Vitamin D and Intimal Hyperplasia in Coronary Artery Disease

___________________________________

By GAURAV KUMAR GUPTA ___________________________________

A (THESIS/DISSERTATION)

Submitted to the faculty of the Graduate School of the Creighton University in Partial Fulfillment of the Requirements for the degree of Doctor of Philosophy in the Department of Biomedical Sciences _________________________________

Omaha, NE (06/12/2012)

Abstract Atherosclerosis is the leading cause of disability and death worldwide. The whole spectrum of atherosclerosis develops through series of highly specific cellular and molecular events that lead to the formation and progression of atherosclerotic plaque and finally its complications. Coronary artery disease (CAD), most common among cardiovascular diseases, is characterized by insufficient oxygen supply to the heart muscle which primarily occurs due to coronary artery atherosclerosis. During last three decades, percutaneous coronary intervention has become the major strategy to treat coronary artery disease but, restenosis (re-narrowing of the vessel after an interventional procedure) is the major limitation of this approach. Although, the rate of restenosis is significantly reduced by stent implantation, especially drug eluting stents, there is a concern that drug eluting stents might increase the rate of in-stent thrombosis, a potentially fatal complication. Neointimal hyperplasia, a cell proliferation and differentiation process, is the predominant mechanism in the development of instent restenosis. Vitamin D is a secosteroid which functions through vitamin D receptor (VDR), a transcription factor, and directly or indirectly controls more than 200 heterogeneous genes including genes that regulate cellular differentiation, proliferation, and angiogenesis. Vitamin D receptors are distributed in a variety of tissues including, vascular smooth muscle cells (VSMCs), cardiomyocytes, endothelium, and cells of immune system. The growth suppressant and immunomodulatory effects of calcitriol are of great interest because of their potential use in the management of disorders, including

post-interventional

restenosis,

1

atherosclerosis

and

post-transplant

vasculopathy in which the underlying pathological mechanisms are uncontrolled cell growth and remodeling in the vascular wall. The central hypothesis is that calcitriol inhibits proliferation, migration and phenotypic modulation of porcine coronary artery smooth muscle cells (PCASMCs) through VDR and that vitamin D supplementation reduces the incidence of restenosis by decreasing neointimal hyperplasia after coronary artery intervention in coronary artery disease. In this study, the effect of calcitriol stimulation on the expression of VDR and vitamin D metabolizing enzymes including CYP24A1 and CYP27B1 was examined in cultured PCASMCs. Further, the effect of calcitriol stimulation on cell proliferation, migration, phenotypic modulation and apoptosis was investigated in cultured PCASMCs. Next, expression of TNF-α and VDR in the neointimal lesions in postintervention hypercholesterolemic swine coronary arteries were examined. Finally, the effect of vitamin D deficiency and vitamin D supplementation on the development of post-intervention restenosis was investigated in a well-controlled atherosclerotic swine model of coronary restenosis. PCASMCs express VDR and vitamin D metabolizing enzymes. Treatment of PCASMCs with calcitriol significantly increased the mRNA and protein expression of VDR and CYP24A1 in a dose-dependent manner while expression of CYP27B1 was significantly decreased as compared to control. Calcitriol treatment significantly decreased serum-induced proliferation of PCASMCs and has no effect on the apoptosis in these cells. Calcitriol also decreased PDGF-BB-induced proliferation, migration and phenotypic modulation in PCASMCs. In vivo morphometric analysis of tissues revealed 2

that coronary intervention in hypercholesterolemic Yucatan miniature swine induced significant restenosis. Histological evaluation of post-intervention swine coronary arteries showed expression of smooth muscle α-actin and significantly increased expression of TNF-α in neointimal lesions. Interestingly, there was significantly decreased expression of VDR in PCASMCs of neointimal region compared to normal media. Vitamin D deficiency increased the magnitude of restenosis and PCNA-positive cells in neointimal tissue of post-intervention coronary arteries, which is suppressed by supplementation of vitamin D post-intervention. Vitamin D supplementation significantly downregulated the levels of TNF-α and IFN-γ, upregulated the levels of IL10, and had no effect on serum IL-6 levels. These data suggest that calcitriol inhibits proliferation in PCASMCs through VDR and there is significant downregulation of VDR in proliferating PCASMCs of neointimal lesions. Thus, downregulation of VDR in VSMCs of post-interventional arteries due to high concentration of TNF-α could be a potentially contributing factor for uncontrolled growth of VSMCs in injured arteries leading to neointimal hyperplasia and restenosis. Expression of VDR is increased by VDR ligands and growth inhibitory and immunomodulatory actions of VDR may likely be enhanced in the presence of vitamin D ligands. Therefore, anti-proliferative effect of VDR ligands can prevent/decrease VSMC proliferation after mechanical injury to the artery and attenuate restenosis. This could be an inexpensive and safe therapeutic approach for reduction in cardiovascular disease burden.

3

Acknowledgement The completion of this work gives me the long awaited opportunities to express my gratitude to all those who have contributed to this work in some way or the other. I am deeply indebted to my esteemed teacher and supervisor Dr. Devendra K. Agrawal, for infinite moral support. His invaluable ideas, critical appraisals and indispensable guidance have been integral to the accomplishment of this effort. I am also grateful to my committee members Dr. Philip R. Brauer, Dr. Michael G. DelCore, Dr. William J. Hunter and Dr. Eric B. Patterson for their guidance, encouragement and constant support. I would also like to express my sincere thanks to the Department of Biomedical Sciences for providing me the opportunity to complete this research work. I am also thankful to all my lab members for their time to time help and tiding over the difficulties whensoever I encountered them. This acknowledgement will be body without soul, if I do not mention my parents Dr. Ram P Gupta and Mrs. Sudha Gupta and no words I write here will ever do justice to their invaluable prayers, support, and constant encouragement for me. Special mention is deserved by Dr. Tanupriya, my best friend and loving wife, for constantly inspiring me in her own loving way, to work hard and realize my potential to the maximum. In addition, I would like to thank my brothers Dr. Saurabh Gupta, Dr. Vaibhav Gupta and my sister in-law Dr. Neha Goel for their emotional support in all those times when this work appeared to be a Herculean task.

4

Table of Contents

Abstract……………………………………………………………………………………………….……….…….1 Acknowledgements………………………………………………………………………………………….…..4 Table of Contents………………………………………………………………………………………….….….5 List of Figures……………………………………………………………………………………………………..8 Abbreviations…………………………………………………………………………………………………..….11

Chapter 1…………………………………………………………………………………………………………….14 1. Introduction………………………………………………………………………………………………..15 1.1 Atherosclerosis...............................................................................................15 1.2 Coronary Artery……………………………………………………………………..…...…….20 1.2.1 Epidemiology of Coronary Artery Disease………………………….….………20 1.2.2 Coronary Artery Disease Treatment……………………………………………..21 1.2.3 Medical Management…………………………………………………………….……21 1.2.4 Percutaneous Coronary Intervention……………………………….……..……22 1.2.5 Angioplasty with Stenting……………………………………………..……….……22 1.2.6 Drug eluting stents………………………………………………………..…….……..23 1.2.7 Coronary Artery Bypass Grafting………………………………………………….27 1.3 Intimal Hyperplasia and Restenosis……………………………………………..…………..28 1.3.1 Pathophysiology of Restenosis………………………………………..…………...29 1.4 Vascular Smooth Muscle cell in Atherosclerosis and Restenosis…….………….…31 1.5 Smooth Muscle Cell Phenotypic Modulation and Restenosis…………….…….…..33 1.6 Platelet derived Growth factor (PDGF)…………………………………………..…….……33 1.6.1 Platelet derived growth factor receptor………………………….……….……..34 1.6.2 Role of PDGF in vascular disease………………………………………………….36 1.7 Role of Inflammatory Cytokines in Restenosis……………………………..….…………38 1.8 Research Models for Coronary Artery Disease…………………………….…………..…42 1.8.1 Swine Model of Coronary restenosis………………………………..……….…..43 1.9 Vitamin D……………………………………………………………………………….……….……..45 1.9.1 Vitamin D Deficiency………………………………………………….……………….45 1.9.2 Vitamin D Metabolism…………………………………………..…….……………..47 1.9.3 Vitamin D Receptor (VDR)……………………………………..….…….…..…….47 1.9.4 Vitamin D and Extra Skeletal Heath…………………………………………….52 1.9.5 Vitamin D and Immunomodulation…………….……………………….………54 1.9.6 Vitamin D and Cardiovascular Diseases………………………………………..56 1.10 Hypothesis and Specific aims…………………………………………………….……………59

5

Chapter 2…………………………………………………………………………………………………………….60 2. Material and Methods…………………………………………………………………………….…….61 2.1 Tissue Culture……………………………………………………………………………….………..61 2.2 Treatment of Porcine Coronary Artery Smooth Muscle Cells…………….…….....63 2.3 RNA Isolation and Quantification……………………………………………………………63 2.4 Reverse Transcription and Real-Time PCR………………………………….……………65 2.5 Protein Isolation and Quantification………………………………………………..……….66 2.6 Western Blotting………………………………………………………………………….……..….66 2.7 GFP Transfection……………………………………………………………………….….….......68 2.8 Silencing RNA .…………………………………………………………………………….……..…69 2.9 Thymidine Proliferation Assay………………………………………………………............69 2.10 Bromodeoxyuridine (BrdU) Proliferation Assay…………………………………….…70 2.11 Annexin V and Propidium Iodide Apoptosis Assay…………………………..…….…70 2.12 Transwell Migration Assay……………………………………………………………..………71 2.13 Fluorometry………………………………………………………………………………..………..72 2.14 Immunocytochemistry……………………………………………………………….………….72 2.15 Animals…………………………………………………………………………………..……………73 2.16 Experimental Diet ……………………………………………………………………..…………73 2.17 Experimental Protocol…………………………………………………………………..……….73 2.18 Animal Preparation and Operative Protocol and Angiography………..…………79 2.19 Blood Draw…………………………………………………………………………………...........81 2.20 Stents…………………………………………………………………………………………………..81 2.21 Optical Coherence Tomography…………………………………………………..………….81 2.22 Euthanasia……………………………………………………………………………….…...........81 2.23 Tissue Harvest and Processing…………………………………………………...…….…...82 2.24 Deparaffinization of the Sections……………………………………………….…………..82 2.25 Staining of the Sections……………………………………………………………….…….….83 2.25.1 H&E Staining……………………………………………………………………….............83 2.25.2 Verhoeff-Van-Gieson (VVG) Staining………………………………..……............83 2.25.3 Trichrome Staining…………………………………………………………..……...........84 2.26 Histomorphometric Analysis………………………………………………...….…………..85 2.27 Immunohistochemistry……………………………………………………………..………….85 2.28 Immunofluorescence……………………………………………..…………….……..…........86 2.29 ELISA................................................................................................................87 2.30 Statistical Analysis………………………………………………….…………………………….88 Chapter 3…………………………………………………………………………………..…………..…….…….88 3. Results………………………………………………………………………………….…………….…..…..89 3.1 Effect of Calcitriol on PCASMCs…………………………………………….…………….…..90 3.1.1 Calcitriol Increases the Expression of VDR, CYP24A1 and Decreases CYP27 B1 Expression in PCASMCs……………………………………………….………..…..90 3.1.2 Calcitriol Inhibits Fetal Bovine Serum (FBS)-induced Proliferation in PCASMCs………………………………………………………………………………….……...….94 3.1.3 Calcitriol Has no Effect on Apoptosis in PCASMCs…………………….…………94 6

3.1.4 Calcitriol Inhibits PDGF-BB-induced Proliferation in PCASMCs……..…...97 3.1.5 Downregulation of VDR Abrogates the Effect of Calcitriol on PDGF-BB- induced Proliferation PCASMCs……………………………………………..…97 3.1.6 Calcitriol Inhibits PDGF-BB-induced Migration in PCASMCs……………….100 3.1.7 Calcitriol Inhibits PDGF-BB-induced Phenotypic Modulation in PCASMCs…………………………………………………………………………………………….102 3.2 In Vivo Studies………………………………………………………………………………..….104 3.2.1 A Non-injury, Diet-induced Swine Model of Atherosclerosis……………..….104 3.2.2 Development of intimal hyperplasia following coronary intervention in hypercholesterolemic swine……………………………………………………………….….106 3.2.3 Expression of Smooth Muscle Alpha Actin (α- SMA) in Post-angioplastyNeointimal Lesions…………………………………………………….…….109 3.2.4 Decreased Expression of VDR in Post-angioplasty Neointimal Lesions……………………………………………………………………….………….109 3.2.5 Expression of TNF-α is Increased in Neointima of Post-angioplasty Coronary Arteries………………………………………………….…………112 3.2.6 TNF-α Decrease the Expression of VDR in PCASMCs…………………………..112 3.2.7 Effect of Vitamin D Deficiency on Biochemical Parameters………………......115 3.2.8 Effect of Vitamin D Deficiency on Development of Restenosis Following Balloon Angioplasty…………………………………………………………..……….118 3.2.9 Effect of Vitamin D Deficiency on Neointimal Formation and Cell Proliferation……………………………………………………………………………………….121 3.2.10 Effect of Vitamin D Supplementation on Biochemical Parameters……….124 3.2.11 Effect of Vitamin D Supplementation on Development of Restenosis Following Coronary Intervention………………………………………….…...127 3.2.12 Effect of Vitamin D Supplementation on Neointimal Formation and Cell Proliferation……………………………………………………………………………………….131 3.2.13 Effect of Vitamin D Supplementation on Serum Cytokines………………….134 Chapter 4………………………………………………………………………………………………………...…136 4. Discussion………………………………………………………………………………………..…….…..137 Chapter 5……………………………………………………………………………………………….…….…….149 5. Bibliography.………………………………………………………………………………………………150

