Endocrine Journal 2010, 57 (9), 839-845

Note

A novel mutation of the MEN1 gene in a Chinese kindred with multiple endocrine neoplasia type 1 Lei Xu, Xu Li, Bo Feng, Yafang Ni, Hua Wang and Lin Wang Department of Endocrinology, the Affiliated East Hospital, Tongji University, Shanghai 200120, China

Abstract. Germline mutations in the MEN1 gene are well documented as the genetic cause of multiple endocrine neoplasia type 1 (MEN1). In this study, we performed genetic analysis by direct MEN1 gene mutation analysis on a Chinese MEN1 family. The two patients in this family were diagnosed as MEN1 by the typical clinical findings of parathyroidoma, insulinoma and pituitary adenoma. The coding sequences, including 9 coding exons and exon/intron boundaries of the MEN1 gene were amplified by polymerease chain reaction (PCR) and subjected to direct sequencing. Sequence analysis showed a same novel insertion mutation in exon 3 (c.433_434ins CTTC) in both patients, resulting in an open reading frames shift and produced a premature termination codon. None of the other family members had this insert mutation. In conclusion, we add a new mutation of MEN1 gene in Chinese patients with MEN1, and it would be useful for the diagnosis of the disease. Key words : Multiple endocrine neoplasia type 1, MEN1 gene, Insertion mutation

Multiple endocrine neoplasia type 1 (MEN1) is an autosomal dominant inherited disorder characterized by frequent occurrence of tumors of parathyroid, pancreatic islet and anterior pituitary, sometimes in combination with other rare tumors, and has been estimated to occur at a prevalence of 2-20 per 100,000 in the general population. The correct diagnosis of this syndrome is mandatory for the management of this disease, because therapeutic options for tumors associated with this syndrome are often different from those for similar but non-hereditary endocrine tumors, and because MEN1 manifestations should be periodically explored in both asymptomatic individuals in the affected pedigree and in people with early signs of MEN1 [1, 2]. The MEN1 gene was identified in 1997, and found to be composed of 10 exons spanning 2.8 kb in the chromosome region 11q13 that codes for a 610 amino acid nuclear protein, known as menin[3, 4]. Menin, which does not have similarities to any preReceived Apr. 19, 2010; Accepted Jul. 20, 2010 as K10E-116 Released online in J-STAGE as advance publication Aug.11, 2010

Correspondence to: Bo Feng, M.D., Department of Endocrinology, the Affiliated East Hospital, Tongji University, No 150 Jimo Road, Shanghai, 200120, China. E-Mail: [email protected] ©The Japan Endocrine Society

viously known protein, is thought to play a role in cell growth regulation, cell cycle, genome stability and synapse plasticity [5]. More than 400 germ line and somatic mutations in the MEN1 gene have been identified (http://uwcmmlls.uwcm.ac.uk/uwcm/mg/ search/120173.html). Germline mutation analysis of the MEN1 gene is a powerful tool for the definitive diagnosis of suspicious cases as well as recognition or exclusion of the predisposition to MEN1 in asymptomatic members at risk in the affected family. Here we describe a novel mutation in a Chinese MEN1 family with a insertion of 4bp in exon 3.

Subjects and Methods Case report The proband II-5 (Fig. 1) was a 52-year-old Chinese woman. At age 49, she visited our hospital for frequent nausea, vomiting, and upper abdominal pain. During a hospital stay, she had repeated hypoglycemic attacks. The laboratory findings for the patient upon admission were summarized in Table 1. Elevated levels of serum Ca, PTH, insulin, gastrin, PRL and GH and decreased levels of blood glucose were not-

Xu et al.

840

Fig. 1 Pedigree of the family with MEN1. Pedigree number for each individual was as shown; circles indicated women and square indicated men. Clinical status was denoted: open symbols, unaffected; solid symbols, affected; stippled symbols, undetermined; slashed, deceased.

Table 1 Laboratory findings in the two patients Reference range

Patient II-5

Patient III-4

Plasma Glucose(mmol/L)

3.1-6.4

1.0

2.55

Insulin (μU/mL)

2.6-24.9

26.22

26.88

Ca (mmol/L)

2.15-2.55

2.99

2.87

P (mmol/L)

0.87-1.45

0.82

1.25

PTH (pg/mL)

15-65

206.2

92.6

PRL (ng/mL)

3.4-24.1

>470.0

17.5

TSH (μIU/mL)

0.27-4.2

1.22

6.480

Gastrin (pg/mL)

