Intestine-specific expression of the b-glucanase in mice Li-Zeng Guan1,3,4, Qian-Yun Xi1,4, Yu-Ping Sun2, Jing-Lan Wang1, Jun-Yun Zhou1, Gang Shu1, Qing-Yan Jiang1, and Yong-Liang Zhang1,5

Can. J. Anim. Sci. Downloaded from www.nrcresearchpress.com by MICHIGAN STATE UNIV on 01/17/17 For personal use only.

1

College of Animal Science, SCAU-Alltech Research Joint Alliance, South China Agricultural University, 483 Wushan Road, Guangzhou 510642, China; 2Institute of Animal Science, Guangdong Academy of Agriculture Science, Guangzhou 510640, China; and 3Agriculture College, Yanbian University, Yanji133000, China. Received 18 August 2013, accepted 1 November 2013. Published on the web 13 November 2013.

Guan, L.-Z., Xi, Q.-Y., Sun, Y.-P., Wang, J.-L., Zhou, J.-Y., Shu, G., Jiang, Q.-Y. and Zhang, Y.-L. 2014. Intestinespecific expression of the b-glucanase in mice. Can. J. Anim. Sci. 94: 287293. The b-glucanase gene (GLU, from Paenibacillus polymyxa CP7) was cloned into a specific expression plasmid (MUC2-GLU-LV). Transgenic mice were prepared by microinjection. Polymerase chain reaction and Southern blot analysis of genomic DNA extracted from the tail tissue of transgenic mice showed that the mice carried the b-glucanase gene. Northern blot analysis indicated that b-glucanase was specifically expressed in the intestine of the transgenic mice. The b-glucanase activity in the intestinal contents was found to be 1.2390.32 U mL 1. The crude protein, crude fat digestibility of transgenic mice were increased by 9.32 and 5.09% (PB0.05), respectively, compared with that of the non-transgenic mice, while moisture in feces was reduced by 12.16% (PB0.05). These results suggest that the expression of b-glucanase in the intestine of animals offers a promising biological approach to reduce the anti-nutritional effect of b-glucans in feed. Key words: b-glucanase, intestine, transgenic mice Guan, L.-Z., Xi, Q.-Y., Sun, Y.-P., Wang, J.-L., Zhou, J.-Y., Shu, G., Jiang, Q.-Y. et Zhang, Y.-L. 2014. L’expression spe´cifique a` l’intestin de la b-glucanase chez les souris. Can. J. Anim. Sci. 94: 287293. Le ge`ne de la b-glucanase (GLU, de Paenibacillus polymyxa CP7) a e´te´ clone´ dans un plasmide d’expression spe´cifique (MUC2-GLU-LV). Des souris transge´niques ont e´te´ pre´pare´es par micro-injection. L’analyse par PCR et buvardage Southern de l’ADN ge´nomique extrait des tissus de la queue des souris transge´niques a montre´ que les souris portaient le ge`ne de la b-glucanase. L’analyse par buvardage Northern indique que la b-glucanase e´tait exprime´e spe´cifiquement dans l’intestin des souris transge´niques. L’activite´ de la b-glucanase dans le contenu intestinal e´tait de 1,2390,32 Uml 1. Les taux de prote´ines brutes et de digestibilite´ des matie`res grasses brutes e´taient augmente´s de 9,32 % et 5,09 % (PB0,05), respectivement, lorsque compare´s aux souris non transge´niques, tandis que le taux d’humidite´ dans les fe`ces e´tait re´duit de 12,16 % (p B0,05). Ces re´sultats sugge`rent que l’expression de la b-glucanase dans l’intestin des animaux offre une approche biologique prometteuse pour re´duire les effets anti-nutritionnels des b-glucans dans la nourriture. Mots cle´s: b-glucanase, intestin, souris transge´niques

b-glucans are polysaccharide components of the cell walls of the higher plant family and are particularly abundant in the endosperm cell walls of cereals such as barley, rye, sorghum, wheat, rice and oats. b-glucans cannot be digested by monogastric animals, which are unable to synthesize the enzymes necessary to digest these structural polysaccharides (Bacic and Stone 1981; Papageorgiou et al. 2005). Negative effects of b-glucans have been attributed to their capacity to increase viscosity. b-glucans can prevent nutrients from mixing with digestive enzymes and so reduce the absorption of nutrients (Burnett 1966; White et al. 1981). b-glucanase, a specific b-glucans hydrolyzing enzyme, can enhance the utilization of cereal feed nutriments in animals (Bedford et al. 1991; Almirall et al. 1995; Mathlouthi 4 5

These authors contributed equally to this work. Corresponding author (e-mail: [email protected]).