7

List of Figures 1. Histology of a normal artery……………………………………………………………………….17 2. Pathogenesis of Atherosclerosis…………………………………………………………………..19 3. Mechanism of restenosis development following balloon angioplasty and stenting…………………………………………………………………………………………………….25 4. Metabolism of vitamin D……………………………………………………………………………48 5. A schematic representation of VDR mediated gene expression……………………...51 6. Protocol for isolation and culture of porcine coronary artery smooth muscle cells (PCASMCs)……………………………………………………………………………………………….62 7. Protocol for investigating the effect of calcitriol on the expression of VDR, vitamin D metabolizing enzymes, cell proliferation, migration and phenotypic modulation in PCASMCs…………………………………………………………………………….64 8. Protocol for development of swine model of coronary restenosis……………………76 9. Protocol to investigate the effect of vitamin status on coronary restenosis………77 10. Protocol to investigate the effect of vitamin D supplementation of coronary restenosis …………………………………………………………………………………………………78 11. Effect of calcitriol stimulation on VDR mRNA transcript and protein expression in PCASMCs………………………………………………………………………………………………91 12. Effect of calcitriol stimulation on CYP24A1 mRNA transcript and protein expression in PCASMCs……………………………………………………………………………..92 13. Effect of calcitriol stimulation on CYP27B1 mRNA transcript and protein expression in PCASMCs……………………………………………………………………………..93 14. Effect of calcitriol on serum-induce proliferation in PCASMCs……………………….95 15. Effect of calcitriol on cell apoptosis in PCASMCs……………………………………….....96 16. Effect of calcitriol on PDGF-BB-induced proliferation in PCASMCs………………..98 17. Effect of calcitriol on PDGF-BB-induced proliferation in VDR knockdown PCASMCs………………………………………………………………………………………………….99

8

18. Effect of calcitriol on PDGF-BB induced migration in PCASMCs…………………..101 19. Effect of calcitriol on phenotypic modulation in PCASMCs…………………...........103 20. Cross section of circumflex coronary artery of hypercholesterolemic Yucatan microswine…………………………………………………………………………………………......105 21. Effect of balloon angioplasty on the development of intimal hyperplasia……….107 22. Development of intimal hyperplasia following balloon angioplasty……………....108 23. Immunofluorescence of α-SMA expression in post balloon angioplasty coronary artery ………………………………………………………………………………………………….….110 24. Immunofluorescence of VDR expression in post-balloon angioplasty left circumflex (LCX) coronary arteries…………………………………………………………….111 25. Expression of TNF-α in post-angioplasty coronary arteries……………………….…113 26. Effect of TNF- α on VDR expression in PCASMCs…………………………………..…..114 27. The effects of vitamin D-deficient- and vitamin D-sufficient- high cholesterol diets on serum 25-hydroxy vitamin D, serum calcium, and serum C - reactive protein levels of the female Yucatan MiniSwine following 12 months of administration of the diet………………………………………………………………………….116 28. Effects of vitamin D-deficient- and vitamin D-sufficient- high cholesterol and diet on total serum cholesterol, low density lipoprotein (LDL), and high density lipoprotein (HDL) levels of the female Yucatan MiniSwine following 12 months of administration of the diet.....................................................................................117 29. Pre-and post-angioplasty angiograms of right swine coronary arteries……….…119 30. Effect of vitamin D deficiency on development of restenosis following balloon angioplasty………………………………………………………………………………………….…..120 31. Immunofluorescence of α-SMA expression in post balloon angioplasty coronary arteries of vitamin D-deficient hypercholesterolemic and vitamin D-sufficient hypercholesterolemic swine…………………………………………………………………..….122 32. Effect of vitamin D-deficiency on VSMC proliferation after angioplasty………...123

9

33. Effects of experimental diets on serum 25-hydroxy vitamin D, serum calcium, and serum C - reactive protein levels of the female Yucatan MiniSwine following 12 months of administration of the diet………………………………………………….…..125 34. Effects of experimental diets on total serum cholesterol, low density lipoprotein (LDL), and high density lipoprotein (HDL) levels of the female Yucatan microswine following 12 months of administration of the diet………………..…….126 35. Pre and post-angioplasty angiograms of right swine coronary arteries…..………128 36. OCT examination of six months post intervention porcine coronary arteries……………………………………………………………………………………………….……129 37. Effect of vitamin D supplementation on development of restenosis following balloon angioplasty…………………………………………………………………………………..130 38. Immunofluorescence of α-SMA expression in post balloon angioplasty coronary arteries of vitamin D-deficient hypercholesterolemic and vitamin D-sufficient+ oral vitamin D supplemental hypercholesterolemic swine…………………………….132 39. Effect of vitamin D supplementation on VSMC proliferation after balloon angioplasty……………………………………………………………………………………………….133 40. Effect of vitamin D on serum cytokine expression………………………………………..135

10

List of Abbreviations ANOVA (Analysis of Variance) APC (Antigen Presenting Cell) BrdU (Bromodeoxyuridine) BSA (Bovine Serum Albumin) CABG (Coronary Artery Bypass Graft) DAB (3, 3’-diaminobenzidine) DAPI (4’, 6-diamindino-2-phenylindole) ECM (Extracellular Matrix) ELISA (Enzyme-linked Immuno-Sorbent Assay) FBS (Fetal Bovine Serum) FITC (Fluorescein isothiocyanate) HDL (High Density Lipoprotein) H&E (Hematoxylin and Eosin) IL-6 (Interleukin-6) IL-10 (Interleukin-10) IL-12 (Interleukin-12) IL-18 (Interleukin-18) 11

IFN-γ (Interferon Gamma) IEL (Internal Elastic Lamina) LAD (Left Anterior Descending Artery) LDL (Low Density Lipoprotein) MCP-1 (Monocyte Chemoattractant Protein-1) MMP (Matrix Metalloproteinase) mRNA (Messenger RNA) NF-kB (Nuclear factor kappa beta) PBS (Phosphate Buffer Saline) PCASMC (Porcine Coronary Artery Smooth Muscle cell) PCNA (Proliferating Cell Nuclear Antigen) PCR (Polymerase Chain Reaction) PDGF (Platelet Derived Growth Factor) PTCA (Percutaneous Transluminal Coronary Angioplasty) RCA (Right Coronary Artery) RT-PCR (Reverse –Transcriptase Polymerase Chain Reaction) RXR (Retinoic X Receptor) Th1 (T-helper type 1) 12

Th2 (T-helper type 2) TNF-α (Tumor Necrosis Factor Alpha) VDR (Vitamin D Receptor) VSMC (Vascular Smooth Muscle cell)

13

Chapter 1 Introduction

14

1. Introduction 1.1 Atherosclerosis Atherosclerosis is the leading cause of disability and death worldwide [1,2]. It is a complex, multifactorial phenomenon that involves several cell types and characterized by the accumulation of lipids and fibrous elements in the large arteries [3-5]. Atheroma (atherosclerotic lesion) is made up of connective-tissue elements, lipids, debris, bloodborne inflammatory and immune cells, and vascular smooth muscle cells (VSMCs) and endothelial cells [6,7]. Foam cells (lipid-laden macrophages) and extracellular lipid droplets form the core region of the atheroma that is surrounded by cap of VSMCs and collagen-rich matrix [6]. Earliest stage of atherosclerotic lesion (atheroma) is fatty streak, an accumulation of lipid-laden monocytes, macrophages and some T cells beneath the endothelium [6]. Although, flow-limiting stenosis can cause ischemic clinical complications in atherosclerosis, the most rigorous clinical event follows the sudden thrombotic occlusion of the artery due to rupture of mature plaques (atheroma). The basic cellular composition and architecture of blood vessels are the same throughout the cardiovascular system. However, vasculature may vary at certain anatomical locations as per distinct functional requirements. The basic components of all blood vessels are endothelial cells, VSMCs, and extracellular matrix (ECM) including collagen, elastin, and glycosaminoglycans. Vessels, particularly large arteries, are composed of three clearly outlined concentric layers, intima, media, and adventitia (Figure 1). Endothelial monolayer is seated on basement membrane in normal intima of large arteries. All basement membranes contain type IV collagen, laminin, and heparin sulfate proteoglycans, such as perlecan, and syndecan [8,9]. Internal elastic lamina, a

15

dense elastic membrane, separates intima from media (Figure 1). The normal medial layer contains contractile VSMCs and fibroblasts [10]. The interstitial matrix in media contains types I and III collagen, various glycoproteins, including fibronectin, vitronectin, tenascin, thrombospondin, together with chondroitin sulfate proteoglycans, such as versican [11]. External of the media is adventitia. The normal adventitia consisting of connective tissue with nerve fibers, small blood vessels (vasa vasorum), and fat in loose interstitial matrix [12]. The whole spectrum of atherosclerosis develops through series of highly specific cellular and molecular events that lead to the formation and progression of atherosclerotic plaque and finally its complications. The first step in the process of atherosclerosis is injury to endothelial cell (EC), with resultant EC dysfunction [13]. The normal, healthy endothelium regulates vascular tone and structure and exerts anticoagulant, antiplatelet, and fibrinolytic properties. The maintenance of vascular tone is accomplished by the release of numerous dilator and constrictor substances by endothelium such as prostacyclin, endothelin and most importantly, nitric oxide (NO) [14]. The response of EC to injury results in decreased production of NO, increased permeability to lipoprotein and other plasma constituents [15], and adhesion of leukocytes [16]. In early atherogenic process, EC begin to express intracellular adhesion molecules (ICAM)-1 and vascular cell adhesion molecule (VCAM)-1 that binds various classes of leukocytes including monocyte and T-lymphocytes [17,18]. After adhering to EC, monocytes migrate between EC to localize in the intima where they transform in to macrophages under the influence of various chemokines, and engulf oxidized lipoprotein especially oxidized LDL [19]. Macrophages produce various cytokines such as interleukin (IL)-1, tumor necrosis factor (TNF)-α and several chemokines, including 16

Figure 1: Histology of a normal artery. Von Verhoeff-Gieson (VVG) staining of right coronary artery of Yucatan Miniswine. The wall of an artery is comprised of three major layers, the intima (I) [the innermost thin layer closest to the lumen (L)], the media (M) [the middle layer of the wall], and the adventitia (A) [the outermost layer of the wall]. The medial layer is surrounded by thin elastic tissues both internally and externally, referred as internal elastic lamina (IEL) and external elastic lamina (EEL) respectively.

17

monocytes chemotactic protein (MCP)-1, which further increase the adhesion of leukocytes [20,21]. When low density lipoproteins (LDL) become trapped in the vessel wall, they undergo oxidation and engulfed by macrophages through a scavenger receptor present on the surface of macrophages [22,23]. This process leads to the formation of lipid peroxides and facilitate the accumulation of cholesterol ester, resulting in the formation of foam cells [24,25]. The next process is the formation of fatty streak. Fatty streak initially consists of lipid-laden monocytes and foam cells together with T-lymphocytes. Later they are joined by VSMCs (Figure 2) [15]. The injury also induces ECs to become procoagulant and secrete various vasoactive substances including, cytokines and growth factors [26,27]. This inflammatory response induces the proliferation and migration of VSMCs that become intermixed with the area of inflammation and form an intermediate lesion. Continue progression of these events lead to deposition of ECM [28] and ultimately leading to the thickening of arterial wall [15]. This inflammatory process continues with further recruitment of platelets, lymphocytes and macrophages with in the lesion. The migration of VSMCs from media to the intima, their proliferation and production of ECM leads to conversion of fatty streak in to mature atheroma (Figure 2) [29,30]. As early atherosclerotic lesions (fatty streaks) progress to advanced lesion, they form a fibrous cap that isolates the lesion from the vessel lumen. Fibrous cap covers a mixture of lipid, leukocytes, and debris that forms a necrotic core. These lesions expand at their shoulders by continued adhesion and entry of leukocyte in to the lesion. In most of the patients, erosion and rupture of fibrous cap leads to the atherosclerotic complication such as myocardial infarction. Thinning and degradation of fibrous cap occurs due to continuing influx and activation of macrophages, which release matrix 18

Figure 2: Pathogenesis of Atherosclerosis: The early steps in the development of atherosclerotic lesions include adhesion of leukocytes to the activated endothelial layer, migration of the leukocytes into the intima, maturation of monocytes into macrophages, their uptake of lipid, and foam cell formation. Progression of lesions involves SMCs migration from the media to the intima, intimal SMCs proliferation, and increased synthesis of extracellular matrix macromolecules such as collagen, elastin and proteoglycans. Accumulation of lipids from dead cells in the central region of plaque leads to necrotic core formation. Thrombosis, the eventual complication of atherosclerosis, develops due to rupture of the atherosclerotic plaque. The rupture of the plaque's fibrous cap allows blood coagulation components to come into contact with tissue factors from the plaque, triggering the thrombus formation that extends into the vessel lumen, where it can obstruct the blood flow.

