Frequency of G71R and detection of a novel mutation in exon 1 of the UGT1A1 gene in a Malay population. Ma’amor NH1,Yusoff S2, Alwi ZilfalilB2,Mohd Yusoff N3,Ramli N2,Ibrahim NR2, Matsuo M4,Nishio H4,5, Van Rostenberghe H2 1

Human Genome Centre 2Department of Pediatrics, Universiti Sains Malaysia, Kubang Kerian, Kelantan, Malaysia, 3 Advanced Medicine and Dental Institute (AMDI), Universiti Sains Malaysia, Bertam, Kepala Batas, Pulau Pinang, Malaysia,4Department of Pediatrics and 5 Department of Community Medicine & Social Healthcare Science, Kobe University, Japan ABSTRACT: Introduction: Neonatal hyperbilirubinemia is a common condition appearing in the first week of life. This condition is caused by several factors such as hematological factor, breast feeding and mutations in genes like the bilirubin-uridine diphosphate glucuronosyltransferase gene (UGT1A1). The objectives of this study were to determine and compare the frequency of mutations in the exon 1 of the UGT1A1 gene in a Malay population in Malaysia, in a group of jaundiced and non-jaundiced neonates Design: Cross sectional study, screening the exon 1 of the UGT1A1 gene for the presence of mutations in jaundiced and non-jaundiced neonates. Method & Materials: Six hundred and ten (610) samples were enrolled in this study. DNA extraction was performed on venous or umbilical arterial blood. Polymerase Chain Reaction (PCR) was performed and samples were screened using Denaturing High Performance Lipid Chromatography (DHPLC). The samples observed with a mutation peak on DHPLC were sequenced to confirm the mutation. Data were analyzing using SPSS version 14.0. Results:

Mutation in exon 1 had been observed in 52 samples. Thirty two were G71R

mutations, belonging to the jaundice group (32/305 or 10.5%) while 19 were G71R mutations belonging to the control group (19/305 or 6.23). One of the 52 samples was a new novel

mutation appearing in the UGT1A1 gene. The differences found between the jaundiced and control groups was not statistically significant. Conclusion:

This study showed a high prevalence of G71R mutation in a Malay population

and revealed a new mutation in the UGT1A1 gene.

KEY WORDS: neonatal hyperbilirubinemia, bilirubin-uridine diphosphate glucuronosyltransferase (UGT1A1), mutation.

SHORT TITTLE: Mutation in exon 1 of the UGT1A1 gene in a Malay population.

INTRODUCTION Neonatal hyperbilirubinemia is multifactorial in etiology. The best know responsible factors include Rhesus or ABO incompatibility, G6PD deficiency, breast feeding, birth trauma and polycythaemia1. Mutation in the UGT1A1 gene, clinically presenting as Criggler Najjar syndrome (I or II) are also well known causes of neonatal jaundice 2. Gilbert syndrome is due to smaller mutations of the UGT1A1 and even though some controversy remains3, there are several studies suggesting that Gilbert syndrome plays a significant pathogenetic role in neonatal jaundice4, 5, 6. The gene (UGT1A1), for the key enzyme in bilirubin excretion (bilirubin uridinediphosphate glucuronosyltransferase 1A1) and is located on chromosome 2 (2q.37)7. A mutation in the promoter region of this gene (A (TA) 7TAA) has been identified as the cause of Gilbert syndrome and as a common potential risk factor for neonatal jaundice in Caucasian populations8. Another mutation (G71R) is located in exon 1 and is a common risk factor for neonatal jaundice in East Asian populations 8, 3. Only more recently there have been reports of research looking into mutations in the UGT1A1 gene in South East Asians. Reports from Malaysian9, Indonesian3 and Singaporean10 populations have shown that mutations in the UGT1A1 gene are present in these populations with different variants and they may play a significant role in the occurrence of neonatal jaundice. In a Malay population from Malaysia, it appears that mutations in the promoter and enhancer region are important in the pathogenesis of neonatal jaundice8. Mutations in the exons of the UGT1A1 gene have also been reported in a small number of Malay subjects. Especially exon 1, where the G71R mutation is located, deserves further investigation in a larger group of