Can. J. Anim. Sci. (2014) 94: 287293 doi:10.4141/CJAS2013-125

et al. 2003). b-glucanase improves the nutritive value of cereals by breaking the polysaccharide components into smaller pieces, thereby reducing the gut viscosity (Smits and Annison 1996; Onderci et al. 2008). It is well accepted that the adverse effects of b-glucans could be largely overcome by supplementing exogenous b-glucanase (Campbell et al. 1983; Bedford 1995). Furthermore animal feeds are often subjected to heat treatments of 70908C, which results in loss of enzyme activity, unless the enzymes are thermostable. The transmission of pathogens via contaminated feed also means that processing conditions may become even more aggressive in the future. To function efficiently, enzyme additives must also work within an optimal pH range in the gut. However, enzymes will likely be digested in the stomach where low pHs (pH 23) are found (Bedford and Classen 1992; Walsh et al. 1993; Philip et al. 1995; Fontes Abbreviation: PCR, polymerase chain reaction 287

288 CANADIAN JOURNAL OF ANIMAL SCIENCE

Can. J. Anim. Sci. Downloaded from www.nrcresearchpress.com by MICHIGAN STATE UNIV on 01/17/17 For personal use only.

et al. 1999). Transgenic animal technology provides an alternative to enzymes supplementation in feed. Such an approach involves the creation of transgenic livestock in which the enzyme would be secreted into the intestinal tract (Fontes et al. 1999). In this study, we ligated the intestinal-specific promoter (MUC2) to the b-glucanase gene and this construction was used to generate transgenic mice expressing b-glucanase specifically in the intestinal tissue. MATERIALS AND METHODS MUC2-GLU-LV Plasmid Construction The mucin 2 (MUC2) promoter (a human intestinespecific promoter) was amplified using polymerase chain reaction (PCR) from the MUC2-T plasmid (Zhai et al. 2012). To amplify the MUC2 promoter, the following primers were used: forward primer 5?-CCCATC GATTCCTCCCAGCGTAACGTGAGC-3? and the reverse primer 5?- TGCTCTAGACTAGTGGCAGCCC ATGGTG-3?, which contains a ClaI (underlined) and an XbaI restriction sites (underlined), respectively. The MUC2 PCR product and the LV vector (Lentivirus, which is developed based on HIV1, a human immunodeficiency virus type I) containing the 716bp b-glucanase gene (GLU, from Paenibacillus polymyxa CP7, provided by our laboratory) were digested with ClaI and XbaI restriction enzymes. Digested fragments were electrophoresed on 1% agarose gel and gel-purified individually. These two fragments were then ligated using T4 ligase (TaKaRa, Tokyo, Japan) to generate the MUC2-GLU-LV plasmid (Fig. 1). The resultant plasmid was sequenced to confirm the right orientation of the MUC promoter and the GLU gene. Generation of Transgenic Mice Animals used in this experiment were cared for under guidelines of Committee of Animal Care of South China Agricultural University. The MUC2-GLU-LV plasmid was linearized by digestion with the ClaI restriction enzyme. Purification of the digested product was performed by electroelution of an agarose gel slice, followed by phenol/chloroform extraction, dialysis in Tris-EDTA buffer (10 mM NaCl, 10 mM Tris-Cl, 1 mM EDTA, pH 8.0) and ethanol precipitation. Finally, the linearized plasmid was resuspended in microinjection buffer [10 mM Tris-Cl (pH 7.4), 0.1 mM EDTA] at a concentration of 20 ng mL1, and stored at 208C. The injection of transgene DNA into the mouse zygotic pronuclei was carried out according to the procedure described by Hogan et al. (1986). Identification of Transgenic Mice Genomic DNA from the tail of transgenic mice was prepared using the Endo-Free Plasmid Giga Kit (OMEGA, GA) according to the manufacturer’s protocol and kept at 808C until used for PCR amplifications and Southern blot analyses. The PCR amplification of