19

metalloproteineases (MMPs) and other proteolytic enzymes such as elastases [31]. The ultimate end point is the formation of a mature fibrous plaque. Symptoms occur when advanced lesions are complicated by plaque rupture, hemorrhage into the plaque, emboli, or thrombosis (Figure 2). To develop strategies for the prevention and effective therapeutic

intervention,

a

thorough

understanding

of

the

pathogenesis

of

atherosclerosis is essential.

1.2 Coronary Artery Disease Coronary artery disease (CAD), most common among cardiovascular diseases, is characterized by insufficient oxygen supply to the heart muscle which occurs due to obstruction of coronary arteries [32]. Coronary artery atherosclerosis is the principal CAD, in which atherosclerotic changes are present within the walls of the coronary arteries. Process of CAD generally begins in childhood and manifests clinically in middle to late adulthood. Smoking [33], high total cholesterol [34], hypertension [35], obesity [36] and low physical activity [37,38] are significant risk factors for coronary artery disease mortality.

1.2.1 Epidemiology of Coronary Artery Disease The CAD has been a leading cause of morbidity and mortality in developed world and predicted to remain so for the next 20 years [39]. Although, public health and medical care advances as well as life style modifications has reduced the mortality rates due to CAD over the past few decades in countries such as the United States, CAD still remains the leading cause of death in developed nations and predicted to achieve that status worldwide within decades [40,41]. CAD is responsible for more than 466,000 20

deaths annually, or one in five of all deaths in United States [42]. Overall, 12.2 million people have a history of myocardial infarction (MI), angina pectoris, or both, and each year 1.1 million people suffer a new or recurrent MI [42]. The economic impact of CAD is overwhelming. Total costs attributed to CAD are estimated at $118.2 billion annually, of which $55.2 billion are direct medical costs, mostly from hospital and nursing home use, and $63 billion are indirect costs, primarily from lost productivity from premature disability and mortality [42].

1.2.2 Coronary Artery Disease Treatment Treatment of CAD depends on the cause and severity of the disease. Treatment may include life style changes, medications, catheter-assisted procedures and surgery.

1.2.3 Medical Management The objective of medical therapy in CAD is to relieve symptoms, reduce risk factors, reduce disease progression, and reduce the likelihood of a major coronary event. Three classes of medication are essential to therapy: antihypertensive [43,44], lipidlowering [45,46] and antiplatelet agents [47,48]. Antihypertensive therapy is started with beta-blockers and angiotensin-converting enzyme inhibitors[49]. Calcium channel blockers or angiotensin receptor blockers can be used as alternatives, if these medications are not tolerated by the patient [49]. Statins (lipid-lowering drugs) have shown clear benefits in morbidity and mortality in of coronary artery disease [42,50]. Lipid-lowering therapy is necessary to decrease low-density lipoprotein cholesterol to a target level of less than 100 mg/dL.

21

1.2.4 Percutaneous Coronary Intervention Use of percutaneous transluminal coronary angioplasty (PTCA) was first started in 1977 [51] and its use has grown steadily since then. In PTCA, narrowed or blocked part of the coronary artery is accessed by radiographically guided catheter with a small balloon, usually through the femoral artery. The narrowed section of artery is reached and balloon is inflated to a high pressure for a short period of time. The inflated balloon produces longitudinal and circular splits in the atheromatous plaque. The balloon is then deflated and withdrawn. Because the plaque has elastic properties, it retracts where it has split leaving the coronary artery with a wider lumen than before the procedure, but with a disrupted surface [52]. Treatment with PTCA is generally considered when medical management fails to control the symptoms [53]. Although, the most common indication for PTCA is single or double vessel disease, but the use of this procedure has now widened to treat the patients with chronic stable angina, unstable angina, coronary artery bypass graft (CABG) stenosis, or cardiogenic shock, as well as patients with asymptomatic ischemic heart disease (IHD) and those for whom CABG is considered unsuitable [54]. PTCA is a safe and effective way to treat blocked coronary arteries but postangioplasty restenosis development is a major limitation of this procedure, which occurs in 30 to 50 percent of patients [55-57]. Restenosis is defined as narrowing of a treated vessel [58], which usually occurs within 6 months after the initial procedure.

1.2.5 Angioplasty with Stenting Post-angioplasty restenosis development has led to make technical advances to improve patient outcome with the placement of small metallic spring-like devices called 22

"stents” at the site of the blockage. The implanted stent serves as a scaffold that keeps the artery open and increase blood flow to ischemic heart muscle. Incidence of restenosis is reduced to 25% in the patients treated with balloon angioplasty with stenting as compared to balloon angioplasty alone, where the incidence of restenosis is 40% [59,60]. Due to very high incidence of restenosis following balloon angioplasty, majority of patients having angioplasty today are treated with stents. However, restenosis can occur even after the use of stents, which is referred as “in-stent restenosis.” After the placement of a stent inside the blood vessel, there is growth of new tissue inside the stent and covering the stent struts. Initially, this new tissue consists of healthy cells from the arterial endothelium, which is a favorable effect because development of normal lining over the stent allows blood to flow smoothly over the stented area without clotting. However, there may be the development of scar tissue later underneath the new healthy lining. This growth of scar tissue underneath the lining of the artery may be so thick in about 25% patients that it can cause significant blockage of blood flow. Development of in-stent restenosis typically occurs in 3 to 6 months after the procedure; after 12 months have passed uneventfully, restenosis is rare.

1.2.6 Drug Eluting Stents To prevent in-stent restenosis, a breakthrough occurred to interventional cardiology in the form of new generation of drug eluting stents. These stents are coated with special drugs on their surface that prevents the development of scar tissue growth in the artery where the stent is placed, and therefore significantly reduce the occurrence

23

of in-stent restenosis. Many large randomized clinical trials using drug eluting stents have shown a remarkable reduction in angiographic restenosis and target vessel revascularization when compared with bare metal stents. The process included in the pathogenesis of restenosis includes immediate vessel recoil after stretch injury, negative arterial remodeling, and neointimal hyperplasia (Figure 3) [61,62]. However, the first two pathological processes are the main cause of restenosis after balloon angioplasty, but are basically eliminated by use of stents. Thus, neointimal hyperplasia is the only major mechanism in the pathogenesis of in-stent restenosis (Figure 3) [63]. Drug eluting stents are coated with many therapeutic agents with antiproliferative and anti-inflammatory properties. The general mechanism of action for most of these drugs is to stop cell cycle progression by inhibiting DNA synthesis. Primarily there are two types of drug eluting stent being used in the treatment of CAD, sirolimus-eluting stent and paclitaxel-eluting stent. Sirolimus (rapamycin), a fermentation product of Streptomyces hygroscopicus, was discovered as an antifungal macrolide antibiotic with potent immunosuppressive properties [64,65]. Due to lipophilic properties of sirolimus, it readily diffuses across the cell membranes of leukocytes and VSMCs and binds to a specific intracellular protein (FKBP12) with high affinity. The resultant complex inhibits a regulatory enzyme called TOR (target of rapamycin), ultimately blocking cell cycle progression from G1 to S phase, and therefore inhibits smooth muscle proliferation [64,65]. Paclitaxel is an antineoplastic agent that was first isolated from the bark of the Pacific yew tree, Taxus brevifolia [66,67]. Initially it was used for the treatment of breast and ovarian cancer. It is also a lipophilic molecule that readily diffuses across cell 24

Figure 3: Mechanism of restenosis development following balloon angioplasty and stenting. Following angioplasty there is dissection of both the intima of the plaque and the vessel media, associated with an enlargement of the treated segment. Early lumen loss occurs due to elastic recoil of the vessel. Development of neointima due to proliferation and migration of VSMCs leads to late lumen loss. Negative remodeling occurs due to the injury to both the media and adventitia resulting in cell proliferation and collagen synthesis, expanding the adventitia. Subsequent maturation of collagen is associated with contraction leading to overall vessel shrinkage. Stents prevent elastic recoil and negative remodeling.

25

membranes and has a potent microtubule stabilizing effect [66,67]. Stabilization of microtubule inhibits the mitosis of smooth muscle cells because microtubule disassembly is essential for the progression of the G2 to M phase in the mitotic cell cycle. This inhibits the proliferation of smooth muscle cells at the site of injury caused by stent. Both of these stents have been used however, the superiority of one of these stents in the treatment of CAD is still debatable. A study comparing sirolimus- and paclitaxel-eluting coronary stents has shown that there is no difference in the rates of restenosis or major adverse cardiac events between sirolimus-eluting versus paclitaxeleluting coronary stents [68]. On the other hand, another study has shown that in the treatment of chronic total occlusion, implantation of sirolimus eluting stent has more favorable outcomes regarding restenosis and clinical events, compared with paclitaxel eluting stents [69]. A study in patients with diabetes mellitus and CAD has shown that use of the sirolimus-eluting stent is associated with a decrease in the extent of late luminal loss, as compared with use of the paclitaxel-eluting stent, suggesting a reduced risk of restenosis [70]. Despite all these benefits, the safety of drug eluting stents has been called in to question by recent studies which suggest that DES may engender adverse arterial responses, including delayed endothelialization and hypersensitivity to the polymeric coating that regulates drug dose and release kinetics [71-74]. Endothelial cell function is crucial for post-intervention healing of damaged endothelium. Sirolimus delays reendothelialization by inhibiting the proliferation and migration of coronary endothelial cells, inducing apoptosis of endothelial progenitor cells and decreasing vascular endothelial growth factor expression in circulation [75]. Similarly, paclitaxel also delays 26

re-enothelialization at damaged site by inhibiting endothelial cell adhesion and migration [76]. Recent reports from randomized trials and observational studies have also suggested that drug eluting stents may be associated with increased risk of late stent thrombosis, as compared with bare-metal stents, which is a potentially fatal complication [77-79]. Long-term use of dual antiplatelet therapy with a thienopyridine (ticlopidine or clopidogrel) and aspirin is used to reduce the risk of late stent thrombosis and complications (myocardial infarction [MI] and death) after placement of drug eluting stents [80]. Anti-platelet therapy may protect against the risk of late stent thrombosis but the optimal treatment strategy is currently unclear.

1.2.7 Coronary Artery Bypass Grafting Coronary artery bypass grafting (CABG) is a surgical technique used for the treatment of critical obstructions in coronary arteries caused by atherosclerotic plaques. During CABG procedure, new conduits are created to bypass the obstruction by the use of either saphenous vein harvested from leg, internal mammary artery or portion of radial artery harvested from the arm. This grafted vessel bypasses the blocked diseased portion of the coronary artery and makes a new path for the blood flow to the myocardium. Although, CABG can provide relief from the symptoms and prolong life, but there is significant risk of initial surgical morbidity and mortality associated with this procedure. CABG also requires surgical centers with specialized staff and facilities and period of convalescence after procedure is substantial. These disadvantages of CABG has prompted percutaneous revascularization using stents to become the most frequently used method to treat coronary artery occlusive disease of almost any severity.

27

However, use of stent has not prevented the development of restenosis. Restenosis may be clinically unrecognized in as many as half of cases. Thus, percutaneous coronary intervention with stenting could be associated with a reduced long term survival, due to the increased risks of subsequent need for revascularization procedures. Several studies have examined the cardiac-related clinical outcomes after CABG or stenting in CAD. A study by Damen et. al, has shown that

percutaneous coronary intervention with

stenting was associated with a long-term safety profile similar to that of CABG. However, as a result of persistently lower repeat revascularization rates in the CABG patients, overall major adverse cardiac and cerebrovascular event rates were significantly lower in the CABG group at 5 years [81]. A recent study by Malenka et. al, indicated that in contemporary practice, survival for patients with 3-vessel coronary disease is better after CABG than percutaneous coronary intervention. This observation should be carefully considered when deciding the revascularization strategy [82]. On the other hand, another study indicated that CABG has a higher periprocedural mortality rate than did percutaneous coronary intervention with stenting. However, after 2.5 years, the survival advantage of stenting was is no longer evident suggesting that there is no intermediate-term survival advantage of CABG over stenting in patients who have multivessel disease with lesions that can be treated percutaneously [83].

Another

studying comparing CABG and percutaneous coronary intervention with stenting has shown that compared to PCI, CABG was more effective in relieving angina and led to fewer repeated revascularizations but had a higher risk for procedural stroke. Survival to 10 years was similar for both procedures [84]. Therefore, no current treatment strategy for CAD is free from risk and associated complications.

28

1.3 Intimal Hyperplasia and Restenosis Intimal hyperplasia (thickening of inner layer of a vessel) occurs due to increased numbers of cells, primarily VSMCs, within the intimal layer of arterial wall [85,86]. Restenosis following coronary intervention, especially coronary stenting, is primarily caused by intimal hyperplasia and extracellular matrix deposition [62].