Malay subjects. The objective of this study was to screen exon 1 of the UGT1A1 gene for the presence of mutations in jaundiced and non-jaundiced neonates, born in the Malaysian mainly for Malay population. SUBJECTS & METHODS This cross sectional study was conducted in Hospital Universiti Sains Malaysia (HUSM), Kelantan, Malaysia from March 2008 until December 2008. HUSM is a tertiary hospital, located in Kelantan, The North East of Peninsular Malaysia, where the populations consist for more than 95% of Malays. Six hundred ten neonates (305 samples for neonates with hyperbilirubinemia and 305 samples without hyperbilirubinemia) were involved in this study. Hundred and thirteen neonates had hyperbilirubinemia requiring phototherapy and 87 had no significant hyperbilirubinemia. Inclusion criteria were: gestational age ≥ 37 weeks, birth weight between 2.5 and 4.0 kg, and absence of congenital abnormalities or illness (other than jaundice). Written parental consent was obtained for this study and this study had approval from the research and Ethics committee of Universiti Sains Malaysia (USM). One milliliter (1 ml) of whole blood was collected using ethylenediaminetetra-acetic (EDTA) container, obtained through venipuncture from jaundiced neonates while bloods from the controls were taken from the umbilical cord. Neonates in the control group were followed up for 5 to 7 days to ensure they did not develop jaundice or other illnesses within that period.

Extraction of genomic DNA and Polymerase Chain Reaction (PCR) DNA extraction was done using commercial extraction kit, QIAamp DNA blood mini kit (QIAGEN, Gmbh Hilden, Germany) 250 units. Two hundred microliliter (200 µl) of blood from neonates were used for the DNA extraction. Primers for polymerase chain reaction (PCR) were designed using software 3 program (www.frodo.wi.mit.edu/primer3/). This program were developed by Steve Rozen (Whitehead Institute, Cambridge) and Helen Skaletsky (Howard Hughes Medical Institute, USA) and maintained by Steve Rozen. PCR was done by preparing master mix using 10X PCR buffer II (contain no MgCl2, manufactured by Roche), 25mM Magnesium Chloride (MgCl) contain 1.5 ml and manufactured by Roche, 10mM dNTP (manufactured by Warrington, UK) and 5µ/µl Amplitaq gold DNA polymerase 250 units manufactured by Roche . Specific conditions using thermo cycler machine, TECHNE (TC-512 manufactured by TECAN, Austria) were used to amplify the interested fragment. Figure 1 show a list of primers for the detection of mutations. Denaturing high performance liquid chromatography (DHPLC) Screening method by DHPLC machine was used in this study for observing an abnormality peak that may appear. The peak may represent the absence of mutations or single nucleotide polymorphisms (SNPs). Optimum temperature for exons were optimized to detect a partial denature peak. The partial denature is the temperature where the mutations or SNPs will be detected. Optimum temperature for every exon was predicted using melt temperature software http://insertion.standford.edu/meltdoc.html. Slow re-annealing using Gene AMP® PCR system 9700 thermocycler machine was performed before samples were placed in DHPLC machine by mixing a wild control with controls (blood collected from umbilical cord blood) or patients

(blood collected from neonatal jaundice). For wild type control, sequencing method was performed first and wild control need to be free from any mutation or SNP in the interest fragment study. Any abnormal peak will be observed to detect mutation. If double peak or heteroduplex peak was observed in a first run, sample alone without mix will be run again prior to sequencing analysis for the confirmation of the presence of mutation. This step is useful in early identification of sample either having heterozygous or homozygous mutation. Purification method Purification was performed using commercial kit QIAquick PCR purification Kit (manufactured by QIAGEN in Germany), by following the instruction from manufacturer prior to sequencing analysis. Sequencing method Samples having the abnormality peak in DHPLC were proceeding to the sequencing method. Any changing in exon (coding region) or intron (non-coding region) was observed to detect the mutation or SNP by observing abnormality in nucleotide or in sequencing graph before analysis result was done. Statistical analysis Science Package Social Software (SPSS) version 14.0 was performed using parametric test (chi-square test) and descriptive statistics test for observe frequencies in both subjects.