gag

5'LTR RSV

1

RRE

ClaI MUC2 promoter

Amp

XbaI MUC2-GLU-LV

GLU

EF1 promoter

pUC ORI

SV40 ORI poly-A

GFP 3'LTR

WPRF

Fig. 1. The MUC2-GLU-LV plasmid map. The MUC2-GLULV plasmid is a vector which specifically express b-glucanase in the intestine. MUC2 promoter, the mucin 2 promoter (a human intestine-specific promoter); ClaI and XbaI, enzymes digest the MUC2 promoter; GLU, b-glucanase gene; LV, lentivector; EF1 promoter, elongation factor 1 promoter; GFP, green fluorescent protein; WPRF, Woodchuck hepatitis virus posttranscriptional regulatory element; 3?LTR and 5?LTR, 3? and 5? long terminal repeat required for viral transcription and packaging; poly-A, polyadenylation; SV40 ORI, simian virus 40 origin allows for episomal replication of plasmid in eukaryotic cells; pUC ORI, pUC plasmid origin allows for high-copy replication in E. coli; Amp, ampicillin resistant gene for selection of the plasmid in E. coli; RSV, Gag and RRE, packaging elements involved in packaging of viral transcripts.

b-glucanase gene (AY 772705) was performed using the forward 5?-TCTAGAATGAAGTTCGT TCTGC-3? and reverse 5?-GAATTCCTAAATGCTCGTATATT3?. The following components were added to 20 mL PCR reaction mixture: 2.0 mL 10buffer, 1.6 mL dNTP (2.5 mM), 1.6 mL MgCl2 (25 mM), 1 mL of each primer (10 mM), 1 mL DNA polymerase (1 U), 1 mL genomic DNA template and 10.8 mL H2O. The PCR conditions were as follows: 958C for 5 min, 35 cycles of 958C for 30 s, an annealing temperature of 568C for 40 s and 728C for 1 min, and 728C for 10 min. For Southern blot analysis, purified genomic DNA was digested with the restriction enzymes XbaI and EcoRI for 3 h at 378C, followed by ethanol precipitation. The pcDNA3.1(-)-GLU plasmid was used as a positive control and tail genomic DNA from wild-type mice served as a negative control. Then, 15 mg of DNA was electrophoresed in a 0.8% agarose gel and transferred to a 0.45 mm aperture nylon membrane (Roche, Basel, Switzerland). The membrane was hybridized with a digoxigenin-labelled DNA probe targeting the 716bp sequence of the b-glucanase gene. Hybridization and washing were performed according to the instructions of the DIG-High Prime DNA Labelling and Detection Starter Kit (Roche, Basel, Switzerland).

Can. J. Anim. Sci. Downloaded from www.nrcresearchpress.com by MICHIGAN STATE UNIV on 01/17/17 For personal use only.

GUAN ET AL. * EXPRESSION OF THE b-GLUCANASE IN MICE

RT-PCR Analysis of Transgenic Mice Total RNA was isolated from the heart, liver, spleen, lung, kidney and jejunum tissues of transgenic mice, and the jejunum tissue of wild-type mice (negative control) using Trizol (Invitrogen, CA) in accordance with the manufacturer’s instructions. The cDNA was synthesized from 2 mg of total RNA using the avian myeloblastosis virus reverse transcriptase along with random 18T primers (RNA PCR Kit Version 2.1, TaKaRa). For the b-glucanase gene, the following forward 5?-TCTA GAATGAAGTTCGTTCTGC-3? and reverse 5?-GAA TTCCTAAATGCTCGTATATT-3? primers were used. The b-actin gene (NM_007393.3) was also amplified as a reference gene using the forward 5?- TAAGGCCAAC CGTGAAAAGATGAC-3? and reverse 5?- ACCGCTC GTTGCCAATAGTGATG-3? primers. The PCR reaction mixture contained 2 mL of cDNA (1:10 dilution of a RT-reaction mix), 2 mL 10 Dream Taq polymerase buffer, 0.2 mL dNTP (10 mM), 0.4 mL of each primer (10 mM), 0.2 mL Dream Taq polymerase (5 U mL1), and H2O to make up the final volume to 20 mL. The PCR conditions were as follows: 958C for 5 min, 35 cycles of 958C for 30 s, an annealing temperature of 568C for 40 s and 728C for 1 min, and 728C for 10 min. Northern Blot Analysis of RNA Isolated from Transgenic Mice Total RNA was prepared using Trizol (Invitrogen, CA) and following the manufacturer’s instructions. Quantification of extracted RNA was performed using the Eppendorf BioPhotometer Plus (Eppendorf, Hamburg, Germany). A total of 30 mg of RNA was then mixed with an equal volume of gel loading buffer, heated for 5 min at 958C and chilled on ice. A gel containing 8 M urea was pre-run for about 30 min at 60 V using 1 TBE (Tris-Boric acid-EDTA) as running buffer. Samples were loaded on the gel and electrophoresed at 60 V until bromophenol blue (10 mg mL 1) reached approximately 3 cm away from the bottom of the gel. After electrophoresis, the RNA was transferred to a nylon membrane (Roche, Basel, Switzerland) by electroblotting for 1 h at 60 V in pre-chilled 1 TBE running buffer. The nylon membrane was washed in 0.1% diethyl dicarbonate (DEPC) buffer and finally the RNA was crosslinked to the membrane by irradiating with a 120 mJ burst for at least 10 min using an ultraviolet crosslinker (Stratagene, CA). Hybridization with a DNA probe labelled with digoxigenin-dUTP and targeting the b-glucanase mRNA was performed in accordance with the protocol of the DIG-High Prime DNA Labelling and Detection Starter Kit II (Roche, Basel, Switzerland). Collection of Intestinal Contents Five transgenic and five control mice were killed by cervical dislocation and their jejunum was removed from the peritoneal cavity. Intestinal contents were