1.3.1 Pathophysiology of Restenosis Restenosis after percutaneous intervention reflects a cascade of molecular and cellular events within the vascular wall and characterized by platelet aggregation, release of growth factors, inflammatory cell infiltration, medial smooth muscle cell proliferation and migration, and extracellular matrix remodeling [87]. Acute occlusion of the vessel after percutaneous coronary intervention within hours to days occurs due to elastic recoil of overstretched vessel, thrombus formation, subintimal hemorrhage extending into the media, or intimal flap formation. However, the use of intravascular stents and aggressive anticoagulation therapy has significantly reduced the incidence of acute occlusion after percutaneous intervention during periprocedural period, but still the overall

rate of restenosis with bare-metal stents and drug eluting stent is

approximately 20% and 10% respectively [88,89]. Reports from human postmortem studies and animal models of coronary restenosis have shown that intimal hyperplasia mechanism is similar to the process of wound healing [90]. The process of wound healing can be divided to in to three phases including inflammatory phase (hours to days), proliferation phase (days to weeks), and extracellular remodeling phase (months) [90,91]. After percutaneous intervention, there 29

is deposition of platelets at the site of injury that release platelet derived growth factor (PDGF) and other mitogenic growth factors that penetrate the vessel wall and activate proliferation and migration of medial VSMC [92]. The platelets also initiate inflammatory response by releasing the chemokines. Almost 90% of the intimal proliferation develops over the first 2 weeks after injury. Endothelial denudation and medial wall injury following balloon- and/or stent-induced injury plays a crucial role in the development of restenosis as these are the vital trigger of the wound “healing” program. A normal functioning endothelium promotes vasodilatation and suppresses intimal hyperplasia by inhibiting thrombus formation, inflammation, and smooth muscle proliferation and migration. The endothelium also provides a selectively permeable barrier that protects against circulating growth factors [87]. When the endothelium is injured, endothelial cells release inflammatory mediators that trigger aggregation of platelet, fibrin deposition and recruitment of leukocytes to injury site [93,94]. Secretion of growth factors and cytokines by both platelets and leukocytes promote VSMCs migration from media to intima [95]. VSMCs proliferate in intima and deposit extracellular matrix, leading to intimal hyperplasia. VSMCs play pivotal roles in the restenosis development after percutaneous coronary

intervention.

VSMCs

retain

remarkable

plasticity

during

postnatal

development and have capacity to undergo dedifferentiation to a synthetic phenotype [96]. Synthetic and contractile smooth muscle cells differ in morphology, smooth muscle cell marker gene expression, proliferation and migratory potential. Contractile phenotype has elongated, spindle shape morphology whereas synthetic phenotype has rhomboid cobblestone morphology [97,98]. The contractile filaments in contractile

30

smooth muscle cells are largely replaced by protein synthesizing organelles in synthetic smooth muscle cells. Moreover, synthetic smooth muscle cells have higher growth rate and migratory activity compared to contractile smooth muscle cells [97]. Although, this represents a survival advantage as it enables these cells to efficiently repair after injuries. But at the same time, it may be disadvantageous in that it increases the risk for abnormal responses after injury, possibly contributing to restenosis. The increased stimulatory growth factors and cytokines such as PDGF, IL-1, IL-6, and TNF-α and reduced inhibitory factors from endothelial cells (nitric oxide, heparin sulfate proteoglycan) activate normal quiescent VSMCs within vessel medial layer to proliferate and migrate. Some of the VSMCs in neointimal thickening may also originate from migration and differentiation of adventitial fibroblasts into myofibroblasts [99,100]. Over a period of several months after angioplasty, the neointima increases, and the additional neointimal volume contains VSMCs and extracellular matrix. The increase in extracellular matrix is due in part to an increase in collagen deposition [101] and reduced collagen turnover [102]. Recent studies in models of post-angioplasty restenosis, graft vasculopathy, and hyperlipidemia-induced atherosclerosis have proposed a new concept that neointimal formation not only depends on the proliferation and migration of local VSMCs, but smooth muscle progenitor cells are mobilized from the bone marrow and hone to sites of vascular injury where they differentiate into smooth muscle cells [103,104]. However, this concept is still controversial and needs additional studies to define the role of bone marrow progenitor cells in the pathogenesis of fibroproliferative vascular diseases.

31

1.4

Vascular Smooth Muscle Cell in Atherosclerosis and Restenosis VSMCs are the stromal cells of the vascular wall that are involved in all the

physiological functions and the pathological changes taking place in the vascular wall. These cells are constantly exposed to mechanical signals and biochemical components generated in the blood compartment. Due to their contractile function, VSMCs of resistance vessels contribute in the regulation of blood pressure. However, the exact role of VSMCs in the pathogenesis of atherosclerosis is still not known [105,106]. In the early stages of atherosclerotic process in humans, VSMCs may contribute to atheroma development through the production of pro-inflammatory mediators such as monocyte chemoattractant protein (MCP) - 1 and vascular cell adhesion molecule, and through the synthesis of matrix molecules required for the retention of lipoproteins [106]. Another important role of VSMCs is to maintain the stability of atherosclerotic plaque through the formation of fibrous cap. Indeed, there is evidence to show that in lipid-laden lesions in which fibrous cap is thin, there is VSMCs apoptosis associated with inflammation [107]. Additionally, the fibrous cap can also be rendered weak and become further susceptible to rupture due increased expression of collagenase and inhibition of expression of proteolytic inhibitors by local inflammatory milieu [105,108]. In advanced lesions, VSMCs along with fibroblasts and extracellular calcification form a fibrocalcific plaque. In the process of restenosis, VSMCs progress through DNA replication and mitosis in a regulated series of cell-cycle events. Quiescent VSMCs, which are maintained in a non-proliferative phase (G0) under normal conditions, enter a gap phase (G1) after injury, at which time factors necessary for DNA replication in the

32

subsequent synthetic phase (S) are produced [109]. After S phase, the cells enter another gap phase (G2), when proteins are synthesized for mitosis (M phase). The orderly progression of cell cycle is ensured by restriction points (R) at the G1-to-S and G2-to-M junctions [109]. Stimulation of VSMCs with growth factors, such as PDGF, causes these cells to enter the cell cycle and propel them to reach the R point in the late G1 phase. Further progression of cell cycle from the G2 phase to the M phase does not require further growth factor stimulation. Growth factors trigger cell cycle entry by binding to their respective cell surface tyrosine kinase receptors and transactivating nuclear factors such as c-fos and c-myc [110]. These nuclear factors act as transcriptional factors and increase the expression of various cell cycle regulatory proteins. VSMCs in normal healthy vessel are non-migratory due to several factors including the relative absence of stimulatory factors and because the matrix is highly adhesive [111]. There are many pro- and anti-migratory molecules including cytokines, growth factors and extracellular matrix components [111]. In the process of restenosis development, these chemotactic and mitogenic factors induce migration of VSMCs from media to intima by remodeling of the cytoskeleton, changing adhesiveness of the smooth muscle cell to the matrix, and activating motor proteins.

1.5

Smooth Muscle Cell Phenotypic Modulation and Restenosis Several growth factors including PDGF, fibroblast growth factor (FGF), and

insulin like growth factor 1(IGF-1) play a major role in restenosis development [112,113]. Among these growth factors, it is widely accepted that PDGF, acting on the PDGFRβ on 33

the VSMCs in the media, is the main offender [112]. PDGF derived from the aggregating platelets and from the VSMCs themselves, acts both as a chemoattractant and a proliferating agent and is responsible for the migration of the VSMCs and the formation of the neointima [112]. VSMCs have a unique characteristic in their ability to modulate VSMC phenotype in response to both physiological and pathological environmental stimulus [114]. In mature blood vessels, VSMCs express unique smooth muscle-specific genes such as smooth muscle α-actin, smoothelin, calponin and smooth muscle myosin heavy chain that serve as markers of “contractile” differentiated phenotype [114-116]. In the event of vascular injury or growth factor stimulation, VSMCs dedifferentiate and the expressions of smooth muscle-specific contractile proteins are downregulated [115,116]. Dedifferentiation process allows VSMCs to proliferate and migrate [114,116]. Phenotypic switching of VSMCs is mediated by several humoral factors including platelet derived growth factor-BB (PDGF-BB) [117,118].

1.6 Platelet derived Growth factor (PDGF) Platelet-derived growth factors (PDGFs) were discovered about two decades ago. Initially, PDGF was recognized as a component of whole blood serum that was absent in cell-free plasma-derived serum [119,120]. Subsequently, PDGF was purified from human platelets [121,122]. Although, the major storage site for PDGF is α-granules of platelets, but number of different other cell types can also synthesize PDGF. The PDGF family contains four polypeptide chains encoded by four different genes: PDGF-A, PDGF-B, PDGF-C and PDGF-D [123]. The classical PDGF chains, PDGF-A and PDGF-B were discovered more than two decades ago, and PDGF-C and PDGF-D are recent 34

additions to the family [124-126]. In its active form, PDGF is a disulfide-bound dimer of two monomers, and all dimeric combinations (PDGF-AA, PDGF-AB, PDGF-BB, PDGFCC, PDGF-DD) exist naturally [123,127-129]. However, heterodimers involving PDGF-C and PDGF-D chains have not been reported [123]. PDGF is synthesized by many different cells including fibroblast [130,131], keratinocytes [132], VSMCs [131,133], astrocytes [134], skeletal myoblast [135], mammary epithelial cells [136], macrophages [131,137], and platelets/megakaryocytes [131,138]. External stimuli such as, thrombin [139,140], low oxygen tension [141], or stimulation of different growth factors significantly increase the synthesis of PDGF [142]. Both A-and B- chains are synthesized in most tissues expressing PDGF but there is independent regulation of expression of two chains both at the transcriptional and posttranscriptional level [143].

1.6.1 Platelet derived growth factor receptor The effect of PDGF isoforms on target cells is exerted by activating two structurally-related protein tyrosine kinase receptors PDGFRα and PDGFβ. The molecular size of α- and β-receptors is of ∼170 and 180 kDa respectively. The gene for αreceptor gene is localized on chromosome 4q12 [144], and the β-receptor gene is on chromosome 5 [145]. The affinities of individual PDGF chains are different for two receptors. PDGFRα has high affinity for PDGF-A, -B, and -C, whereas PDGFRβ has high affinity for PDGF-B and -D. In vitro studies have confirmed these interactions, but it is not known if they are effective in vivo [146]. Because PDGF isoforms are dimeric molecules, they bind two receptors simultaneously and thus induce receptor

35

dimerization [147,148] which leads to intrinsic tyrosine kinase domain activation and subsequent recruitment of SH-2-domain-containing signaling proteins [149]. Finally, activation of downstream signaling pathways leads to cellular responses, like migration and proliferation. Because of the differences between α- and β-receptors in their binding specificity of different PDGF isoforms and in the signals they transduce, the response of a cell to PDGF stimulation is determined by which of the two receptors types are expressed on the cell. Fibroblast and smooth muscle cells, the classical target cells of PDGF, express both α and β-receptors, but the expression of β-receptors is generally higher [150]. Other cell types, such as human platelets [151], and rat liver endothelial cells [152], express only α-receptors, whereas certain cell express only β-receptors, such as mouse capillary endothelial cells [153]. However, the expression of PDGF receptor on cells is not constant. For instance, the expression of both α- and β-receptors is increased in mouse uterus and vagina by estrogen treatment [154]. The expression of β-receptors on connective tissue cells in vivo is increased during inflammation [155]. The stimulation of VSMCs [156] and bronchial smooth muscle cells [157] by basic FGF selectively increases the expression of the α-receptor, but not the β-receptors. The stimulation of fibroblasts or mesothelial cells by transforming growth factor (TGF)-β increases α-receptor expression [158,159].