RESULTS: Out of the 610 subjects included in this study, there were 52 (8.52%) subjects carrying a mutation in exon 1 of the UGT1A1 gene. Thirty two of these subjects were found in the jaundice group (32/305 or 10.5%) while 19/305 or 6.23 % subjects belonged to the non-jaundiced group. Screening by DHPLC showed a similar abnormal peak (figure 1) appears in all 51 samples. Samples with heteroduplex peak were re-run and heteroduplex peak were observed in the entire 51 sample. All samples with abnormal peaks were subsequently sequenced and the 46 samples showing a similar peak on DHPLC were confirmed to be the heterozygous G71R mutation (figure 3). However, we had observed another 5 samples that were confirmed to be as a homozygous of G71R mutation (figure 4). There is no significant between jaundice group and non-jaundiced group (p>0.484). Interestingly, one sample showed a mutation in different part the exon 1 (figure 2). The one with the different peak on DHPLC showed a novel mutation at nucleotide 774, T (Thymine) to A (Adenine) in sequencing analysis in heterozygous form and there is no significant result found between these two group (p>1.000). Figure 5 shows the result of sequencing of the latter mutation. DISCUSSION This study shows a high prevalence of mutations in the first exon of the UGT1A1 gene (10%) in the studied Malay population. The prevalence found in this study may be an overestimate of the real prevalence in the Malay population since a large of percentage (56.5%) of the studied population had jaundice requiring phototherapy. The prevalence of the G71R

mutation turns out to be higher than a previous estimate from a smaller study done on a sample of the same population8. It has been shown that, by using of cDNA in COS-7 cells, heterozygous state for the G71R mutation could result in a 60% reduction in expression of the enzyme activity of the UGT1A1 gene11. An important this is for the pathogenesis of neonatal jaundice has remained a subject of controversy. In Japan12, 13 the heterozygous state was thought to be a significant risk factor for neonatal jaundice while in other populations 3,14the association between the heterozygous state for G71R and neonatal jaundice was less clear.

It may well be that in Malaysia, where a lot of other genetic and environmental risk factors exist, that a combination of risk factors may be essential in the pathogenesis of most cases of neonatal jaundice. For example, G6PD deficiency is another risk factor for neonatal jaundice screened for in all Malaysian neonates and has a prevalence of about 5% in the male population or 2.5 % in the overall population15. It has been shown to cause a mild haemolysis which was equally severe in G6PD deficiency with or without jaundice 15. If the bigger picture is considerated, a combination of risk factors may be responsible for the clinical picture of neonatal jaundice in many cases (e.g. any cause of mild haemolysis, associated with a mild or moderate reduction in expression of the UGT1A1 gene). Based on G6PD deficiency and the G71R mutation alone there would be already 0.2-0.3% of newborns having a combination of these risk two factors15. However a multitude of factors, including ABO incompatibility16,17, South East Asian Ovalostomatocytosis18, Thallasaemia trait19, other mutations in the UGT1A1 gene9, deficient breast feeding17, birth trauma, polycythaemia are occurring at relatively high frequencies (un rarely exceeding five percent) in the population.

This study has revealed also a novel mutation in a patient with severe neonatal jaundice. The replacement of Thymine (T) by Adenine (A) at nucleotide 774 causes a missense mutation resulting in a substitution of Serine to Arginine in the corresponding protein. This mutation is also known as S258R mutation. The effects on the expression of the uridine glucuronyl transferase enzyme are uncertain. If expression studies show a reduced expression of the enzyme to be caused by this mutation, it may well be a risk factor for neonatal jaundice.

CONCLUSION Although DHPLC had been useful use to screen the mutation in UGT1A1 gene, sequencing method need to be performed in order to determine and confirm the mutation of the gene. This study also showed a high prevalence in a Malay population of the G71R mutation and a novel mutation in Malay population was discovered. ACKNOWLEDGEMENT: We would like to thank Ministry of Sciences Technology & Innovation (MOSTI) for providing the grant under e-sciences fund grant (06-01-05-SF0166) and USM fellowship for financial support. A lot of thanks to all parent for allowing their neonates to participate, students and staffs in Human Genome Centre, Universiti Sains Malaysia and also to staff and nurse in labor room and neonatal intensive care unit (NICU) for giving a lot of cooperation during this study.

