakika 72°C’de olacak şekilde düzenlendi. Optimum amplifikasyon şartları sağlanarak PCR ürünleri %2 lik agaroz jel elektroforezinde yürütüldü.

Tablo 1. Survivin geni promotör -625 G/C bölgesi primerleri (FP: İleri Primer, RP: Geri Primer) Polimorfizm

Primer Dizileri

PCR Ürün boyu

BstUI kesimi sonrası ürün boyları CC: 125

-625C/G (rs8073069)

FP: 5’-TGTTCATTTGTCCTTCATGCGC-3’ RP: 5’-CCAGCCTAGGCAACAAGAGCAA-3’

125 bç

CG: 125/104/21 GG: 104/21

Restriksiyon analizi

Sonuçlar

Amplifiye olan PCR ürünleri BstUI restriksiyon enzimi ile uygun tamponu içeren karışım hazırlandıktan sonra 37°C de 4 saat inkübe edildi. Kesim ürünleri % 3’lük agaroz jelde 100 volt elektrik altında, 20 dakika yürütüldükten sonra UV altında incelenerek genotipler tespit edildi.

Çalışmaya 146 KHDAK hastası ve 98 kontrol olgu dahil edildi. Hastaları yaş ortalaması 60,41 yaş (±9,71), kontrol olgularının yaş ortalaması 55,23 yaş (±8,8.) di. Çalışmaya dahil edilen hastalardan 132’si erkek (%90,4), 14’ü kadın (%9,6), kontrol grubu olgularının ise 56’sı erkek (%57,1), 42’si kadındı (%42,9). Hasta ve kontrol grubuna ait genotip ve alel dağılımları Tablo 2’de verilmiştir. PCR sonucu elde edilen bant boyu 125 baz çifti büyüklüğünde (Şekil 1); BstUI restriksiyon enzimi kesimi sonucu elde edilen bant büyüklükleri ise 125, 104 ve 21 baz çifti olarak görüntülendi (Şekil 2).

İstatistiksel

analiz

AJJC tarafından yayınlanmış olan evrelendirme sistemine göre tümör evrelendirmesi yapılan hasta olguları ve kontrollere ait veriler SPSS 15.0 programına yüklendi ve kategorik verilerin karşılaştırılmasında ki-kare testi ve parametrik ttesti kullanıldı.

Şekil 1. Survivin geni -625 G/C bölgesi PCR görüntüsü 

Şekil

2. BstUI kesimi %3’lük jel elektroforezi görüntüsü. M: 50 bp DNA markörü

Ϯϵ

30 Engin AYNACI et al.

 Tablo 2. Hasta ve kontrol grubuna ait genotip ve alel dağılımları Genotipler ve Alel dağılımları

Kontrol

Hasta

Grubu

Grubu

N=98

N=146

P değeri

χ2

0.484

1.45

-625G/C

N

%

N

%

GG

56

57.1

72

49.3

GC

32

32.7

57

39.1

CC

10

10.2

17

11.6

144 52

56.06 43.94

201 58.59 0.27 1.21 91 41.41 düzeyindeki artışın -31G/C polimorfizmi ile ilişkili olduğunu ve bu artışın hem mRNA düzeyinde hem de protein düzeyinde meydana geldiğini bildirmişlerdir. Klinik perspektiften bakıldığında kişisel paternlerle klinik özelliklerin öngörülmesinde hastaların genetik parmak izinde survivin geni ifadesi düzeylerinde ve genetik varyantlarda oluşan değişikliklerin olası tedaviye yanıtta erken bir belirteç olabileceğini söylemek mümkündür. Örneğin plevral efüzyondaki yüksek survivin düzeylerinin kötü prognoz göstergesi olduğu Lan ve ark. 2010 yılındaki yayınında gösterilmiştir. Yang ve ark 2009 yılında özefagus kanserli hastalarda yaptıkları bir çalışmada C alleline sahip olmanın hastalık riskini 1.4 kat arttırdığını söylemektedirler. Özefagus kanseri hastalarında survivin -625G/C promotor polimorfizminin p53 düzeyine bağlı olan survivin yüksek ifadesi olasılığını artırdığı düşünülmektedir. Sonuç olarak bir Türk popülasyonu üzerinde yapmış olduğumuz bu çalışmada survivin geni -625 G/C bölgesi (rs8073069) polimorfizminin küçük hücreli dışı akciğer kanseri hastalığına yatkınlık sağladığına dair herhangi bir bulgu elde edilemedi. Ancak olgu sayısının artırılması ve polimorfik bölgenin özellikle transkripsiyonun aktivitesine etki eden promotör bölgesinde olmasından dolayı yapılabilecek ekspresyon çalışmaları ile özellikle tanı öncesi ve sonrası gen anlatım ifadesine bağlı değişikliklerin öngörülmesine yardımcı olabilecek daha anlamlı sonuçlara ulaşılabileceği kanaatindeyiz.