289

collected in 1.5 mL Eppendorf tubes and 300 mL Tyrode buffer as immediately added to the samples, which were kept on ice throughout the procedure. The samples were kept at 808C until analyzed. Analysis of b-glucanase Activity in Intestinal Contents b-glucanase activity in intestinal contents was assayed using the reducing-sugar method with b-glucan as the substrate (Shen et al. 2003). The intestinal content samples were centrifuged at 12 000 rpm to remove intestinal debris before assay. The assay system consisted of 900 mL Tyrode buffer and 100 mL intestinal content samples The reaction was allowed to proceed for 30 min at 508C, and was then stopped by the addition of 2 mL L-dinitrosalicylate reagent and 10 min of boiling (Miller 1959). The absorbance of the reaction mixture was determined at 540 nm using a spectrophotometer (Model 680, Bio-Rad). one Unit (U) is the amount of enzyme which liberates 1 mmol of reducing sugars (glucose equivalent) from b-glucan per minute at 508C and pH 5.3 (Shen et al. 2003). Analysis of Crude Protein and Crude Fat Digestibility and Moisture in Feces Five transgenic and five control mice were kept in individual cages and fed a diet containing 4 g of Cr2O3 kg 1, a marker of digestibility, for 2 wk. 1.5-g fecal samples were collected once daily and were placed into sterile tubes and dried immediately at 458C. Crude protein was analyzed according to the Bensadoun and Weinstein method (Bensadoun and Weinstein 1976). The protein standard (bovine serum albumin) was treated in an identical manner. Crude protein digestibility (%) (protein content in feed-protein content in feces)/protein content in feed 100%. Crude fat in 1 g feces was extracted with petroleum ether in a Tecator Soxtec System HT (Tecator, Sweden) after 3 mol HCl L1 acid hydrolysis (Anonymous 1971). Crude fat digestibility (%) (fat content in feed-fat content in feces)/fat content in feed 100%. Moisture in feces was analyzed according to the conventional method. Moisture (%) (feces weight before drying  feces weight after drying)/ feces weight before drying 100%. Statistical Analysis The statistical calculations were made using one-way ANOVA (SPSS 17.0, Chicago, IL) for the crude protein and crude fat digestibility analyses and for moisture in feces. The data were expressed as means9standard deviation; P B0.05 was considered to be statistical significance. RESULTS Identification of Transgenic Mice The MUC2-GLU-LV resultant plasmid was successfully constructed in this study. The plasmid was linearized

290 CANADIAN JOURNAL OF ANIMAL SCIENCE

Can. J. Anim. Sci. Downloaded from www.nrcresearchpress.com by MICHIGAN STATE UNIV on 01/17/17 For personal use only.