REFERENCES: 1. Julia A. McMillan, Ralph D. Feigin, Catherine DeAngelis, M. Douglas Jones. Chapter 26: Neonatal Jaundice. Oski’s pediatrics: principles&practice. 4th Edition (2006). Lippincott Wiliams and Wilkins 2. Kadakol A, Ghosh SS, Sappal BS, Sharma G, Chowdhury JR, Chowdhury NR. (2000). Genetic lesions of bilirubin uridine-diphosphoglucuronate glucuronosyltransferase (UGT1A1) causing Crigler-Najjar and Gilbert syndrome:correlation of genotype to phenotype. Hum Mutant, 16:297-306. 3. Sutomo R, Talib NA, Yusoff NM, Van Rostenberghe H, Sadewa AH, Sunarti, Sofro AS, Yokoyama N, Lee MJ, Matsuo M, Nishio H. (2004). Screening for G71R mutation of the UGT1A1 gene in the Javanese-Indonesian and Malay-Malaysian populations. Pediatr Int.Oct;46(5):565-9. PubMed PMID: 15491385. 4. Y. Maruo, S. Wada, K. Yamamoto, H. Sato, T. Yamano and M. Shimara. (1999). A case of anorexia nervos with hyperbilirubinaemia in a patient homozygous for a mutation in the bilirubin UDP/glucuronosyltransferase gene. Eur. J. Pediatr. 158, 547–549. 5. Ching-Shan Huang,Pi-Feng Chang, Myay Jen Huang, En-Sung Chen, Kun-Long Hung, Kuo-Inn Tsou. (2002). Relationship between bilirubin UDP-Glucuronosyl Transferase 1A1 gene and Neonatal Hyperbilirubinemia. Pediatrics Research, 52:4 6. Akiyo Yamamoto, Hisahide Nishio, Shozo Waku, Naoki Yokoyama, Masahiko Yonetani, Yoshiyuki Uetani, Hajime Nakamura. (2002). Gly71Arg Mutation of the bilirubin UDPGlucuronosyltransferase 1A1 gene is Associated with Neonatal Hyperbilirubinemia in the Japanease Population. Kobe J. Med.Sci, 48(3):73-77. 7. Elisio Costa, Emilia Vieira, Marcia Martins, Jorge Saraiva, Eugeniacancela, Miguel Costa, Roswitha Bauerle, Teresa Freitas, Joao R. Carvalho, Ermelinda Santos-Silva, Jose Barbot and Rosario dos Santos. (2006). Analysis of the UDP-glucuronyltransferase gene Portuguese patients with a clinical diagnosis of Gilbert and Crigler-Najjar Syndrome. Blood Cells, Molecules, and Disease, 36 (91-97). 8. Yusoff S, Van Rostenberghe H, Yusoff NM, Talib NA, Ramli N, Ismail NZ, Ismail

WP, Matsuo M, Nishio H. (2005). Frequencies of A(TA)7TAA, G71R, and G493R mutations of the UGT1A1 gene in the Malaysian population. Biol Neonate.89(3):171-6. Epub Oct 6. PubMed PMID: 16210851. 9. Surini Yusoff, (2006). Study of Bilirubin-Uridine Diphosphate Glucuronyl Transferase (UGT1A1) Gene in Neonatal Hyperbilirubinemia. 10. Y.Y.Zhou, L.Y.Lee, S.Y.Ng, C.P.P. Hia, K.T.Low, Y.S. Chong and D.L.M. Goh. (2009). UGT1A1 Haplotype Mutation among Asians in Singapore. Neonatology, 96:150-155. 11. Kazuo Yamamoto, Hiroshi Sato, Yoshihide Fujiyama, Yukio Doida and Tadao Bamba.(1998). Contribution of two missense mutation (G71R and Y486D) of the bilirubin UDP glycosytransferase (UGT1A1) gene to phenotypes of Gilbert’s syndrome and Crigler-Najjar syndrome type II. Biochim Biophys Acta,1406(3):267-73. 12. O. Koiwai, M. Nishizawa, K. Hasada, S. Aono, Y. Adachi, N. Mamiya and H. Sato. (1995). Gilbert's syndrome is caused by a heterozygous missense mutation in the gene for bilirubin UDP-glucuronosyltransferase. Hum. Mol. Genet. 4, 1183–1186. 13. Yamamoto, A., Nishio, H., Waku, S., Yokoyama, N., Yonetani, M., Uetani Y., & Nakamura, H. (2002). Gly71Arg mutation of the bilirubin UDP-glucuronosyltransferase 1A1 gene is associated with neonatal hyperbilirubinemia in the Japanese population. Kobe J med Sci, 48 (3-4), 73-7. 14. Surini Yusoff, Atsuko Takeuchi, Chitose Ashi, Masako Tsukada, Nur Hasnah Ma’amor, Bin Alwi Zilfalil, Narazah Mohd Yusoff, Tsutomu Nakamura, Midori Hirai, Indra sari Kusuma Harahap, Gunadi, Myeong Jin Lee, Noriyuki Nishimura, Yutaka Takaoka, Satoru Morikawa, Ichiro Marioka, Naoki Yokoyama, Masafumi Matsuo, Hisahide Nishio, Hans Van Rostenberghe. (2010). A Polymorphic mutation, c-3279t>G, in the UGT1A1 promoter is a risk factor for neonatal jaundice in the Malay population. Pediatric Research 15. Salamatu Jalloh, Hans Van Rostenberghe, Narazah M Yusoff, Selamah Ghazali, Nik Zainal Nik Ismail, Masafumi Matsuo, Nor Akmal Wahab and Hishahide Nishio. Poor correlation between hemolysis and neonatal jaundice in Malaysian glucose 6-phosphate dehydrogenase-deficient babies. Pediatrics International, 2005. 47, 1-000.