0-90

136.3

Not available

0-10

31.7

2.3

25-65 pg/mL

Not available

60

GH (ng/mL) ACTH (pg/mL)

ed. Multiple duodenal ulcers were found by gastroscope. Magnetic resonance image (MRI) of pancreas showed multiple tumors located in the head and tail of the pancreas (Fig. 2A). Bilateral parathyroid tumors were found by computerized tomography (CT) (Fig. 2B). Pituitary adenoma was also detected by MRI (Fig. 2C). According to those findings, she was diagnosed with MEN1. The pancreatic tumors were completely removed by surgery. Pathology (Fig. 2D) and immunohistochemistry confirmed that they were insulinomas which could release gastrin. Subsequently, resection of parathyroid tumors was conducted and pathology confirmed the diagnosis of adenoma (Fig. 2E). No treatment for pituitary adenoma had yet been done, but regularly follow-up visits were demanded. Patient III-4 (Fig. 1), a nephew of the proband, visited our hospital for repeated hypoglycemic at-

tacks at age 18. The laboratory findings for the patient upon admission were summarized in Table 1. Elevated levels of serum Ca, PTH, insulin, TSH and decreased levels of blood glucose were found. A tumor 2.0×1.5cm in size was detected at the pancreatic body by MRI (Fig. 3A), which was removed by surgery then. Pathology (Fig. 3B) and immunohistochemistry showed that it was insulinoma. During the hospital stay, an MRI found pituitary adenomas (Fig. 3C) which might produce and release TSH; it has not been treated and regular follow-up visits were carried on. A CT scan detected a parathyroid tumor (Fig. 3D) then, and the diagnosis of primary hyperparathyroidism was determined according to the laboratory findings. Parathyroid tumor resection was performed and the pathology of the parathyroid tumor was adenoma (2×1.2×0.8cm) (Fig. 3E). After adenoma resec-

A novel mutation of the MEN1 gene

841

A

B

C

D

E

Fig. 2 Abnormal imaging and pathology for the proband A: Pancreas MRI showed multiple tumors located in the head and tail of the pancreas; B: CT scan showed bilateral parathyroid tumors; C: Pituitary MRI showed a soft tissue tumor in a size of 1.5cm×2.1cm; D: Pathology of resected pancreatic tumor showed tumor cells both in the pancreatic gland and nodule besides pancreatic gland. (HE stain,×40); E: pathology of resected parathyroid tumor showed parathyroid adenoma. Tumor was well circumscribed, and tumor cells were arranged in cords. (HE stain, ×100); Abnormality was denoted by arrows.

Xu et al.

842

A

B

C

D

E

Fig. 3 Abnormal imaging and pathology for the Patient III-4 A: Pancreas MRI showed a tumor at the pancreatic body; B: Pathology of resected pancreatic tumor showed tumor cells and Homer. Wright - like structures. (HE stain,×100); C: Pituitary MRI showed pituitary adenoma; D: CT scan of parathyroid showed a parathyroid tumor in the right parathyroid; E: pathology of resected parathyroid tumor showed parathyroid adenoma, and tumor cells were arranged in solid sheets, follicles and micro cysts. (HE stain, ×100). Abnormality was denoted by arrows.

A novel mutation of the MEN1 gene

tion, this patient also had moderate hypercalcemia and slightly elevated serum intact PTH. These two patients were diagnosed with MEN1. They all had the characteristics of insulinomas, parathyroid adenomas and pituitary tumors. The son of proband exhibited no manifestation of MEN1. The parents of the proband had been deceased for decades. No further information was available about the parents. None of the other family members had any manifestation of MEN1. It is noted that parathyroid adenoma but not its hyperplasia caused hyperparathyroidism in this MEN1 family. Enlargement, albeit highly asymmetric, of multiple parathyroid-glands is usually present in MEN1, but parathyroid adenoma was also reported before that it could cause hyperparathyroidism. Our study confirmed this view. Participants in this study were informed about the possibility of a genetic study, its implication, and its purpose. A written informed consent was obtained from those wishing to participate in the study. This study was approved by the ethics committee of Shanghai East Hospital. DNA extractions and mutation screening Venous blood samples were obtained from 8 members of the kindred (4 females and 4 males) for biochemical and genetic analyses. As control, peripheral blood samples were drawn from 25 healthy people who had no relation with this family for MEN1 gene analysis. Genomic DNA was isolated from peripheral blood leukocytes of the subjects by the phenol/chloroform method. The coding sequences, including 9 coding exons and exon/intron boundaries of the MEN1 gene [3] were amplified by polymerease chain reaction (PCR) and subjected to direct sequencing. Primers are listed in Table 2. PCR was performed in a final volume of 20µL containing 1x HotStarTaq buffer, 2.0 mM Mg2+, 0.2 mM dNTP, 0.2µM of each primer, 1 U HotStarTaq polymerase (Qiagen Inc, CA) and 1 µL template DNA. 1x GC buffer I (TAKARA, JPN) was used for exons 2, 8 and 9 instead of 1x HotStarTaq buffer. The PCR conditions were as follows: 95ºC for 15 min; 11 cycles of 94ºC for 15 s, 62ºC-0.5ºC per cycle for 40 s, 72ºC for 1min; 24 cycles of 94ºC for 15 s, 57ºC for 30 s, 72ºC for 1 min; 72ºC for 2 min, and 72ºC for 90 s (except exon 2, 8 and 9). For exon 2, 8 and 9, The cycling program was 95ºC for 15 min; 35 cycles of 96ºC for 10 s, 68ºC for 4min. PCR products were purified by SAP (Promega, USA) and Exo I (Epicentre, USA) as per the