using ClaI restriction enzyme digestion and then microinjected into mouse zygotic pronuclei. Nine mice (three males and six females) were found to be positive for the presence of the plasmid using PCR screening. A fragment of 716 bp, corresponding to the b-glucanase gene, was successfully amplified (Fig. 2A). Southern blot analysis of genomic DNA from transgenic mice further confirmed the presence of the foreign DNA in transgenic mice (Fig. 2B). RT-PCR and Northern Blot Analysis of b-glucanase Gene Expression Total RNA from the intestine, heart, liver, spleen, lung and kidney of transgenic mice and the intestine of normal mice was subjected to RT-PCR to confirm the presence of b-glucanase transcripts. The 716 bp bglucanase fragment was successfully detected in intestinal tissue of transgenic mice, whereas it was absent in the heart, liver, spleen, lung and kidney of the transgenic mice and in the intestinal tissue of non-transgenic controls (Fig. 3A). To further confirm the tissue specificity of the transgene expression, Northern blot analysis was performed on intestinal, heart, lung and liver tissues from one transgenic mice and on intestinal tissue of one wild type mouse. Results confirmed the presence of b-glucanase mRNA in the intestinal tissue of transgenic mice, whereas it was absent in the heart, lung and liver of the transgenic mice and the intestinal tissue of the wild type mouse (Fig. 3B). b-glucanase Activity in the Intestine Juice of Transgenic Mice Intestinal content samples were collected from 5 b-glucanase transgenic and five control mice (transgenic and non-transgenic mice were all from F0), and the

Fig. 2. Identification of transgenic mice using PCR and Southern blot analyses. (A) The observed PCR products corresponded to the expected 716 bp length of the b-glucanase transgene. Lane M, DL2000 Marker; lanes 19, transgenic mice; lane10, wild-type mouse; lane 11, negative control (H2O). (B) Southern blot analysis. Blots were hybridized with a random digoxigenin-labeled DNA probe. Lanes 19, transgenic mice showing the b-glucanase transgene; lane 10, wildtype mouse; lane 11, positive plasmid.

Fig. 3. Detection of b-glucanase gene expression using RTPCR and Northern blot analyses in different tissues. (A) RTPCR analysis of b-glucanase transcripts. The expected 716 bp long fragment, corresponding to the b-glucanase transgene, was detected. Lane 1, intestinal tissue from a transgenic mouse; lanes 26, heart, liver, spleen, lung and kidney tissues from a transgenic mouse, respectively; lane 7, intestinal tissue from a non-transgenic mouse. The b-actin gene was used as a reference gene. The results of the b-glucanase and b-actin gene expression are from two separate gels. (B) Northern blot analysis of b-glucanase transcripts and blotting procedures were performed as described in Materials and Methods. Blots were hybridized with a random digoxigenin-labelled DNA probe. Lane 1, intestinal tissue of a non-transgenic mouse; lanes 24, heart, lung and liver tissues of a transgenic mouse, respectively; lane 5 represents the intestinal tissue from a transgenic mouse.

b-glucanase activity in the transgenic mice was found to be about 1.2390.32 U mL 1, whereas there was no activity detected in the non-transgenic mice (data not shown). The effect of the expressed b-glucanase on the transgenic mice was investigated by analysing the crude protein and crude fat digestibility, along with the moisture content in feces. The crude protein digestibility of transgenic mice was increased by 9.32% compared with that found in the wild type mice (P 0.012, Fig. 4A). The crude fat digestibility of transgenic mice was increased by 5.09%, when compared with that of the wild type mice (P 0.021, Fig. 4B). Finally, the moisture in feces of transgenic mice were reduced by 12.16%, when compared with that of the wild type mice (P 0.026, Fig. 4C). DISCUSSION The b-glucans in cereals have a high water-binding capacity and form highly viscous solutions and gelatinous suspensions in aqueous media. As a result, b-glucans can increase intestinal viscosity, interfere with the digestion and absorption of nutrients and reduce animal performance (Ravindran et al. 2007). Therefore, cereal-based diets are often supplemented with endo-b-glucanase which, particularly in poultry, can lead to significant improvements in the nutritional and health status of animals. However, enzyme supplementation increases the cost of feed. The advent of

Can. J. Anim. Sci. Downloaded from www.nrcresearchpress.com by MICHIGAN STATE UNIV on 01/17/17 For personal use only.