Aleller G C

Tartışma Kanser oluşumunda apoptoz mekanizmasındaki bozukluklar önemli rol oynamaktadır. Apoptoz, farklı inhibe ve aktive edici ajanlar tarafından kontrol altında tutulan önemli bir olaydır. Kanserde apoptozun çeşitli anti-apoptotik proteinler tarafından inhibisyonu söz konusudur. Survivin, hücre döngüsünün düzenlenmesinde temel rol oynayan başlıca anti-apoptotik faktördür. Ayrıca survivinin Bcl-2 ve diğer IAPlerin aksine farklılaşmasını tamamlamış normal dokularda anlatımı olmayan ancak çeşitli kanser tiplerinde ifade edilen bir protein olduğu bilinmektedir. Bu durum survivin genindeki anormal ifadenin transkripsiyonel regülasyon bozukluğuna sebep olduğunun açık bir göstergesidir. Apoptozu inhibe eden diğer proteinlerde de bulunan BIR (“Baculovirus IAP Repeat”) bölgesi ile kaspazlara bağlanarak etkisini göstermektedir. Dai ve ark. 2010 yılında yaptıkları çalışmada survivin geni promotor bölgesindeki polimorfizmlerin KHDAK’de gen modifikasyonuna neden olabileceğini ileri sürmüşlerdir. Jang ve ark. tarafından yapılan çalışmada -31 G alelinin -31 C aleline göre önemli derecede düşük transkripsiyonel aktiveye sahip olduğu ve bu durumun -31G/C polimorfizminden etkilenerek ortaya çıktığı ve buna bağlı olarak -31G/C polimorfizminin akciğer kanserine yatkınlıkta önemli bir rolü olduğu belirtilmektedir. (Jang et al., 2008). Xu ve ark. kanser hücre hatları ile yapmış oldukları bir çalışmada survivin gen ifadesi .

KHDAK’de survivin polimorfizmi 31

Kaynaklar Altieri DC. Survivin apoptosis: an interloper between cell death and proliferation in cancer. Lab Invest. 79: 1327-1333, 1999. Altieri DC. The case for survivin as a regulator of microtubule dynamics and cell-death decisions. Curr Opin Cell Biol. 18: 609-615, 2006. Chan H. Han, Qingyi Wei, Karen K. Lu, Zhensheng Liu, Gordon B. Mills, Li-E Wang. Polymorphisms in the survivin promoter are associated with age of onset of ovarian cancer. Int J Clin Exp Med. 2: 289-299, 2009. Chiou SK, Jones MK, Tarnawski AS. Survivin an anti-apoptosis protein: its biological roles and implications for cancer and beyond. Med Sci Monit. 9:I25-I29, 2003. Chun-Hua Dai, Jian Li, Shun- Bing Shi, Li- Chao Yu, Li-Ping Ge, Ping Chen, Survivin and Smac Gene Expressions but not Livin Are Predictors of Prognosis in Non-small Cell Lung Cancer Patients Treated with Adjuvant Chemotherapy Following Surgery. Jpn J Clin Oncol. 2-9, 2010. Dai J, Jin G, Dong J, Chen Y, Xu L, Hu Z, Shen H. Prognostic significance of survivin polymorphisms on non-small cell lung cancer survival. J Thorac Oncol. 2010 Nov;5(11):1748-54. PubMed PMID: 20881643. Deveraux QL, Takahashi R, Salvesen GS and Reed JC. X-linked IAP is a direct inhibitor of celldeath proteases. Nature. 388: 300-304, 1997. Giodini A, Kallio MJ, Wall NR, Gorbsky GJ, Tognin S, Marchisio PC, Symons M and Altieri DC. Regulation of microtubule stability and mitotic progression by survivin. Cancer Res. 62: 2462-2467, 2002. Jang JS, Kim KM, Kang KH, Choi JE, Lee WK, Kim CH, Kang YM, Kam S, Kim IS, Jun JE, Jung TH, Park JY. Polymorphisms in the survivin gene and the risk of lung cancer. Lung Cancer. Apr;60(1):31-9, 2008. Jin Sung Jang,,Kyung Mee Kim, Kyung Hee Kang, Jin Eun Choi, Won Kee Lee, Chang Ho Kim, Young Mo Kang, Sin Kam, In-San Kim, Jae Eun Jun, Tae Hoon Jung, Jae Young Park. Polimorphizms in the survivin gene and the risk of lung cancer. Lung Cancer. 60:31-39, 2008.