843

Table 2 PCR primers of the MEN1 genes MEN1P2F

cggggcgggtggaaccttagc

MEN1P2R

tgagggggcagaggtgaggttga

MEN1P3F

ggaagggatggagggatagtg

MEN1P3R

caggaaaaggggctcttctgt

MEN1P4F

acacccctttcttcccatcac

MEN1P4R

ttctgggaccagccctttaat

MEN1P5F

attaaagggctggtcccagaa

MEN1P5R

agtgagactggatgggcgata

MEN1P6F

gagaaagagaagggccctgag

MEN1P6R

ggagggagggaaagatgtgac

MEN1P7F

cagcatcattttgcagtgagg

MEN1P7R

tccctaatcccgtacatgcag

MEN1P8F

gcccacgttggacgggactga

MEN1P8R

cccatcccacccagggggtct

MEN1P9F

gagaccccctgggtgggatgg

MEN1P9R

cctttgggctgggggcagaac

Table 3 Sequencing Primers MEN1P2F

cggggcgggtggaaccttagc

MEN1P2R

tgagggggcagaggtgaggttga

MEN1P3F

ggaagggatggagggatagtg

MEN1P4F

acacccctttcttcccatcac

MEN1P5F

attaaagggctggtcccagaa

MEN1P6F

gagaaagagaagggccctgag

MEN1P7F

cagcatcattttgcagtgagg

MEN1P8R

cccatcccacccagggggtct

MEN1P9F

gagaccccctgggtgggatgg

MEN1P9R

cctttgggctgggggcagaac

manufacture’s instructions. The sequencing reaction was conducted with a BigDye 3.1 kit (Applied Biosystems, Forster City, CA), The cycling program was 96ºC for 1 min; 28 cycles of 96ºC for 10 s; 50ºC for 5 s ; 60ºC for 4 min. The DNA was sequenced on both strands using an automated DNA sequencer ABI3130XL (Applied Biosystems, Forster City, CA). Primers used were listed in Table 3.

Results Germ line mutations of the MEN1 gene were screened in 8 members of this family. One nov-

Xu et al.

844

WT

Mut

Fig. 4 Partial sequence of wild-type and mutant MEN1. Sequence analysis of genomic DNA from the family members revealed a novel mutation c.433_434ins CTTC in the patients of this family. WT: Wild-type; Mut: Mutation.

el insertion mutation was identified in the 2 patients in exon 3(c.433_434ins CTTC, Fig. 4). This insertion mutation caused open reading frames shift and produced a premature termination codon (p.Ser145ThrfsX41). DNA samples from 25 unrelated normal individuals were also submitted to direct sequencing of exon 3. This insert mutation was absent in the other 6 available relatives and in all unrelated healthy subjects.

Discussion The MEN1 gene, which was identified in 1997 [3] consists of 10 exons that span approximately > 9 kb of genomic DNA and encodes a 610-amino acid protein referred to as menin. The main transcript of the MEN1 gene is a 2.8 kb mRNA. Menin, which is ubiquitously expressed, is predominantly a nuclear pro-

tein in nondividing cells [6], but in dividing cells it is found mainly in the cytoplasm [7]. Menin has at least 3 nuclear localization signals (NLSs) [8]. The truncated MEN1 proteins that would result from the nonsense and frameshift mutations, if express, would lack at least 1 of these nuclear localization signals. Menin has been shown to interact with proteins such as JunD, Smad3 family and NFKB family that are involved in transcriptional regulation, genome stability, cell division and proliferation [9, 10]. Different mutations of MEN1 gene have been identified in familial and sporadic MEN1. Nonsense mutations, frameshift deletions or insertions have been reported in the majority of MEN1 kindred so far studied [11]. These changes are likely to result in major alterations and functional loss of the menin protein and are consistent with the proposed role of the MEN1 gene as a tumor-suppressor gene [12].