GUAN ET AL. * EXPRESSION OF THE b-GLUCANASE IN MICE

Fig. 4. Analyses of the crude protein and crude fat digestibility and moisture in feces. (A) The crude protein (CP) digestibility observed in feces of transgenic mice was significantly increased by 9.32%, when compared with that of the non-transgenic mice (n 5, P B0.05). (B) The crude fat (CF) digestibility observed in feces of transgenic mice was significantly higher (5.09%), when compared with that of the non-transgenic mice (n 5, P B0.05). (C) The moisture in feces of transgenic mice was significantly reduced by 12.16%, when compared with that in non-transgenic mice (n 5, PB0.05). * indicates significant difference (PB0.05).

transgenic animal technology provides an opportunity to manipulate heterologous digestive enzymes such as b-glucanase. For example, Fontes et al. (1999) expressed the xylanase gene, which was under the control of the rat elastase I promoter, in the exocrine pancreas

291

of transgenic mice and the pancreatic xylanase was catalytically active. Guan et al. (2013) used the pig parotid secretory protein promoter to express b-glucanase in mice parotid glands. These studies demonstrated that monogastric animals can be manipulated successfully to express enzymes in different tissues. In the current study, we used the human MUC2 gene promoter to express the b-glucanase gene in the mice intestine. This is a first step towards the generation of larger monogastric animals with the endogenous capacity to hydrolyze b-glucans in the intestine, thereby providing a less expensive alternative to b-glucanase supplementation. MUC2 is the most prevalent member of the mucin family (Gum 1992; Gendler and Spicer 1995; Kim and Gum 1995), and MUC2 is expressed almost exclusively in goblet cells of the intestine (Chang et al. 1994; Tytgat et al. 1994; Aslam et al. 2001). Gum et al. (1999) characterized the promoter region of MUC2. Using this promoter, Gum and colleagues expressed the hGH gene in mice and reported that the hGH expression was abundant in the small intestine (Gum et al. 1999). The MUC2 promoter has been studied extensively in our laboratory, where it was used to express a-galactosidase in SW480, HeLa and 293T cells (unpublished data), and results demonstrated that the MUC2 promoter shows a good transcriptional activity and cell specificity. In the current study, b-glucanase was detected in the intestine of transgenic mice. RTPCR, Northern blot and b-glucanase activity analysis confirmed that b-glucanase is specifically expressed in the intestine of the transgenic mice and was catalytically active. These results showed that the MUC2 promoter was able to direct the expression of b-glucanase in the intestinal tissue of monogastric animals. In addition, since b-glucanase was synthesized and secreted in the intestine, it could bypass the acid denaturing conditions of the stomach, thus preserving enzyme activity (Fontes et al. 1999). In this study, the average activity of b-glucanase in different transgenic mice was found to be different individually (1.2390.32 U mL 1). In accordance with our results, Yin et al. (2006) found that the phytase activity in the saliva of two different transgenic mice differed substantially when using the parotid secretory protein promoter to express the phytase gene in the parotid gland (Yin et al. 2006). Guan et al. (2013) reported the same observation when expressing the b-glucanase gene in the salivary glands of mice. It is possible that the copy number of the transgene and the insertion position in the mice genome might affect the expression, a phenomenon commonly observed in transgenic mice that may affect the activation of the transgene (Alien et al. 1988; Al-Shawi et al. 1990). It was reported that the DNA sequences adjacent to the inserted gene could inhibit the gene function (Alien et al. 1988). So we hypothesized that the observed individual differences may be associated with the transgene insertion position. To further evaluate the effect of b-glucanase expression in mice, the crude

Can. J. Anim. Sci. Downloaded from www.nrcresearchpress.com by MICHIGAN STATE UNIV on 01/17/17 For personal use only.

292 CANADIAN JOURNAL OF ANIMAL SCIENCE

protein and crude fat digestibility and moisture in the feces were measured in transgenic and non-transgenic mice. Our results show an increase in crude protein and crude fat digestibility in transgenic mice expressing the b-glucanase gene, when compared with that of the non-transgenic mice. Moisture content in the feces of transgenic mice was significantly reduced when compared with that of the non-transgenic mice. All of these metabolism parameters are consistent with the presence of an active b-glucanase enzyme in the intestine These results show that b-glucanase expressed in transgenic mice could overcome the anti-nutritional effects of b-glucans in feed These findings provide support for the nutritional potential of b-glucanase expressed in the intestinal tract of transgenic mice and further suggest a possible application in farm animals. In conclusion, we are the first to use the MUC2 promoter to direct the b-glucanase gene expression in the intestinal tract of mice and to demonstrate the presence of an active b-glucanase enzyme, which has the capacity to reduce the anti-nutritional effects of b-glucan. Our findings are the first steps towards the production of b-glucanase transgenic pigs. ACKNOWLEDGMENTS