1.6.2 Role of PDGF in vascular disease The role of PDGF has been implicated in wide variety of disease. Broadly, these diseases can be divided into three groups: vascular diseases, tumors, and fibroses. However, these groups are not definitive and pathogenic processes associated with 36

PDGF can overlap in various diseases. In general, PDGF promotes vessel wall pathologies by acting on VSMCs [160]. Atherosclerotic lesions express increased levels of all PDGF forms in particular A and B, as compared to the normal vessel wall [161]. Receptors for PDGF-α and PDGF-β are also increased in VSMCs of atherosclerotic vessels. However, the mechanism responsible for increased PDGF and PDGFR expression in atherosclerotic lesions has not been elucidated yet. The expression of PDGF or PDGFR is affected by several conditions associated with cardiovascular disease. Increased blood pressure and α-adrenergic stimulation of vessel increase vascular PDGF-A expression [162,163]. Hypercholesterolemia can also significantly increase PDGF-A and PDGF-B expression in circulating mononuclear cells [164]. In the response-to-injury hypothesis of atherosclerosis pathogenesis, aggregating platelets at the site of endothelial injury release PDGF, which would then stimulate the migration of VSMCs from media to intima as well as the proliferation of VSMCs at this site [165]. Indeed, the administration of several PDGF pathway inhibitors, including neutralizing PDGF (AB) antibodies [166,167], PDGF-B aptamers [168], PDGF kinase inhibitors [169,170], and PDGFR-neutralizing antibodies [171,172] decrease the accumulation of VSMCs in neointima in animal models of acute arterial injury by catheterization. PDGFR-blocking kinase inhibitors also decrease restenosis following angioplasty of atherosclerotic vessels in minipigs [173]. Atherosclerotic lesions are inhibited by a PDGFR blocking kinase inhibitor [174] and PDGFR-β neutralizing antibodies [175] in ApoE- deficient mice. The proliferation of VSMCs and consequently intimal thickening is increase with infusion of PDGF-B or local transfection of a PDGF-B expression vector in different arterial injury models [118,176]. Uses of genetic models of

37

PDGF-B or PDGFR-β deficiency have supported the functional role of PDGF-B and PDGFR-β in various aspects of atherosclerosis and neointimal proliferative responses. Ligation of carotids arteries in pdgfrb+/+ and pdgfrb−/− mouse chimeras, a lower proportion of pdgfrb−/− cells are present in the neointimal growth compared to the media. This suggests that migration of VSMCs from media to intima is diminished in the absence of functional PDGFR-β [177]. Studies of low density lipoprotein receptorrelated protein (LRP)-1 remarkably supported the important role of PDGF-BB, PDGFRβ in VSMC migration and proliferation and in the pathogenesis of atherosclerosis [178]. LRP1 is a multifunctional transmembrane receptor, which binds various arrays of biological ligands and is expressed in diverse cell types [179,180]. Data from studies suggest that there is a molecular interaction between PDGFR-β and LRP1, as well as PDGFR-β-dependent tyrosine phosphorylation of LRP1 [181-183]. Data from the in vitro studies also suggest that binding of ApoE to LRP1 inhibits PDGF-BB-induced phosphorylation of LRP1 and PDGF-BB-dependent proliferation and migration of VSMCs. Atherosclerotic response is significantly increased in VSMC-specific knockout of LRP1 in an LDL receptor-deficient background [184]. This response was associated with significant increase in PDGFR-β expression and autophosphorylation of VSMCs. Therefore, LRP1 has an atheroprotective role, which is mediated through suppression of function and expression of PDGFR-β in VSMCs. Thus, the above mentioned studies suggest that PDGF-BB, which stimulates PDGFR-β, is one the most potent chemoattractants and mitogen for VSMCs. A multitude of biological processes are initiated by PDGF-BB through activation of mitogen-activated protein kinases(MAPK), including extracellular signal-regulated

38

kinase (ERK), c-Jun NH2-terminal kinase (JNK), Akt and p38 MAPK (p38) that contribute to proliferation, migration and extracellular matrix synthesis (ECM) of VSMC.

1.7 Role of Inflammatory Cytokines in Restenosis Several studies have examined the role of inflammation in the development of restenosis after percutaneous coronary interventions [185,186]. These studies suggest that vascular injury due to percutaneous interventions activates inflammatory reactions and vascular response to injury leads to the development of intimal hyperplasia. This inflammatory reaction is even more prominent in the atherosclerotic plaque lesions, which already have activated inflammatory cells. Dilatation of arterial wall by balloon incites endothelial denudation and deposition of a layer of platelet and fibrin at the injury site [185]. Adhesion molecules mediate local platelet/platelet, platelet/leukocyte and leukocyte/endothelial cell complex formations [187,188]. The migration of leukocytes across the platelet-fibrin layer into tissue is enhanced by activated cytokines. Inflammatory cytokines have also been implicated in playing a significant role in restenosis following PTCA by inducing inflammation, cell proliferation, and apoptosis. These inflammatory cytokines are produced by macrophages, VSMCs and endothelial cells [189-191]. Interferon (IFN)-γ, a key proinflammatory cytokine, coordinates a diverse array of cellular programs through transcriptional regulation of immunologically relevant genes. Initially, it was believed that IFN-γ is exclusively produced by CD4+ T helper cell type 1 (Th1) lymphocytes, CD8+ cytotoxic lymphocytes, and NK cells [192,193], but

39

recent studies have shown that other cells, such as natural killer cells, B cells, and antigen-presenting cells (APCs) secrete IFN-γ [194-197]. Production of IFN-γ by APCs acts locally and plays an important role in the cell-self activation and activation of nearby cells [195,198]. Secretion of IFN-γ by APCs and NK cells plays an important role in early host defense again infections, while in the adaptive response T lymphocyte is the major source of IFN-γ [195,199]. Cytokines secreted by APCs, particularly interleukin (IL)-12 and IL-18, control the production of IFN-γ in the innate immune response in response to an infection [200-202]. Recognition of pathogens by macrophages induce the secretion of IL-12 and certain chemokines, such as macrophage-inflammatory protein (MIP)-1α, which draw NK cells to the site of inflammation, and IL-12 promotes IFN-γ synthesis in these cells [203,204]. Production of IFN-γ is further increased by stimulation of macrophages, NK, and T cells in combination with IL-12 and IL-18 [201,205-207]. The negative regulation of IFN-γ production is mediated by IL-4, IL-10, TGF-β, and glucocorticoids [199,202,205,206,208]. Immunohistochemical studies have revealed that atherosclerotic lesions, a chronic inflammatory vascular response, express very high levels of IFN- γ [209]. The overall effect of IFN-γ on the disease progression is complex as it acts on all the major cell types in plaques. Expression of IFN- γ is induced by the proatherogenic Th1 cells in the plaque region [209-212]. Recent studies have shown that cells in restenotic coronary lesions express many genes that activate IFN-γ signaling in neointimal VSMCs. Furthermore, genetic disruption of IFN-γ in a mouse model of restenosis significantly reduced the vascular proliferative response [213]. Thus, it is assumed that IFN-γ plays a significant role in controlling tissue proliferation during neointimal formation.

40

TNF-α, a proinflammatory cytokine, is crucially involved in the pathogenesis and progression of atherosclerosis [214,215]. It is secreted by a number of cells, including macrophages, neutrophils, endothelial cells, and VSMCs [216] and has been identified as a potent stimulator of plasminogen activator inhibitor-1 [217] and numerous matrix metalloproteinase (MMPs) [218,219]. Data from clinical and preclinical studies indicate that TNF-α plays an important role in restenosis [220]. Tissue levels of TNF-α level are 100,000-fold over baseline after balloon angioplasty in femoral artery of a rabbit atherosclerotic model [221]. Studies show that arterial TNF-α mRNA expression is upregulated in a mouse model of reactive stenosis [216]. Moreover, TNF-α is released during stent implantation into saphenous vein aortocoronary bypass grafts [222]. The interleukin (IL) -6 is a cytokine shown to contribute to both development and destabilization of atherosclerotic plaque via several mechanisms including the release of other pro-inflammatory cytokines, stimulation of acute phase protein, oxidation of lipoproteins by phospholipases, activation of MMPs, and the release of prothrombotic mediators [223]. Furthermore, IL-6 is regulated by the reactive oxygen species (ROS) generated by vascular enzyme systems demonstrating a cross talk between IL-6 and various vasoactive substances, such as angiotensin (ANG) II [224,225]. IL-6 is produced locally by cells in the atherosclerotic lesion or released into the circulation [108,226,227] and can augment atherosclerosis by exerting several detrimental effects. IL-6 perpetuates vascular inflammation by activating inflammatory cells as well as promoting endothelial dysfunction, proliferation and migration of VSMCs [228]. Moreover, IL-6 has been shown to promote the formation of macrophage-derived foam cells by altering the local expression of the scavenger

41

receptors SR-A and CD36 that are involved in the uptake of modified LDL, and a hallmark of early and advanced atherosclerotic lesion formation [229-232]. Studies have shown that IL-6 also acts as an ensuing marker for restenosis. Post-procedure IL-6 concentration is increased in patients with restenosis following coronary angioplasty suggesting IL-6 may be a predictive marker of restenosis development [233]. Another recent study has shown that serum concentration of IL-6 correlates with lumen loss and the severity of stenosis in patients with myocardial infarction treated with PCI with stent implantation [234]. Interleukin (IL)-10, a prototypical anti-inflammatory cytokine, has a potential role in the modulation of atherosclerotic process as well. IL-10 modulates many cellular processes that may interfere with the development and stability of the atherosclerotic plaque. IL-10 has strong deactivating properties in macrophages and T cells and is associated with decreased signs of inflammation expressed in human atherosclerotic plaques [235]. IL-10 also inhibits Th1 immune responses by downregulation of IL-12 production which would normally be associated with IL-2 and IFN-γ expression and with T-cell and macrophage activation [236,237]. The ability of IL-10 to regulate monocyte-induced matrix degradation is another potential antiatherogenic effect. IL-10 inhibits the production of certain MMPs, induces tissue inhibitor of metalloproteinase-1 expression by mononuclear cells and suppresses lysosomal enzyme release by monocytes [238]. IL-10 could also limit thrombotic complications in atherosclerosis by inhibiting the tissue factor expression by activated human monocytes [239]. IL-10deficient mice are exceedingly susceptible to atherosclerosis and atherosclerotic lesions of IL-10–deficient mice showed increased T-cell infiltration, abundant interferon-γ

42

expression, and decreased collagen content [235]. Further, in vivo, transfer of murine IL-10 significantly reduced lesion size [235]. IL-10 has also been shown to have an important role in the regulation of restenosis development. Human recombinant IL-10 (rhuIL-10) attenuates post-injury intimal hyperplasia in hypercholesterolemic rabbits after balloon angioplasty and stenting [240]. Moreover, IL-10 also reduces macrophage infiltration [240]. Therefore, IL-10 plays a pivotal role in restenosis development. Thus, if a causal relationship is established between these cytokines and restenosis, inhibition of these cytokines could have potential therapeutic implications. Additionally, these cytokines may serve as a marker for the restenosis, if elevated levels of cytokines are found in the serum of patients with restenosis.

1.8 Research Models for Coronary Artery Disease For the development of any novel treatment therapy, the preclinical safety and efficacy of the treatment molecule needs to be proven in an animal model prior to its use in clinical trials. Potentially, an animal model that replicates the pathogenesis of the disease in humans can lead to development of new treatment strategies that can be tested in humans. Over the past century, numerous animal models have been developed, but no animal model is perfect to fully replicate the complex nature of human pathological conditions. Nevertheless animal models are the key for evaluation of pathobiology of disease and testing of diagnostic technologies and interventions. Small animal models, particularly rabbit and rodents, have contributed significant insight into the molecular and cellular basis of cardiovascular biology. However, the characteristics of cardiovascular system are significantly different in small animals as compared to 43

humans. Therefore, large animal models that approximate human cardiovascular physiology, function, and anatomy, are essential to develop discoveries in to clinical therapies and interventions.

1.8.1 Swine Model of Coronary restenosis The pig is a very good model because the cardiovascular system in pig is very similar to humans and it develops spontaneous atherosclerotic lesions [241-244]. In addition, pigs coronary arteries can be directly evaluated because of their larger size rather than having to use larger central vessels in smaller animals. The pig heart has similar anatomy to humans except for the presence of the left azygous (hemiazygous) vein, which drains the intercostal system into the coronary sinus [245]. Both anatomy and function of pig coronary artery system and aorta are similar to humans. However, pig blood vessels require careful handling because they are more friable and prone to develop vasospasm. In regards to hemodynamics, physiological cardiac function as well as mechanically induced myocardial infraction, wound healing process, and reperfusion induced arrythmogenic activity is also comparable to humans [246]. Atherosclerosis in pigs can occur spontaneously by regular chow intake and induced by experimental atherogenic diet [247-249]. Experimental diet can induce hypercholesterolemia and atherosclerotic lesions in pigs by increasing plasma cholesterol levels similar to those in humans. A study by Casani et. al, showed that after a 50-day period of standard hypercholesterolemic diet, pigs developed early atherosclerotic lesions localized in the abdominal aorta and also in the coronary arteries to a lesser extent [249]. Composition of these lesions was similar to early human atherosclerotic lesions [249]. Increasing the 44

duration of diet in these animals was associated with greater degree of lesion severity in these animals [249]. Moreover, if allowed to develop over time, both atherosclerotic plaque distribution and composition (lipid, fibrinogen, smooth muscle cells, and macrophage content) [249] follows a pattern comparable to that of humans [250-252]. Lipoprotein metabolism in pigs is also similar to humans and may explain, in part, the above mentioned similarities [253]. To get the atherosclerotic models of higher human resemblance, animals are kept on atherogenic diets for long periods of time. But the management of these animals is difficult because of their substantially high weight [254]. The miniature pig are being increasingly used to over-come the size and weightrelated problems. Indeed, the use of miniature pigs is preferable over domestic pigs as animal models because of their small body size and also their slower growth rate allows them to maintain size and weight throughout adulthood. Unlike other animal models, after slow occlusion of the coronary vessels induced by both atherogenic diet and balloon injury, pigs develop the coronary artery restenosis similar to that of humans [250,251,255]. In addition, the amount of neointimal thickening is directly proportional to injury thereby permitting the creation of an injury-response regression relationship that can be used in the quantification of response to potential therapeutic interventions [256,257]. Cardiac catheterization techniques in the pigs are similar to the techniques used in humans. All standard human diagnostic and interventional equipment suitable for use in humans can be used with pigs. Thus, porcine model is widely accepted as a very good animal model to study human fibroproliferative vascular diseases involving an intervention procedure.

45

1.9 Vitamin D Vitamin D is a collection of fat-soluble steroids known to optimize calcium and phosphorus absorption from the intestine for proper formation of the bone mineral matrix. The primary source of vitamin D is endogenous synthesis in the skin when 7dehydrocholesterol is exposed to ultraviolet-B light between wavelengths of 270 to 300 nm. Vitamin D can also be obtained from natural dietary sources such as fatty fish, fish liver oil, and eggs [258] or from fortified sources such as milk, milk products, and butter [259]. Recent studies have shown that vitamin D acts a hormone and also plays a key role in extra-skeletal health.