A novel mutation of the MEN1 gene

This study identified a novel insertion mutation of MEN1 gene in a Chinese kindred with MEN1. This insert mutation caused open reading frames shift and produced a premature termination codon (p.Ser145ThrfsX41). These amino acid changes were predicted to result in a truncated and thus inactivated form of menin which lacked the function in suppressing transcriptional activation and controlling cell proliferation. That may drive cells towards inappropriate growth and ultimately result in tumor formation. In agreement with this concept was the absence of the insertion mutation in the other 6 members of this family and 25 unrelated normal individuals. In conclusion, we have described a novel MEN1

845

gene mutation in exon 3 in a Chinese kindred. This finding extends our knowledge of the variety of genetic abnormalities associated with familial MEN1. Functional studies are necessary to evaluate and understand the impact of this insertion mutation on clinical traits.

Acknowledgement This work supported by the scientific and technological foundation of social development department in Pudong new area, Shanghai, China (foundation number: PW2009B-1).

References 1. Glascock MJ, Carty SE (2002) Multiple endocrine neoplasia type 1: fresh perspective on clinical features and penetrance. Surg Oncol 11: 143-150. 2. Brandi ML, Gagel RF, Angeli A, Bilezikian JP, BeckPeccoz P, Bordi C, Conte-Devolx B, Falchetti A, Gheri RG, Libroia A, Lips CJ, Lombardi G, Mannelli M, Pacini F, Ponder BA, Raue F, Skogseid B, Tamburrano G, Thakker RV, Thompson NW, Tomassetti P, Tonelli F, Wells SA Jr, Marx SJ (2001) Guidelines for diagnosis and therapy of MEN type 1 and type 2. J Clin Endocrinol Metab 86: 5658-5671. 3. Chandrasekharappa SC, Guru SC, Manickam P, Olufemi SE, Collins FS, Emmert-Buck MR, Debelenko LV, Zhuang Z, Lubensky IA, Liotta LA, Crabtree JS, Wang Y, Roe BA, Weisemann J, Boguski MS, Agarwal SK, Kester MB, Kim YS, Heppner C, Dong Q, Spiegel AM, Burns AL, Marx SJ (1997) Positional cloning of the gene for multiple endocrine neoplasia-type 1. Science 276:404-407. 4. Lemmens I, Van de Ven WJ, Kas K, Zhang CX, Giraud S, Wautot V, Buisson N, De Witte K, Salandre J, Lenoir G, Pugeat M, Calender A, Parente F, Quincey D, Gaudray P, De Wit MJ, Lips CJ, Höppener JW, Khodaei S, Grant AL, Weber G, Kytölä S, Teh BT, Farnebo F, Thakker RV (1997) Identification of the multiple endocrine neoplasia type 1 (MEN1) gene. The European Consortium on MEN1. Hum Mol Gnet 6:1177-1183. 5. Yang Y, Hua X (2007) In search of tumor suppressing functions of menin. Mol Cell Endocrinol 265-266: 34-41.

6. Guru SC, Goldsmith PK, Burns AL, Marx SJ, Spiegel AM, Collins FS, Chandrasekharappa SC (1998) Menin, the product of the MEN1 gene, is a nuclear protein. Proc Natl Acad Sci USA 95: 1630-1634. 7. Huang SC, Zhuang Z, Weil RJ, Pack S, Wang C, Krutzsch HC, Pham TA,Lubensky IA (1999) Nuclear/ cytoplasmic localization of the multiple endocrine neoplasia type 1 gene product, menin. Lab Invest 79:301– 310. 8. La P, Desmond A, Hou Z, Silva AC, Schnepp RW, Hua X (2006) Tumor suppressor menin: the essential role of nuclear localization signal domains in coordinating gene expression. Oncogene 25:3537–3546. 9. Agarwal SK, Kennedy PA, Scacheri PC, Novotny EA, Hickman AB, Cerrato A, Rice TS, Moore JB, Rao S, Ji Y, Mateo C, Libutti SK, Oliver B, Chandrasekharappa SC, Burns AL, Collins FS, Spiegel AM, Marx SJ (2005) Menin molecular interactions: insights into normal functions and tumorigenesis. Horm Metab Res 37:369– 374. 10. Balogh K, Racz K, Patocs A, Hunyady L (2006) Menin and its interacting proteins: elucidation of menin function. Trends Endocrinol Metab 17:357–364. 11. Manuel CL, Rajesh VT (2008) Multiple endocrine neoplasia type 1 (MEN1): Analysis of 1336 mutations reported in the first decade following identification of the gene. Human Mutation 29: 22-32. 12. Larsson C, Skogseid B, Oberg K, Nakamura Y, Nordenskjold M (1998) Multiple endocrine neoplasia type 1 gene maps to chromosome 11 and is lost in insulinoma. Nature 332: 85-87.