This work was supported by grants from the National Basic Research Program of China (973 Program, 2011C B944200), Chinese transgenic animal project (2011ZX0 8007-003 and 2011ZX08006-004). No additional external funding received for this study. This work was supported by grants from the Chinese transgenic animal project (2014ZX08009-048B), National Basic Research Program of China (973 Program, 2011CB944200, 2013CB127304) and the Natural Science Foundation of China program(31272529). No additional external funding was received for this study 2014ZX 08009-048B. Al-Shawi, R., Kinnaird, J., Burke, J. and Bishop, J. 1990. Expression of a foreign gene in a line of transgenic mice is modulated by a chromosomal position effect. Mol. Cell. Biol. 10: 11921198. Alien, N. D., Cran, D. G., Barton, S. C., Hettle, S., Reik, W. and Surani, M. A. 1988. Transgenes as probes for active chromosomal domains in mouse development. Nature 333: 852855. Almirall, M., Francesch, M., Perez-Vendrell, A. M., Brufau, J. and Esteve-Garcia, E. 1995. The differences in intestinal viscosity produced by barley and beta-glucanase alter digesta enzyme activities and ileal nutrient digestibilities more in broiler chicks than in cocks. J. Nutr. 125: 947955. Anonymous 1971. Determination of crude oils and fats. Official Journal of the European Communities 297: 995997. Aslam, F., Palumbo, L., Augenlicht, L. H. and Velcich, A. 2001. The Sp family of transcription factors in the regulation of the human and mouse MUC2 gene promoters. Cancer Res. 61: 570576. Bacic, A. and Stone, B. 1981. Chemistry and organization of aleurone cell wall components from wheat and barley. Funct. Plant Biol. 8: 475495.

Bedford, M. 1995. Mechanism of action and potential environmental benefits from the use of feed enzymes. Anim. Feed Sci. Technol. 53: 145155. Bedford, M., Classen, H. and Campbell, G. 1991. The effect of pelleting, salt, and pentosanase on the viscosity of intestinal contents and the performance of broilers fed rye. Poult. Sci. 70: 15711577. Bedford, M. R. and Classen, H. L. 1992. Reduction of intestinal viscosity through manipulation of dietary rye and pentosanase concentration is effected through changes in the carbohydrate composition of the intestinal aqueous phase and results in improved growth rate and food conversion efficiency of broiler chicks. J. Nutr. 122: 560569. Bensadoun, A. and Weinstein, D. 1976. Assay of proteins in the presence of interfering materials. Anal. Biochem. 70: 241250. Burnett, G. 1966. Studies of viscosity as the probable factor involved in the improvement of certain barleys for chickens by enzyme supplementation. Br. Poult. Sci. 7: 5575. Campbell, G., Campbell, L. and Classen, H. 1983. Utilisation of rye by chickens: effect of microbial status, diet gamma irradiation and sodium taurocholate supplementation. Br. Poult. Sci. 24: 191203. Chang, S., Dohrman, A., Basbaum, C., Ho, S., Tsuda, T., Toribara, N., Gum, J. and Kim, Y. 1994. Localization of mucin (MUC2 and MUC3) messenger RNA and peptide expression in human normal intestine and colon cancer. Gastroenterology 107: 28. Fontes, C. M., Ali, S., Gilbert, H. J., Hazlewood, G. P., Hirst, B. H. and Hall, J. 1999. Bacterial xylanase expression in mammalian cells and transgenic mice. J. Biotechnol. 72: 95101. Gendler, S. and Spicer, A. 1995. Epithelial mucin genes. Annu. Rev. Physiol. 57: 607634. Guan, L. Z., Sun, Y. P., Xi, Q. Y., Wang, J. L., Zhou, J. Y., Shu, G., Jiang, Q. Y. and Zhang, Y. L. 2013. b-Glucanase specific expression in the parotid gland of transgenic mice. Transgen. Res. 18. Gum, J. R. 1992. Mucin genes and the proteins they encode: Structure, diversity, and regulation. Am. J. Respir. Cell Molec. Biol. 7: 557. Gum, J. R., Hicks, J. W., Gillespie, A. M., Carlson, E. J., Ko¨mu¨ves, L., Karnik, S., Hong, J. C., Epstein, C. J. and Kim, Y. S. 1999. Goblet cell-specific expression mediated by theMUC2 mucin gene promoter in the intestine of transgenic mice. Am. J. Physiol. Gastrointest. Liver Physiol. 276: 666676. Hogan, B., Costantini, F. and Lacy, E. 1986. Manipulating the mouse embryo: a laboratory manual. Cold spring harbor laboratory Cold Spring Harbor, NY. Kim, Y. S. and Gum, J. R. 1995. Diversity of mucin genes, structure, function, and expression. Gastroenterology 109: 999. Mathlouthi, N., Juin, H. and Larbier, M. 2003. Effect of xylanase and b-glucanase supplementation of wheat-or wheatand barley-based diets on the performance of male turkeys. Br. Poult. Sci. 44: 291298. Miller, G. L. 1959. Use of dinitrosalicylic acid reagent for determination of reducing sugar. Anal. Chem. 31: 426428. Onderci, M., Sahin, N., Cikim, G., Aydin, A., Ozercan, I., Ozkose, E., Ekinci, S., Hayirli, A. and Sahin, K. 2008. b-Glucanase-producing bacterial culture improves performance and nutrient utilization and alters gut morphology of