1.9.1 Vitamin D Deficiency The main source of vitamin D for humans is exposure to sunlight [260-262]. Cutaneous synthesis of vitamin D3 is affected if the transmission of solar UVB radiation to the earth’s surface or the penetration of UVB radiation into the skin is decreased [263]. UVB radiations are efficiently absorbed by melanin, and, thus, vitamin D3 synthesis is decreased by increased skin pigmentation [264]. Topical application of a sunscreen with sun protection factor (SPF) of 15 absorbs 99% of incident UVB radiation, and, thus, will decrease the synthesis of vitamin D3 in the skin by 99% [265]. Thus, certain ethnic groups such as African Americans, with dark skin have a significantly reduced ability to synthesize vitamin D in their skin [263,264]. Geographical location and the angle at which sun reaches the earth also have dramatic influence on cutaneous vitamin D synthesis. Vitamin D deficiency is more prevalent in population living in temperate climate as compared to the population living near the equator where vitamin D3 synthesis is more efficient because of the higher flux of UVB photons [266,267]. The 46

concentrations of 7-dehydrocholesterol, the precursor of vitamin D3 in the skin, is decreased with age. A 70 year old has 25% of the 7-dehydrocholesterol that a young adult does and thus has a 75% reduced capacity to make vitamin D3 in the skin [268]. Obesity is also associated with vitamin D deficiency. Because vitamin D is fat soluble and readily taken up by fat cells, it is believed that vitamin D can be sequestered into the larger pool of body fat [269]. No one is immune from vitamin D deficiency. Studies suggest that almost of 30– 50% of world population is at risk of vitamin D deficiency [270-278]. The definition of vitamin D deficiency is still debatable. However, most people agree that serum concentration of 25(OH)D 41 ng/ml) is associated with a significant decreased incidence of MS in white subjects [325]. Several observational and experimental animal model studies have implicated the role of vitamin D in IBD. Deficiency of vitamin D and VDR result in increased susceptibility of mice to experimental IBD and 1,25(OH)2D3 suppresses IBD symptoms [322,326]. The development of IBD is accelerated in IL-10 knockout mice [322]. In addition, double VDR and IL-1o knockout mice develop a fulminating IBD that cause premature mortality [327]. Prevalence of IBD is higher in areas where synthesis of vitamin D from sunlight exposure is less, such as North America and Northern Europe [328,329]. A recent human study has indicated that vitamin D deficiency is common in IBD and is independently associated with lower health-related quality of life and greater disease activity in Crohn’s disease (CD) [330]. In IBD patients, the deficiency of vitamin D is common even when the disease is in remission [331,332]. VDR and 1-α-hydroxylase (CYP27B1) are expressed in numerous normal as well as malignant tissues, including breast, colon, prostate, and pancreas. Several in vitro and in vivo studies have demonstrated that vitamin D deficiency promotes proliferation, whereas stimulation with 1, 25(OH) 2D3 and its analogues significantly inhibit proliferation of these cells [333]. The antineoplastic effects of vitamin D are proposed to be due to cell cycle gene inhibition, reduction of tumor invasiveness, and angiogenesis. Interestingly, the antiproliferative action of vitamin D is postulated to occur in an autocrine and paracrine fashion via local conversion of 25(OH) D to its hormonally active form through the local 1-α-hydroxylase [279]. However, the optimal circulating level of 25(OH) D for extrarenal tissues to have antiproliferative activity is not well 54

defined but is believed to be higher than the levels required for skeletal health. A study conducted in postmenopausal women randomized into calcium supplemented, calcium plus vitamin D supplemented, or placebo treated groups showed a significant reduction in all-cancer incidence in the calcium plus vitamin D– treated group after 4.1 years of follow-up [334]. This study used higher (1100 IU/d) than recommended amounts of daily vitamin D which allowed 25(OH) D levels to reach values greater than 32 ng/ mL after 1 year of treatment. Another recent study has shown that intake of 2000 IU/day of vitamin D3 and when possible, moderate exposure to sunlight, could raise serum 25(OH) D to a level (52 ng/ml), was associated with a 50% reduction in the incidence of breast cancer [335]. Many prospective studies have also demonstrated that risk of colorectal cancer is reduced with higher baseline plasma levels of 25(OH) D [336-338]. Investigating the influence of plasma 25(OH) D on the outcome of patients with established colorectal cancer has shown that higher pre-diagnosis plasma 25(OH)D levels were associated with a significant improvement in overall survival [339]. Epidemiological studies have also suggested that sunlight exposure is inversely proportional to prostate cancer mortality and that the risk of prostate cancer is increased in men with lower levels of vitamin D [340,341]. In vivo studies in rodent model have shown that 1, 25(OH) 2D3 and its analogs slow tumor growth and hinder metastasis of prostate tumors [342,343]. Therefore, vitamin D is crucial for overall health and there is growing scientific evidences that associate vitamin D deficiency with increased risk of autoimmune diseases, cancers, and many other chronic diseases.

55

1.9.5 Vitamin D and Immunomodulation The possibility of immunomodulatory effects of vitamin D was raised due the observation that VDR is expressed in cells of immune system including, peripheral blood monocytes, leucocytes, antigen-presenting cells and activated CD4+ T cells [344,345]. Additionally, the capacity of dendritic cells (DCs) and activated T lymphocytes to synthesize 1, 25(OH) 2D3 from sunlight-derived precursors suggests possible immune autocrine/paracrine activity [346]. Monocyte-derived DCs are specialized APCs that play a crucial role in the initiation of mucosal CD4+ T-cell responses. DCs mature into APCs upon uptake of antigen and present this antigen to T cell receptor (TCR) of naïve T cells. T-cell activation occurs in the presence of required additional DC (CD80/CD86/CD40) and T-cell (CD28 and CD154) co-stimulatory signals [347]. Several studies have demonstrated 1, 25(OH) 2D3, or its analogues inhibit the differentiation of precursor monocyte into DCs [348,349]. Several studies have shown that 1, 25(OH) 2D3 also inhibits T-cell activation and proliferation directly [350,351]. Moreover, DCs cultured with vitamin D have tolerogenic properties (characterized by decreased co-stimulatory expression of CD40, 80, 86 and class II MHC molecules), demonstrating a decreased ability to activate allogenic T cells. These tolerogenic DCs also induce T cells with suppressive activity [352-354]. Notably, DCs treated with vitamin D retained an immature phenotype even after the withdrawal of vitamin D, a feature not observed with corticosteroids treatment that also impair DC maturity and proliferation [355]. Specific DC-derived cytokines direct the phenotype of T-cells upon DC-modulated activation of T-cells [356]. Interleukin-12 is a key cytokine that plays a major role in driving proinflammatory Th1 differentiation and also inhibits the apoptosis of T-cells [357]. 1, 56

25(OH) 2D3 inhibits the production of IL-12 [358,359], possibly by interfering with nuclear factor kappa B (NFkB)-induced transcription of IL-12. In contrast, 1, 25(OH) 2 D3 upregulates the production of DC-derived IL-10, promoting Th2 cell phenotype [352,359]. IL-10 induces regulatory T cells and inhibits production of other proinflammatory monokines, such as IL-1, IL-6 and TNF-α. Furthermore, 1, 25(OH) 2 also blocks IFN-γ synthesis by differentiated Th1 T cells [360]. A study by Stio et. al, has shown that culture of antigen-stimulated peripheral blood monocytes from CD patients supplemented with a vitamin D analogue not only had reduced the cell proliferation but also inhibited the production of TNF-α and associated transcription factor NF-kB [361]. Potential therapeutic effects of vitamin D are apparently synergistic to other conventional immunomodulators such as steroids. A combination of vitamin D and steroids more effectively reduce the Th1 cytokine IFN-γ and increase Th2 cytokines IL5/IL10/IL13 [362,363]. However, unlike other immunosuppressants, which also appear able to induce a tolerogenic DC phenotype (sirolimus and glucocorticosteroids), only vitamin D and its analogues appear able to specifically increase IL-10 [359]. The tissue-specific homing and microenvironmental destination of immune cells is determined by chemokines [364]. Recent evidences have shown that vitamin D can influence DC-mediated homing marker expression on activated T cells, including chemokine receptor (CCR) 9 (gut homing) , CCR 10 (skin homing) and integrin intestinal-homing receptor α4β5. This modulation of homing marker expression of immune cells has clear implications in various diseases including IBD [346]. Thus, 1, 25(OH)2 D3 appears to promote desirable Th2 responses and inhibit the Th1

immune

response

demonstrating

that

vitamin

D3

has

immunomodulatory effects that could have potential therapeutic implications. 57

powerful

1.9.6 Vitamin D and Cardiovascular Diseases Widespread prevalence of vitamin D deficiency and cardiovascular diseases, with higher incidence of ischemic heart disease(IHD) has been noted in countries with lower levels of ultraviolet B exposure [365]. There is seasonal variation in the levels of vitamin D, with higher levels in summer [366], and the incidence of IHD shows similar seasonal patterns [367]. Several epidemiological studies have also shown higher prevalence of IHD and hypertension in regions with increasing distance from the equator, which is attributed to increased vitamin D deficiency in these regions [368,369]. Evidences have encouraged elucidating the possible association of vitamin D with cardiovascular disease. Vitamin D is thought to help maintain cardiovascular health by its direct action on cardiomyocytes and indirectly affecting the circulating calcium levels [370,371]. Deficiency of 25(OH) D is associated with CVD risk factors such as obesity [372], metabolic syndrome [373], glucose intolerance [372], and hypertension [374]. Low 25(OH) D levels have been found in patients of heart failure [375] and stroke [376]. Vitamin D deficiency is also associated with increased plasma renin activity and coronary artery calcification [377,378]. Another recent study has demonstrated that in patients receiving dialysis, supplementation of vitamin D may reduce the risk of cardiovascular disease [379]. Vitamin D supplementation has also been shown to reduce cardiovascular disease in the general population [380].

Another recent study has

concluded that levels of vitamin D are linked with incident cardiovascular disease and the potential underlying mechanisms could be the inhibition of renin gene expression by 1,25IOH)2D3 and potential role of vitamin D in vascular functions including smooth muscle cell proliferation, thrombosis and inflammation [381]. However, the association 58

of endogenous 25(OH) D levels with CVD events is still debatable [382,383]. A systemic review concluded that there is no definite association between vitamin D status and cardiometabloic outcome [384]. Another recent meta-analysis examining vitamin D and cardiovascular outcomes has concluded that there is no statistically significant correlation between vitamin D status and reduction in mortality or cardiovascular risk [385]. However, most of these studies are observational and clinical application of this data is limited. Thus, more prospective randomized controlled studies are needed to determine whether vitamin D supplementation may provide cardiovascular protection. The possible underlying mechanism involved in the putative prevention of cardiovascular disease by vitamin D could be the negative regulation of renin, inhibition of cell proliferation, and immunomodulation. No study has investigated the effect of vitamin D on coronary restenosis. Proliferation of VSMCs and inflammation are the major pathological processes involved in the development of coronary restenosis. Vitamin D has anti-proliferative and immunomodulatory properties. Vitamin D receptor is expressed in various cells including VSMCs and immune cells. There are epidemiological evidences suggesting protective role of vitamin D in cardiovascular diseases. Based upon the information from the current literature, I investigated the effect of vitamin D on porcine coronary artery smooth muscle cells proliferation, migration and phenotypic modulation in vitro and vitamin D deficiency and vitamin D supplementation on the outcome measures following coronary intervention in a wellcontrolled atherosclerotic swine model of coronary restenosis.

59

1.10 Hypothesis and Aims: The central hypothesis is that calcitriol inhibits proliferation, migration and phenotypic modulation in porcine coronary artery smooth muscle cells (PCASMCs) through VDR and that vitamin D supplementation reduces the incidence of restenosis by decreasing neointimal hyperplasia after coronary artery intervention in coronary artery disease.

Specific Aim 1: To investigate the effect of calcitriol on the expression of vitamin D receptor (VDR), vitamin D metabolizing enzymes (CYP24A1, CYP27B1), cell proliferation, and apoptosis in PCASMCs. Specific Aim 2: To investigate the effect of calcitriol on PDGF-BB induced proliferation, phenotypic modulation, and migration in PCASMCs. Specific Aim 3: To investigate the effect of vitamin D status and oral vitamin D supplementation on intimal hyperplasia after balloon angioplasty and bare metal stenting in porcine coronary arteries.