Julian R. Molina, Ping Yang, Stephen D. Cassivi, Steven E. Schild,, Alex A. Adjei, Non–Small Cell Lung Cancer: Epidemiology, Risk Factors, Treatment, and Survivorship. Mayo Clin Proc.83(5): 584–594.,2008. Lan CC, Wu YK, Lee CH, Huang YC, Huang CY, Tsai YH, Huang SF, Tsao TC. Increased survivin mRNA in malignant pleural effusion is significantly correlated with survival. Jpn J Clin Oncol. Mar;40(3):234-40, 2010. Li F, Ambrosini G, Chu EY, Plescia J, Tognin S, Marchisio PC and Altieri DC. Control of apopto-sis and mitotic spindle checkpoint by survivin. Nature. 396: 580-584, 1998. Li F.,Altieri DC. The cancer antiapoptosis mouse survivin gene: characterization of locus and transcriptional requirements of basal and cell cycle-dependent expression. Cancer Res.59: 3143-3151, 1999. Masayuki Otaki, Masahiko Hatano, Koichi Kobayashi, Takeshi Ogasawara, Takayuki Kuriyama, Takeshi Tokuhisa Cell cyledependent regulation of TIAP/m-survivin expression. Biochim Biophys Acta. 1493:188194, 2000. Nicholson DW,Thornberry NA. Caspase:killer proteases. Trends Biochem Sci. 22:299-306, 1997. Reed JC. X-linked IAP is a direct inhibitor of celldeath proteases. Nature. 388: 300-304, 1997. Thompson CB. Apoptosis is the pathogenesis and treatment of disease. Science. 5267:1456-1462, 1991. Uren AG, Coulson EJ and Vaux DL. Conserva-tion of baculovirus inhibitor of apoptosis repeat proteins (BIRPs) in viruses, nematodes, vertebrates and yeasts. Trends Biochem Sci. 23: 159162, 1998. Xu Y, Fang F, Ludewig G, Jones G, Jones D. A mutation found in promoter region of the human survivin gene is correlated to overexpression of survivin in cancer cells. DNA Cell Biol. 23:419-429, 2004. Yang X, Xiong G, Chen X, Xu X, Wang K, Fu Y, Yang K, Bai Y. Polymorphisms of survivin promoter are associated with risk of esophageal squamous cell arcinoma. J Cancer Res Clin Oncol. Oct;135(10):1341-9, 2009.