Can. J. Anim. Sci. Downloaded from www.nrcresearchpress.com by MICHIGAN STATE UNIV on 01/17/17 For personal use only.

GUAN ET AL. * EXPRESSION OF THE b-GLUCANASE IN MICE broilers fed a barley-based diet. Anim. Feed Sci. Technol. 146: 8797. Papageorgiou, M., Lakhdara, N., Lazaridou, A., Biliaderis, C. and Izydorczyk, M. 2005. Water extractable (1 03, 104)-b-Dglucans from barley and oats: An intervarietal study on their structural features and rheological behaviour. J. Cereal Sci. 42: 213224. Philip, J., Gilbert, H. and Smithard, R. 1995. Growth, viscosity and beta-glucanase activity of intestinal fluid in broiler chickens fed on barley-based diets with or without exogenous beta-glucanase. Br. Poult. Sci. 36: 599603. Ravindran, V., Tilman, Z., Morel, P., Ravindran, G. and Coles, G. 2007. Influence of b-glucanase supplementation on the metabolisable energy and ileal nutrient digestibility of normal starch and waxy barleys for broiler chickens. Anim. Feed Sci. Technol. 134: 4555. Shen, M. Q., Lu, X. X., Cui, L. and Xu, J. X. 2003. Effects of different store condition on xylanase and b-glucanase activity. J. Shanghai Jiaotong Univ. (Agric. Sci.) 21: 2329. Smits, C. H. and Annison, G. 1996. Non-starch plant polysaccharides in broiler nutrition-towards a physiologically valid approach to their determination. World’s Poult. Sci. J. 52: 203222.

293

Tytgat, K., Bu¨ller, H., Opdam, F., Kim, Y., Einerhand, A. and Dekker, J. 1994. Biosynthesis of human colonic mucin: Muc2 is the prominent secretory mucin. Gastroenterology 107: 1352. Walsh, G. A., Power, R. F. and Headon, D. R. 1993. Enzymes in the animal-feed industry. Trends Biotechnol. 11: 424430. White, W. B., Bird, H., Sunde, M., Prentice, N., Burger, W. and Marlett, J. 1981. The viscosity interaction of barley betaglucan with Trichoderma viride cellulase in the chick intestine. Poult. Sci. 60: 10431048. Yin, H. F., Fan, B. L., Yang, B., Liu, Y. F., Luo, J., Tian, X. H. and Li, N. 2006. Cloning of pig parotid secretory protein gene upstream promoter and the establishment of a transgenic mouse model expressing bacterial phytase for agricultural phosphorus pollution control. J. Anim. Sci. 84: 513519. Zhai, Y. F., Shu, G., Zhu, X. T., Zhang, Z. Q., Lin, X. J., Wang, S. B., Wang, L. N., Zhang, Y. L. and Jiang, Q. Y. 2012. Identification of an intestine-specific promoter and inducible expression of bacterial a-galactosidase in mammalian cells by a lac operon system. J. Anim. Sci. Biotechnol. 3: 110.