16. Christian Bragger MD. (2005). Another risk factor for Neonatal Hyperbilirubinemia. Risk factors for severe Hyperbilirubinemia in Neonates. Journal of Pediatric Gastroenterology and Nutrition, 40:388–389 17. Michael Kaplan and Cathy Hammerman. (2005). Bilirubin and the Genome: The hereditary Basis of unconjugated bilirubin. Current Pharmacogenomics, 3, 21-42. 18. Vichai Laosombat, Supaporn Dissaneevate, Malai Wongchanchailert, Benjamas Satayasevana. (2005). Neonatal Anemia Associated with Southeast Asian Ovalocytosis. International journal of hematology, 82:201-205 19. Maurizio Sampieto, Lorenda Lupica, Luca Perrero, Alessia Comino, Franco Martinez Di Montemutos, Maria Domenica and Gemino Fiorelli. (1997). The expression of Uridine diphosphate glucuronosyltransferase gene is a major determination of bilirubin level in heterozygous β-thalassemia and in glucose-6-phosphate dehydrogenase deficiency. British Journal of Hematology, 99: 437-439. 20. P.J. Bosma, B. Goldhoorn, R.P. Oude Elferink, M. Sinaasappel, B.A. Oostra and P.L. Jansen. (1993). A mutation in bilirubin uridine 5′-diphosphate glucuronosyltransferase isoform 1 causing Crigler–Najjar syndrome type II .Gastroenterology, 105, 216–220. 21. J. Seppen, P.J. Bosma, B.G. Goldhoorn, C.T. Bakker, J.R. Chowdhury, P.L. Jansen, R. Oude and P. Elferink. (1994). Discrimination between Crigler–Najjar type I and II by expression of mutant bilirubin uridine diphosphate glucurononosyltransferase. J. Clin. Invest. 94, 2385–2391. 22. Aono, S., Yamada, Y., Keino, H., Sasaoka, Y., Nakagawa, T., Onishi, S., Mimura, S., Koiwai, O. & sato, H. (1994). A new type of defect in the gene for bilirubin uridine 5’diphosphate-glucuronosyltransferase in a patient with Crigler-Najjar Syndrome type I. Pediatr Res, 35(6), 692-32. 23. V. Servedio, M. d'Apolito, N. Maiorano, B. Minuti, F. Torricelli and F. Ronchi. (2005). Spectrum of UGT1A1 mutations in Crigler–Najjar (CN) syndrome patients: identification of twelve novel alleles and genotype–phenotype correlation. Hum. Mutat. 25, 325. 24. Sutomo R, Laosombat V, Sadewa AH, Yokoyama N, Nakamura H, Matsuo M, Nishio H. (2002). Novel missense mutation of the UGT1A1 gene in Thai siblings with Gilbert's syndrome. Pediatric Int, 55(4):427-32

25. Yoshihiro Maruo, Ishwar Chander Verma, Katsyuki Matsui, Hiroko Takahashi, Yu Mimura, Yoriko Ota, Asami Mori, Renu Saxena, Hiroshi Sato and Yoshihiro Takeuchi. (2008). Conformational Changes of UGT1A1 gene by a Novel Missense Mutation (p.L131P) Causing Crigler Najjar-Syndrome Type I. Journal of Pediatric Gastroenterology and Nutration, 46:308-311 26. Sunil K. Agrawal, Praveen Kumar, Ritu Rathi, Neeraj Sharma, Reena Das, Rajendra Prasad and Anil Narang. (2009). UGT1A1 Gene Polymorphism in North Indian Neonates Presenting with Unconjugated Hypernilirubinemia. Pediatric Research, 65 (6) 27. Mario D’Apolito, Agnese Marrone, Veronica Servedio, Pietro Vajro, Achille Iolascon. (2007). Seven novel mutations of the UGT1A1 gene in patients with unconjugated hyperbilirubinemia. Hematology journal, 92(01).