60

Chapter 2 Material and Methods

61

2. Material and Methods 2.1 Tissue Culture Pig hearts were obtained from slaughter a house and coronary arteries smooth muscle were cultured as per the following protocol. Coronary arteries were dissected out from the heart and kept in smooth muscle cell media [SMCM] (Sciencell, USA) containing 1% penicillin/streptomycin solution (Sigma, USA) for 1 hr. Tissue was minced and washed with Dulbecoo’s modified Eagle’s medium [DMEM] (Sigma, USA), incubated in 0.25% trypsin (1x) solution (Thermo Scientific, USA) for 30 min at 370C and then washed with DMEM. Tissue was incubated in 0.2% collagenase for 3 hr at 370C followed by washing with DMEM. Finally, tissue was rinsed with

SMCM

containing 10% fetal bovine serum (FBS) and seeded in 25 cm2 cell culture flask (Corning Flask, USA) in 5 ml of SMCM with 10% FBS (Figure 6). Flasks were kept in incubator at 370C and 5% CO2 (Figure 7). Media was changed at every 48 hr and cells were observed in an inverted phase contrast microscope (Nikon, Japan) for the growth. Once the flasks were confluent, cells were passaged into three 25 cm2 cell culture flasks. The subcultured PCASMCs, between passages 3–5, were used for the invitro experiments. The confluent cells showed the characteristic hill-and-valley pattern and spindle-shape of PCASMCs. The purity of isolated VSMCs was confirmed with positive immunocytochemical staining for smooth muscle α-actin and myosin heavy chain, the positive cells were over 95 %.

62

Figure 6: Protocol for isolation and culture of porcine coronary artery smooth muscle cells (PCASMCs)

63

2.2 Treatment of Porcine Coronary Artery Smooth Muscle Cells (PCASMCs) Prior to stimulation experiments, 70-80% confluent 25 cm2 cell culture flasks were serum starved for 24 hr with DMEM. Cells were stimulated with test substance prepared in DMEM. PCASMCs were treated with different concentrations (0.1 nM- 100 nM) of calcitriol (Sigma, St. Louis, MO) prepared in DMEM. In some cases, PCASMCs were treated with TNF-α (10 ng/ml) (PeproTech, Rocky Hill, NJ) and /or calcitriol (10 nM) for 24 hr. For cell proliferation experiments PCASMCs were treated with PDGF-BB (20ng/ml) (PeproTech, Rocky Hill, NJ) and /or calcitriol (10 nM) (Figure 7). Cells were harvested for RNA and protein isolation as per the following protocol. Cells were rinsed with FBS-free SMCM. Flasks were incubated with 2 ml of 0.25% trypsin at 370C for 5 min. Four ml of 10% FBS containing SMCM was added to the flasks, transferred to 15 ml centrifuge tubes (Fisher Scientific Pittsburg, PA) and centrifuged at 1500 rpm for 5 min at 40C. Media was removed and the cell pellet was used for RNA and protein isolation.

2.3 RNA Isolation and Quantification Total RNA isolation was done by using the Trizol reagent (Sigma, USA) method. Cell pellet were placed in 1 ml Trizol reagent, mixed well, and incubated at room temperature for 15 min. Next 100 μL 1-bromo-3-chloropropane was added, vortex for 10 sec and incubated at room temperature for 10 min. Samples were centrifuged at 12,000g at 40C for 15 min. The aqueous phase (top clear layer) was transferred to fresh Eppendorf tube, 500 μL of isopropanolol was added and mixed and

64

Figure 7: Protocol for investigating the effect of calcitriol on the expression of VDR, vitamin D metabolizing enzymes, cell proliferation, migration and phenotypic modulation in PCASMCs.

65

incubated at room temperature for 10 min. Samples were centrifuged @ 12,000g at 4 0C for 8 min. Supernatant was discarded and RNA pellet was mixed with 1 ml of 80% ethanol (Decon Laboratories Inc., King of Prussia, PA). Samples were centrifuged @ 7500g for 5 min at room temperature. RNA pellet was air dried and dissolved in 30- 50 μL of nuclease-free water (Fischer Scientific, USA). The yield of RNA was quantified by using a Nanodrop instrument (GE Healthcare, USA).

2.4 Reverse Transcription and Real-Time PCR One µg total RNA with oligo dT (1 µg), 4 µl of 5 X reaction buffer, 4.8 µl MgCl2, 1 µl dNTP mix and 0.5 µl of Improm II reverse transcriptase were used for cDNA synthesis. Cycling conditions for reverse transcription procedure were 25ºC for 5 min, 42ºC for 60 min and 70ºC for 15 min. Following the cDNA synthesis, real-time PCR (7500 Real Time PCR System Biorad) was conducted using 8 µl cDNA, 10 µl SYBR green PCR master mix (Biorad) and 1 µl forward and 1 µl reverse primers (25 picomol) (Integrated DNA Technologies, USA). The specificity of the primers was analyzed by running a melting curve. The PCR cycling conditions used were 5 min at 95ºC for initial denaturation, 45 cycles of 45 sec at 95ºC, 45 sec at 53-57ºC (depending on primer annealing temperature) and 45 sec at 72ºC. Three individual samples in duplicate were used to carry out each real-time PCR. Calculations of relative gene expression were based on the differences in the threshold cycles (Ct). The fold change in expression between samples was calculated by Fold change= 2 –ΔΔCt method. The results were normalised against glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The primer sequences used are listed in Table 1. 66

2.5 Protein Isolation and Quantification Protein lysate was extracted from the cell pellet by using RIPA lysis buffer (Sigma, St. Louis, MO) with protease inhibitor (P8340, Sigma, St. Louis, MO) as per following protocol. 150 μL of RIPA lysis buffer and protease inhibitor cocktail were added and samples were incubated for 10 min at 4oC. Sample were sonicated for 5 sec and incubated at 4oC for 10 min. Sample was mixed and incubated again 4oC for 10 min and centrifuged @ 14,000 rpm at 4oC for 10 min. Supernatant was taken out and transfered to fresh Eppendorf tube. The concentration of protein in each sample was determined by the bicinchoninic acid (BCA) method [386]. Albumin ranging in concentration from 0.2-1.0 mg/ml was used as standards. Ten μL of sample and standards were placed in a 96-well microtitre plate. Next 200 μL of BC/copper sulfate solution (1:50 dilution of 4% copper sulfate in BCA solution) was added to each well. The microtitre plate was incubated at 370C for 30 min. Absorbance was measured at 550 nm on microplate reader (Perkin Elmer, Waltham, MA).

2.6 Western Blotting Each sample containing 30 µg of protein was mixed with Laemmli loading buffer (Biorad, Hercules, CA ) with 10% mercaptoethanol (Sigma, St. Loius, MO) and separated by electrophoresis using 10-20% polyacrylamide gels (Biorad, Hercules, CA). After electrophoresis the proteins were transferred from the gel onto a nitrocellulose membrane (Biorad, Hercules,CA). For antibodies detection of specific proteins the membrane was blocked in 5% non-fat dry milk for 1 hr. After blocking,

67

Table 1 VDR

Forward primer: AATGGCGGCCAGCACTTCCC Reverse primer: CTGGCAGTGGCGTCGGTTGT

CYP 27B1

Forward primer: AGGAGTGAAGTATGCACTTGGCCT Reverse primer: GGAGCGGCCCAAAGAAATAGCAAA Forward primer: TGTGACGAGAGAGGCTGCATTGAA Reverse primer: TCATCTTCCCGAACGTGCTCATCA

CYP24A1 αSMA Smoothelin GAPDH

Forward primer: TGAGCGCAAATACTCCGTCTGGAT Reverse primer: GAAGCATTTGCGGTGGACAATGGA Forward primer: TGTGAGCAAGCAGTGTGGGCA Reverse primer: TGGTGGTGGGTCTTTGTGGCG Forward Primer: ACACTCACTCTTCTACCTTTG Reverse Primer: CAAATTCATTGTCGTACCAG

68

membrane was incubated overnight with a dilute solution of primary antibodies under gentle agitation at 40C. Membrane was washed 6 times (10 minutes each) with washing buffer (0.05% Tween-20 with PBS) to remove unbound primary antibody and then the membrane was exposed to another antibody, linked to horseradish peroxidase (1:2000)(Novus Biologicals, Littleton, CO), directed at a species-specific portion of the primary antibody. The membrane was then incubated for 1 hr at room temperature under gentle agitation. The membrane was washed three times with washing buffer and relative amount of antibody binding was detected by ECL chemiluminescence detection reagents (Amersham Pharmacia Biotech, Piscataway, NJ). The emission was detected in EpiChemi darkroom and the image captured with BioChemi CCD camera. Results were normalized against the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH).

2.7 GFP Transfection FuGENE HD reagent (Roche, CA) was used for transient transfection of PCASMCs. Cultured PCASMCs, 4×105 cells/well, were seeded into each well of a 24-well plate and cultured to 80-90% confluency. Transfection-complex was prepared using 3:2, 4:2, 5:2, 6:2, 7:2, 8:2 , 9:2 and 10:2 ratios of FuGENE HD transfection reagent: GFP in 100 μL of Opti-MEM I media ( Life Technologies, Grand Island, NY). The plate was removed from the incubator and growth medium was replaced by serum-free medium. Transection-complex (25 μL/well) was added and the plate was incubated for 8 hr at 370C. After 8 hr media was replaced with serum-containing media and cells were

69

incubated for 72 hr. Cells were regularly observed and images were taken using a florescence microscope to evaluate levels of GFP expression.

2.8 Silencing RNA Knockdown Small interfering RNA (siRNA), an effective tool to downregulate the expression of target genes in cultured mammalian cells, was used for knock-down of VDR. Ten nM of specific silencing (si) RNA oligonucleotides (Ambion, Austin, TX) or scrambled oligonucleotides (Santa

Cruz Biotechnology, Santa Cruz, CA) serving as negative

controls were transfected into PCASMCs using FuGENE 6 transfection reagent (Roche Applied Science, Germany ). The knockdown efficiency was analyzed by western blot analysis. The sequences of oligonucleotides to silence VDR were: sense: 5′ GCUGUUUAUUUGACAGAGAtt; antisense: UCUCUGUCAAAUAAACAGCaa.

2.9 Thymidine Proliferation Assay Thymidine incorporation assay for cell proliferation was done per the following protocol. PCASMCs (5x104/well) were seeded in a 24-well plate with 1 ml SMCM + 10% FBS. Cells were incubated for 24 hr. Cells were then rinsed with FBS-free SMCM and incubated in 1 ml of serum free DMEM for 24 hr to render the cells quiescent. PCASMCs were stimulated with different concentrations of calcitriol (0.1 nM -100 nM) in SMCM with 10% FBS for 24 hr. Eight hr prior to the end of treatment 1 µCi [3H]-thymidine (Perkin Elmer) (1 ul diluted with 24 ul of media) was added to each well and culture plate was placed at 37 0 C. After 8 hr, media was aspirated and wells were washed with 1 ml ice-cold PBS. 1 ml of ice-cold 5% TCA was added and incubated at 40 C for 30 min. 70

Cells were then washed once with PBS. At room temperature, 0.5 ml 0.5N NaOH/0.5% SDS was added and gently pipetted up and down before being transferred to scintillation vials. The amount of incorporated [3H] thymidine was determined using a β-counter.

2.10 Bromodeoxyuridine (BrdU) Proliferation Assay The BrdU incorporation assay was performed using a cell proliferation ELISA BrdU kit (Roche Applied Science, Germany) to assess PCASMCs proliferation. PCASMCs were trypsinized [0.25%trypsin] (Hyclone, Logan, UA) and seeded at a density of 5x 104 cells on 24-well plate. After 24 hr, cells were serum starved by replacing the media with serum-free DMEM. Quiescent cells were treated with different concentrations of calcitriol ± PDGF-BB for 24 hr. After 24 hr of experimental stimulation, the cells were labeled with 10 μM of BrdU solution prepared in DMEM and incubated for 8 hr at 37°C. The medium was removed, cells were dried and fixed, and the cellular DNA was denatured with FixDenat solution for 30 min at room temperature. A mouse anti-BrdU monoclonal antibody conjugated with peroxidase was added to each well and the plates were incubated again at room temperature for 2 hr. Tetramethylbenzidine was added and the cells were incubated for 30 min at room temperature. Finally, the absorbance of the samples was measured by a microplate reader (PerkinElmer, Inc. CA, USA) at 450 nm.

71

2.11 Annexin V and Propidium Iodide Apoptosis Assay Cultured PCASMCs were treated with different concentrations of calcitriol (0.1 nM-100 nM) for 24 hr and Annexin V assay was performed for apoptosis using Annexin V FITC Apoptosis Detection Kit (eBioscience Cat# 88-8005) as per following protocol. Binding buffer (10X) was diluted 1:10 in distilled water. Cells grown in 25 cm2 flasks were suspended washed once in PBS and then once in diluted binding buffer. Cells were then resuspended in 1 ml diluted binding buffer. 100 μl of the cell suspension and 5 μl of fluorochrome conjugated-Annexin V were mixed and incubated for 12 min at room temperature. Cells were washed and resuspended in 200 μl of diluted binding buffer. Five μl of propidium iodide staining solution was added. Samples were analyzed by flow cytometry (BD Biosciences, USA) using the PE channel for propidium iodide.

2.12 Transwell Migration Assay Cell migration was measured using Transwell migration plates (Corning, MA, USA) as per following protocol. The chemoattractant (PDGF-BB) ± calcitriol were diluted and placed in the bottom wells of the chamber. PCASMCs were trypsinized and washed twice in DMEM and resuspended in DMEM. PCASMCs (15,000 cells/well) were placed into each well in the upper chamber and the chemotaxis chambers were incubated at 37°C for 6 hr. After the incubation, unmigrated cells were removed from the upper side of the filters and migrated cells were fixed and stained with hematoxylin. Filters were mounted onto microscope slides and stained cells were counted at 200× magnification in four fields per well. In each individual experiment, chemotaxis was

72

performed in four separate wells for each concentration of a given test substance under a specified condition.