32 Engin AYNACI et al.

Yang X, Xiong G, Chen X, Xu X, Wang K, Fu Y, Yang K, Bai Y. Survivin expression in esophageal cancer: correlation with p53 mutations and promoter polymorphism. Dis Esophagus. 2009;22(3):223-30. Yuan-Hung Wang, Hung-Yi Chiou, Chang-Te Lin, Hsiao-Yen Hsieh, Chia-Chang Wu, Cheng-Da Hsu, Cheng-Huang Shen. Association Between

Survivin Gene Promoter -31C/G Polymorphism and Urothelial Carcinoma Risk in Taiwanese Population. Urology. 73 (3):670-674, 2009. Yun-Hong Li, Chen Wang, Kui Meng, Long-Bang Chen, Xiao-Jun Zhou, İnfluence of survivin and caspase-3 on cell apoptosis and prognosis in gastric carcinoma. World J Gastroenterol. 10(13):1984-1988, 2004͘

Journal of Cell and Molecular Biology 10(1):33-40, 2012 Haliç University, Printed in Turkey. http://jcmb.halic.edu.tr

Research Article 33

Effects of prenatal and neonatal exposure to lead on white blood cells in Swiss mice Ragini SHARMA*, Khushbu PANWAR, Sheetal MOGRA Environmental and Developmental Toxicology Research Lab, Department of Zoology, M. L. S. University, Udaipur- 313001 Rajasthan, India (* author for correspondence; [email protected]) Received: 27 August 2011; Accepted: 25 May 2012

Abstract Lead exposure is one of the major environmental issues for children and women of child bearing age. It crosses the placental barrier and its greater intestinal absorption in fetus results in developmental defects. Lead, as one of the environmental pollutants, can threat the lives of animals and human beings in many ways; especially during developing stages. The present study was carried out to study the alterations in different types of white blood cells (WBC) due to chronic lead acetate toxicity in neonates, which passes from adult pregnant female during gestation and lactation. Lead acetate was administered orally at 8, 16, 32 mg /kg/BW to pregnant Swiss mice from 10th day of gestation to 21th day of lactation. Hematopathological and numerical alterations in the WBCs were examined in the neonates after birth at postnatal days 1, 7, 14 and 21. Blood smears examined illustrate that lead induces disturbances in the development of different types of WBCs during postnatal development and lead to an abrupt neutrophilic degeneration, immature cells, abnormal neutrophils, reactive and plasmacytoid lymphocytes. The results of the present study emphasize that prenatal lead exposure is extremely dangerous to developing fetus. Keywords: Lead acetate, Swiss albino mice, prenatal, neonatal, white blood cells.

Swiss farelerde prenatal ve yenidoğan kurşun maruziyetinin beyaz kan hücreleri üzerine etkileri Özet Kurşun maruziyeti çocuklar ve çocuk doğurma çağındaki kadınlar için majör çevresel konulardan birisidir. Plasental bariyeri geçer ve fetusta barsaklardan emilimi, gelişimsel defektlerle sonuçlanır. Çevresel kirliliklerden biri olan kurşun, birçok yönden özellikle gelişim çağı boyunca insan ve hayvan hayatını tehdit etmektedir. Bu çalışma, yetişkin hamile dişilerden gebelik ve laktasyon süresince yenidoğanlara geçen kurşun asetatın yarattığı kronik toksisite sebebiyle lökositlerin farklı tiplerindeki değişimleri incelemek için yapılmıştır. Kurşun asetat, hamile Swiss farelere gebeliğin 10. gününden laktasyonun 21. gününe kadar ağız yoluyla 8, 16, 32 mg /kg//BW şeklinde uygulanmıştır. Yenidoğanlarda doğumdan sonraki 1, 7, 14 ve 21. günlerde beyaz kan hücrelerindeki hematopatolojik ve sayısal değişiklikler incelenmiştir. Kurşunun doğum sonrası gelişim sırasında lökositlerin farklı tiplerinin gelişimindeki bozuklukları indüklediğini ve ani nötrofilik dejenerasyona, olgunlaşmamış hücreler, anormal nötrofillere, reaktif ve plazmasitoid lenfositlere neden olduğunu göstermek için kan yaymaları incelenmiştir. Bu çalışmanın sonuçları prenatal kurşun maruziyetinin gelişen fetus için son derece tehlikeli olduğunu vurgulamaktadır. Anahtar kelimeler: Kurşun asetat, Swiss albino fare, prenatal, yenidoğan, lökosit.

34Ragini SHARMA et al.