Type of primer

Primer Sequences (5’-3’)

Size of PCR products (bp)

Exon 1b (F)

TGGGAAGATTCTGTTGATCC

Exon 1b (R)

AAGAATACAGTGGGCAGACC

Exon 1d (F)

TCTCTCCTCTCATTCAGATCAC

Exon 1d (R)

TATATCTGGGGCTAGTTAATCG

431 bp 367 bp

Table1: List of primers used in the mutation detection analysis.

Figure 1: Abnormality peaks in dHPLC at 60 degree in 32 samples with hyperbilirubinemia and 19 samples without hyperbilirubinemia.

Figure 2: Abnormality peak using dHPLC at 59 degree in a sample.

Figure 3: Overlapping graph observed in exon 1 confirming mutation in G71R cause Guanine (G) change to Adenine (A) in heterozygous form.

Figure 4: Mutation been observed in exon 1 confirming mutation in G71R cause Guanine (G) change to Adenine (A) in homozygous graph.

Figure 5: Overlapping in another region in exon 1 showed overlapping in Thymine (T) and Adenine (A).

Table 2: Mutations in exon 1 reported in various populations in the world

No

Study by

Type of mutation

 

Nucleotide/

Population

Clinical

Study report causes of

protein

Investigate

syndrome

mutation

changes or

and the

mutation

mutatant

percentage

of UGT1A1

1

P.J Bosma et al., 199320

Substitution

c.625T>C

Netherlands

CN II

2

J.Seppen et al., 199421

Deletion

c.524 T>A/AA

Netherlands

CN II

175 leu toglu 3

Osamu Koiwai et al., 1995

Substitution

c.686 C>A

Truncated proteins with a frameshift were not expressed

Japan

12

Gilbert syndrome

4

Aono S et al., 199422

Substitution

c.840 C>A

Japan

CN I

Cause stop codon appear

5

V. Servedio et al., 2005 23

Substitution/Non

c.576 C>G

Italy

CN I

Generates a premature

sense mutation 6

V. Servedio et al., 200523

Deletion

termination of the protein c.801Del C

Italy

CN I

Premature termination of UGT1A1 protein due to frameshift. Mutation inherited from consanguineous parents

7

8

9

Y. Maruo et al., 1999 4

Surini Y et al., 20069

Sutomo et al., 20043

Substitution

Substitution

Substitution

c211 G>A

c211 G>A

c211 G>A

Japan

Gilbert

Mutation appear in most cases

syndrome

in this population

Malay,

Gilbert

Malaysia

syndrome

Malay,

Gilbert

Mutation is this region is not

Malaysia &

syndrome

main causes contribute to NNJ.

Javanese,

Another factor such as G6PD

Indonesia

deficiency and ABO incompatibility might be contribute

10

Kazuo Yamamoto et al.,

Substitution

c211 G>A

Japan

Gilbert

Expression study show reduced

199811

syndrome

of G71R activity to develop genotype of Gilbert’s syndrome

11

Sutomo R et al., 200224

Substitution

c247T>C/

Thailand

leucine to

Gilbert

Mutation lead to overt

syndrome

phenotype and it is inherited as

phynylalanine

an autosomal recessive trait

at codon 83 of enzyme protein 12

Yoshihiro Maruo et al., 2008

Substitution

25

c392T>C/

India

CN I

Expression study suggests

leucine to

corresponding protein cause

proline at

loses glucuronidation activity

position 131of

of UGT1A1. Acid amino

corresponding

changes don’t cause a

protein

glycosylation site, implying mutation alters steric conformation of enzyme.

13

Sunil K. Agrawal et al., 2009

Substitution

26

c72G>C/alanin

India

Found in control and patients

e to proline

and suggest may not affect the glucuronidation activity significantly. Protein expression needs to be explored.

14

Maria D’Apolito et al., 2007

27

Insertion &

c526InsT &

substitution

c847C>T

Italy

CNI

Introduces to a stop codon to the sequences