Introduction Lead has been recognized as a biological toxicant and different doses have been used to study leadinduced alterations Prenatal exposure to lead produces toxic effects in the human fetus, including increased risk of preterm delivery, low birth weight, and impaired mental development; because during the period of early organogenesis the onset of greatest susceptibility to teratogenesis occurs (Falcon et al., 2003). This highly sensitive or critical period is the time during which a small dose of a teratogen produces high percentage of fetuses that exhibit malformations of the organ in question (Wilson, 1973; Desesso et al., 1996). Pregnancy and breastfeeding can cause a state of physiological stress that increases bone turnover of lead. Lead stored in the bone moves into the blood, increasing the mother’s blood lead level and passing to the fetus, affecting fetal development. Lead is tightly bound to red blood cells, enhancing transfer from maternal circulation through the placenta to the fetus. Fetus is more sensitive to lead because the fetal blood-brain barrier is more permeable. The toxic effects of lead on blood indices are well known. Lead potentially induces oxidative stress and evidence is accumulating to support the role of oxidative stress in the pathophysiology of lead toxicity. Lead is capable of inducing oxidative damage to brain, heart, kidneys, and reproductive organs. The mechanisms for lead-induced oxidative stress include the effects of lead on membranes, DNA, and antioxidant defense systems of cells (Ahamed and Siddiqui, 2007). Lead interferes with a variety of body processes and is toxic to the body systems including cardiovascular, reproductive, hematopoietic, gastrointestinal and nervous systems (Kosnett, 2006), renal functions (Patocka and Cerny, 2003) and release of glutamate (Xu et al., 2006). It affects the hematological system even at concentrations below 10μg/dl (ATSDR, 2005). Many reports are available regarding lead toxicity and its deleterious effects in various species of animals and there has been lot of work carried out on pharmacokinetics and genotoxicity but very few researchers tried to correlate haematopathological alterations of lead acetate in different white blood cells at different dose levels in laboratory animals, especially in mice. Therefore the current study was performed to clarify the lead induced hematological changes, especially those related to white blood cells, during

gestational and lactational exposure to lead in Swiss mice.

Materials and methods Sexually mature random bred Swiss mice with the age of 5-6 weeks, weighing 25-30 gm was used for this study. During the entire experimental period, the animals were fed on a standard diet and water ad libitum. Mice were kept in the ratio of 1:4 males and females, respectively, and females showing vaginal plugs were separated in the control and lead treated group. Lead acetate solution was prepared by dissolving 4gm lead acetate in 12ml distilled water. Pregnant Swiss mice were given lead acetate at a concentration of 8, 16 and 32 mg (266.66, 533.33, and 1066.66 mg/kg/bodyweight) from 10th day of gestation to 21st day of lactation. Blood samples were obtained from the tail of pups from each litter at days 1,7,14 and 21 day after birth. The tip of the tail was cleaned with spirit before being cut with a sharp blade and was not squeezed to avoid dilution of blood by tissue fluid. Blood cells were studied in smears prepared by spreading a drop of blood thinly over a clean and sterilized microscopic slide with the help of another slide moved over the first at the angle of 45ᵒ after discarding first drop of blood. These blood films were air-dried and fixed in absolute methanol for 15 minutes by dipping the film briefly in a Coplin jar containing absolute methanol. After fixation the slides were removed and air-dried. Afterward blood smears were stained with freshly made Giemsa stain diluted with water buffered to pH 6.8 or 7.0 (1:9) stain and buffer respectively. The slides were washed by briefly dipping the slide in and out of a Coplin jar of buffered water and air dried again for taking observations. The erythrocytes appear pink to purple, whereas leukocytes turned blue black in color. All the experimental work was approved by the Institutional Animal Ethics Committee. No./CS/Res/07/759. Group 1- Control (distilled water only). Group 2- Exposure to 8 mg lead acetate (266.66 mg/kg BW) from 10th day of gestation up to 21st day of lactation. Group 3- Exposure to 16 mg lead acetate (533.33 mg/kg BW) from 10th day of gestation up to 21st day of lactation. Group 4- Exposure to 32 mg lead acetate (1066.66 mg/kg BW) from 10th day of gestation up to 21st day of lactation. The statistical analysis was performed following t-test for the comparison of data between different experimental groups. The data was calculated using

Prenatal and neonatal exposure to lead 35 

prism software to calculate the p values. 100 WBC from each group were counted at different weeks, different cell types were identified and % ratio was calculated. For numerical observation highest dose level was selected.

Results In the control group all the WBCs showed normal appearance. The neutrophils in control group were examined by a very characteristic nucleus with condensed chromatin. It is divided into 3-5 lobes (Fig.1A, 1, 2, 5 and 6) at birth which was observed with an increase by 5 to 6 lobes (Fig.1B, 1 and 3) at the termination of lactation, connected by thin strands of chromatin. Lymphocytes were round or ovoid at the time of birth (Fig. 1A, 3 and 4) but further on they were found notched or slightly indented (Fig. 1B, 5 and 6). The chromatin was generally diffusely dense. Ordinarily, nucleoli were not visible. A perinuclear clear zone surrounding the nucleus was visible after first week of lactation in some cells. The cytoplasm stained light blue and ranges from sparse to moderately abundant in amount. The monocyte in control group were round with smooth margins, the nucleus was oval, indented and slightly folded (Fig.1B, 4). The chromatin material was moderately clumped and relatively less dense compared to that of neutrophils or lymphocytes. There was no visible nucleolus with abundant cytoplasm. The administration of lead acetate altered the appearance and caused structural changes. The following hematological observations were taken during postnatal period from birth till the termination of the lactation period upon exposure of different doses of lead acetate: 1. At the time of birth (PND1) Abnormal neutrophils: In lead treated groups the neutrophils showed structural abnormalities in their nucleus including improper segmentation and lesser condensation of nucleus. At a lower dose the chromatin material was condensed, all the lobes were interconnected with each other and form a nodule like structure at one side (Fig.1C, 1). Degeneration: In lead treated group most of the neutrophils appeared in degenerating state in which the chromatin material was very less condensed, fused and there was no sign of clear lobulization and segmentation (Fig. 1C, 2). Immature cells: In lead treated group the number of immature cells was increased (Fig. 1C, 3).

Ring shaped: In lead treated groups, some neutrophils showed abnormal ring like appearance and diffuse chromatin material, with unclear cytoplasm. In 32 mg lead treated group vacuolization in chromatin material was also observed ((Fig. 1C, 4).). Lymphocyte: Reactive (Fig. 1C: 5 and 6) and cleaved (Fig. C, 5) types of lymphocytes were observed in lead treated groups. Monocytes: At postnatal day 1 we cannot identify any structural change in shape and size of monocyte as observed on postnatal day 21. 2. During first and second week of postnatal period (PND7&14) The following observations were taken at first to second week after birth: Degenerated neutrophils: In lead treated group overall numbers of neutrophils were increased particularly with degenerated neutrophils, however, their number was less than postnatal day 1. In 16 mg lead group on postnatal day 7 the nuclear material of neutrophil was less condensed and nucleus was divided into 2-3 unequal lobes. The cytoplasm of neutrophil appeared colorless. At the dose of 32mg lead at postnatal day 7, this severity of degeneration was very much increased so that the lobes were broken into many small fragments. No sign of lobulization and appropriate segmentation of neutrophils were found (Fig. 1D, 1). Ring shaped neutrophils: In contrast to postnatal day 1, ring like nucleus was not observed in lead treated group at postnatal day 7. Different types of neutrophils: At higher dose 32 mg lead treated groups apoptotic or necrotic neutrophils were more prominent. These neutrophils were characterized by 3-4 separate and equal lobes with less condensed chromatin and diffuse cytoplasmic region (Fig. 1D, 2). Immature cells: Review of the lead treated smear revealed that most of the leukocytes were myelocytes, bands, myeloblast and other immature and unidentified white blood cells with left shift in leucocytes. A left shift is an increase in the number of band neutrophils and other immature cell of the granulocytic lineage in the peripheral blood (Fig. 1D, 3). Various lymphocytes: Administration of lead acetate produced great variation in lymphocyte structurally as well as numerically. Various types of lymphocytes such as plasmacytoid, reactive, oval, irregular, binucleated and cleaved lymphocytes were identified, whereas only reactive and cleaved

36Ragini SHARMA et al.

lymphocytes were seen in postnatal day 1, exclusively in lead treated group. Lead treated group with 16 mg lead acetate produced large lymphocytes and most of the lymphocytes were having irregular; clumpy and smudgy chromatin material with very dense nucleus (Fig. 1D, 4). The cytoplasm appeared completely absent as the nucleus reached its largest size and covered all the cytoplasmic area. Overall, number of lymphocytes decreased in most of the groups. At higher dose (32 mg lead) the plasmacytoid lymphocytes (eccentric nucleus and intensely blue / basophilic cytoplasm) (Fig. 1D, 6) and reactive lymphocytes were observed. Reactive lymphocyte was characterized by relatively very large, irregular but flattened nucleus with fine chromatin and agranular light blue stained cytoplasm (Fig. 1D, 5). 3. At the end of lactation period (PND21) Abnormal nuclear segmentation: It includes abnormal segmentation of nucleus, in which the nuclear lobes were connected with each other. It gave abnormal appearance of nucleus and chromatin condensation in most of the neutrophils (Fig. 1E, 1). Degeneration: In lower doses of lead diffuse appearance of chromatin material was observed in neutrophils and the lobes were fused with each other as any segmentation was not observed, whereas in higher lead treated group the neutrophils presented fragmented chromatin material and very less condensation of nucleus which finally leads to cell lysis (Fig. 1E, 2). The nuclear arrangement was distorted, as appear that all the lobes were intermingled with each other and in some cases

form a nodule at one side known as sessile nodule appeared like hypersegmentation (Fig. 1E, 3). Immature cells: In lead treated group the numbers of immature cells were increased. A left shift i.e. presence of immature neutrophils, bands, metamyelocytes, myelocytes and other unidentified immature cells were observed (Fig. 1F, 1 to 6). Lymphocytes: As the dose level increased the number of lymphocytes decreased. In higher dose lead treated group the lymphocyte appeared large in size with higher volume of cytoplasm. The shape of the nucleus also vary from round to elliptical in structure, termed as reactive lymphocyte (Fig. 1E, 4). Some lymphocytes transformed into plasmocytoid lymphocyte in which the lymphocyte contains basophilic cytoplasm and eccentric nucleus (Fig. 1E, 5). Monocytes: In lead treated groups the shape and structure of the monocyte were modified and the shape of the nucleus was also altered from the normal reniform (kidney shaped) nucleus. The indentation of the nucleus became larger and deeper from periphery to center. At higher dose level intensity of the indentation was increased so that the normal range of nucleo-cytoplasmic ratio was disturbed (Fig. 1E, 6). Numerical changes in different types of WBC and percent variations in different types are incorporated in Table 1 and 2 respectively. In present investigation, after evaluating all the cell types, we can conclude that lead acetate at PND 1 and 14 caused significant increase in number of neutrophils and decrease in lymphocytes, while there was no significant difference in the number of neutrophils and lymphocytes at PND 7 and 21.

Table 1. Various types of WBCs at different postnatal days treated with lead acetate. Groups Neutrophils Lymphocytes Monocytes Control at PND 1 59.25±1.70 38.5±1.29 2.25±1.70 Lead acetate at PND1 66.00±2.16** 28.25±2.06** 5.75±1.70* Control at PND 7 57.75±2.21 41.75±2.21 0.75±0.95 Lead acetate at PND7 61.75±3.5 37.5±2.88 0.75±0.95 Control at PND 14 55.25±3.40 44.5±3.10 0.25±0.5 Lead acetate at PND14 61.25±1.70** 37.75±1.70** 1.00±0.81 Control at PND 21 47.75±2.5 47.75±2.21 4.5±2.38 Lead acetate at PND21 52.25±4.57 44.00±2.26 3.75±2.75 Values were expressed as means ± S.D.; 4 animals /group;*=p