2.13 Flourometry PCASMCs cultured in 24-well plates were synchronized in serum-free DMEM for 24 hr before the addition of test compounds. PCASMCs were fixed with ice-cold 4% (wt/vol) paraformaldehyde for 10 min, incubated in 0.1% Triton X-100 for 5 min followed by blocking with 1 % BSA for 30 min. To detect the protein expression of smooth muscle alpha actin (α-SMA), smooth muscle myosin heavy chain, smoothelin, calponin, PCASMCs were then incubated with primary antibody for 1 hr and wells were washed with PBS. Next, wells were incubated with cyanine3 conjugated secondary antibody (Jackson ImmunoResarch, Westgrove, PA) for 1 hr and wells were again washed with PBS. After washing, the wells were dried with a stream of cold air and the fluorescence on the dry solid surface was quantified using a plate reader (Perkin Elmer, Weltham, MA). The fluorescence intensity, background subtracted (secondary antibodyonly signal), and presented as relative fluorescence intensity units (RFU).

2.14 Immunocytochemistry PCASMCs cultured in Lab-Tek chamber slides (Thermo Fischer Scientific, Rochester, NY) were quiesced in serum free DMEM for 24 hr before the addition of 10 ng/ml of TNF-α and/or 10 nM calcitriol. PCASMCs were fixed with ice-cold 4% (wt/vol) paraformaldehyde for 10 minutes, incubated in 0.1% Triton X-100 for 5 min followed by blocking with 1 % BSA for 30 min. PCASMCs were then incubated with primary 73

antibody for 1 hr followed by cyanine3-conjugated secondary antibody (Jackson ImmunoResarch, Westgrove, PA) for 1 hr then rinsed in phosphate buffer saline (PBS). To detect filamentous actin (F-actin), PCASMCs were incubated with Alexa Fluor 488phalloidin (Invitrogen, Carlsbad, CA) for 1 hr. Slides were mounted with Vectashield mounting medium (Vector Laboratories Burlingame, CA) and examined using fluorescence microscopy.

2.15 Animals Institutional Animal Care and Use Committee of Creighton University approved all research protocols and all animals were housed and cared as per National Institute of Health standards. Female yucatan Miniature Swine of 30-40 lb were obtained from Lonestar Laboratories IA, USA. Animals were housed in Animal Resource Facility of Creighton University, Omaha, NE.

2.16 Experimental Diet Animals were fed 1-1.5 lb/ animal/day of experimental diet. Vitamin D-sufficient high cholesterol diet (Harlan, USA) contained the following major ingredients: corn 37.2.% corn (8.5% protein), 23.5% soybean meal (44% protein), 20% chocolate mix, 5% alfalfa, 4% cholesterol, 4% peanut oil, 1.5% sodium cholate, and 1% lard. Vitamin Ddeficient high cholesterol swine diet (Harlan, USA) constituted following major ingredients: 19% casein “vitamin free”, 23.5% sucrose, 23.9% corn starch, 13% maltodextrin, 4% soybean oil, 4% cholesterol, 10% cellulose.

74

2.17 Experimental Protocol To investigate the effect of vitamin D status and supplementation on intimal hyperplasia development, the following swine model of coronary restenosis was developed. Yucatan miniature swine of 30-40 lb were fed a high-fat, high-cholesterol experimental diet for 6 months. Coronary angiography and histological evaluation was done to assess the degree of intimal hyperplasia and luminal loss. Next, hypercholesterolemic atherosclerotic Yucatan miniature swine underwent percutaneous coronary intervention (PCI). Morphometric analysis of coronary artery tissue sections was performed to evaluate intimal hyperplasia and restenosis development (Figure 8). Next, Yucatan miniature swine were divided into two groups (i) vitamin Ddeficient high cholesterol diet and (ii) high cholesterol diet alone. After 6 months coronary balloon angioplasty was performed. Angiogram was performed at the time of coronary intervention. Six months post-coronary intervention, another angiogram was performed to quantify in-segment minimal luminal diameter, diameter stenosis, late loss and intimal hyperplasia. Animals were euthanized and coronary arteries were dissected for histological examination. Histological parameters included were the intimal thickness, lumen area, and re-occlusion. Histomorphometric evaluation of coronary artery tissue sections was done by hematoxylin and eosin (H&E), Verhoeff-Van Gieson (VVG), and Masson’s trichrome staining. The increased proliferation in the tissue sections of the intimal hyperplasia lesions in the various experimental groups was detected using immunohistochemistry for proliferating cell nuclear antigen (PCNA), smooth muscle alpha actin (α-SMA) using respective antibodies (Figure 9). 75

To investigate the effect of vitamin D supplementation on coronary restenosis, Yucatan microswine were fed a vitamin D-deficient high cholesterol diet or a vitamin Dsufficient high cholesterol diet for 6 months. After 6 months, coronary angiogram was performed and balloon angioplasty and balloon angioplasty with bare-metal stenting was performed. Post-coronary intervention, animals in the vitamin D-sufficient high cholesterol group was divided in to 2 groups and received oral supplementation of 1,000 IU and 3,000 IU of vitamin D3 respectively. Vitamin D-deficient high cholesterol diet group remained on the same diet without any vitamin D supplementation. Follow-up angiogram and optical coherence tomography (OPT) was conducted at 6 months postcoronary intervention to examine minimal luminal diameter, diameter stenosis, and intimal hyperplasia. Animals were euthanized and coronary arteries were dissected for histomorphometric and immunohistochemical evaluation as mentioned above (Figure 10).

76

Figure 8: Protocol for development of swine model of coronary restenosis

77

Figure 9: Protocol to investigate the effect of vitamin status on coronary restenosis

78

Figure 10: Protocol to investigate the effect of vitamin D supplementation of coronary restenosis

79

2.18 Animal Preparation and Operative Protocol and Angiography Three days prior to the operative procedure, the hyperlipidemic swine were medicated with anti-platelet therapy (orally 350 mg aspirin and 250 mg ticlopidine per day). This was a precautionary measure to avoid any immediate post-operative thrombotic episodes leading to early mortality. The day before surgery, pigs were fasted overnight and were given a general anesthesia, intramuscular ketamine (10 mg/kg) and medetomidine (0.1 mg/ml) (ratio of ketamine/ medetomidine will be 100:1) or the standard combination dosage of Telazol (2.5-5 mg/kg) and Xylazine (1-2 mg/kg) prior to intubation. Isoflurane was administered by mask using an Excel 210 anesthesia machine (BOC Healthcare) to sustain anesthesia during the surgery. Access in the femoral artery in the leg was created by an introducer needle. This was followed by the placement of a 6F sheath introducer to keep the artery open and control bleeding. A guiding catheter was then introduced and pushed all the way to coronary arteries. Systemic heparin (100 U/kg) was administered to maintain blood flow and an additional 50 U/kg heparin if the procedure exceeded 90 min. This was followed by insertion of a guidewire through the guiding catheter and into the coronary artery. The left coronary artery was visualized and recorded angiographically using a 6F JR4 catheter. Non-ionic contrast media, 5-7 ml 60%, was injected into the coronary arteries, for fluoroscopic evaluation. All angiographic images were stored in the C-arm (OEC 9900 Elite Vas 8, GE Healthcare). Coronary angiography and OCT was used to assess lumen loss. The percutaneous transluminal coronary angioplasty [PTCA] (Voyager Abbott) or PTCA with bare-metal stenting (Vision) was gently pushed, until the deflated balloon catheter was inside the coronary arteries. The balloon was then inflated to 10-15 atm pressure, depending on the vessel to produce injury in the coronary artery 80

endothelial cells. Angiograms were performed to estimate TIMI grade flow. Then the catheter was removed and the femoral artery sutured followed by closure of leg wound. The pigs were allowed to recover under a thermal blanket. The i.v. fluid was continued until pigs are able to drink water and the pigs were subsequently moved back to the animal care facility. Oral aspirin (350 mg) and ticlopidine (250 mg) post-operatively were continued. If a fever developed (>103oF), animals were treated with Tylenol (500 mg twice/day orally) until the fever subsided. Cephalexin was administered orally at the dosage of 20 mg/kg twice/d for 7-10 days to treat any post-operative infections. Microswine were brought back to the surgical suite for coronary angiography at 24 weeks following the initial coronary intervention to determine the blood flow and measure in-segment minimal luminal diameter, diameter stenosis, late loss and intimal hyperplasia, similar to the pre-angioplasty and post-angioplasty studies. After the arteriography at 24 weeks postsurgery, the animals were euthanized with sodium pentobarbital.

Immediately

thereafter, whole hearts were excised and coronary arteries were isolated. Parts of the coronary arteries were fixed for morphometry and remaining portions of the arteries will be used for other studies.

2.19 Blood Draw Blood was drawn from ear vein at baseline, 6 months and 12 months for measuring complete lipid profile, complete metabolic profile, complete blood count (CBC), C-reactive protein (CRP), and serum 25 (OH) D levels. Serum levels of IL-6, IL10, TNF-α, and IFN-γ were also determined using ELISA kits.

81

2.20 Stents Bare metal sterile stents (VISION, Abbott) were used. Clinical "coronary-type" (3.0 mm x 15 mm diameter) stents were used. The stents were mounted on 5F or 6F noncompliant angioplasty catheters (Cook Inc.). VISION were used because (i) these stents are ones that are most commonly used in clinical practice, and (ii) the incidence of restenosis in patients deployed with VISION stent is reported to be 20-25%.

2.21 Optical Coherence Tomography The OCT imaging is useful to clearly visualize stent apposition and neointimal coverage of stent struts. Complete imaging was performed and recorded using C7-XR OCT intravascular imaging system (St. Jude Medical, St.Paul, MN). Minimal luminal diameter, reference diameter, and percent diameter stenosis were calculated.

2.22 Euthanasia Euthanasia was performed using Beuthanasia-D (1.0 mL/10 lb i.v.) at the time of termination and prior to harvesting of tissues. This method is consistent with the recommendations of the Panel on Euthanasia of the American Veterinary Medical Association.

82

2.23 Tissue Harvest and Processing Immediately after euthanasia pigs’ heart were removed and placed in collection media (RPMI with 10% FBS, 500U/ml penicillin, 500µg/ml streptomycin). Coronary vessels were dissected out and fixed in 4% formalin for 24 hours at room temperature. Formalin fixed tissues were embedded in paraffin and sectioned (5 µm) using a microtome (Leica, Germany) for histomorphometric and immunohistochemical evaluation.

2.24 Deparaffinization of the Sections Tissue sections were deparaffinized as per following protocol: 

Submerge slides in xylene to remove paraffin. -

Shake at low speed for 3 min



100% EtOH for 3 min



95% EtOH for 3 min



80% EtOH for 3 min



70% EtOH for 3 min

2.25 Staining of the Sections 2.25.1 H&E Staining  Dip slides a few times in distilled water  Place slides in Harris hematoxylin solution for 30 sec  Rinse slides in running tap water for 5 min 83

 Differentiate slides in bluing solution for 10 sec  Rinse briefly in distilled water  Place sides in eosin solution for 22 sec (Counterstain)  Dip slides in 95% EtOH for 10 times  Dip slides in 100% EtOH for 5 times  Dip slides in additional 100 % EtOH for 5 times  Dip slides in xylene/ethanol mix for 5 times  Place slides in xylene for 5 min  Mount slides using xylene-based mounting medium

2.25.2 Verhoeff-Van-Gieson (VVG) Staining  Dip slides a few times in distilled water  Place slides in elastic stain solution for 10 min  Rinse in deionized water  Differentiate in working ferric chloride solution  Rinse in tap water  Check microscopically, if over differentiated return to working elastic stain solution  Rinse in 95% EtOH  Rinse in deionized water  Stain in Van Gieson solution 1-3 min  Rinse in 95% EtOH  Dehydrate to xylene and mount 84

2.25.3 Trichrome Staining  Dip slides a few times in distilled water.  Place slides in Bouins fluid at 560c for 1 hr  Rinse slides in running tap water 3-5 min  Place slides in working Weigert’s iron hematoxylin stain for 10 min  Rinse slides in running tap water 5-10 min  Stain sections in Biebrich Scarlet-acid fuschsin solution 5-10 min  Rinse slides in distilled water for 30 sec  Place slides in phosphotungustic-phosphomolybdic acid for 5 min  Place slides in aniline blue stain for 5-10 min  Place section in 1% acetic acid solution for 1 min  Rinse briefly in distilled water for 30 sec  Dehydrate in 100 % EtOH 2 min  Clear slides with xylene/EtOH mix 1 min  Clear slides by placing xylene for 1 min  Clear slides again by placing in additional change of xylene for 1 min  Mount slides using xylene-based mounting medium

85

2.26 Histomorphometric Analysis Serial sections were obtained for every 200 m segment spanning the entire length of the vessel. Sections were stained with H&E stain and morphometric analysis was conducted to evaluate percent restenosis. For each segment, 5 sections were analyzed. Luminal surface of the neointima, internal elastic lamina and the external elastic lamina were traced and areas were calculated. To perform morphometric analysis, area within the lumen (LA) and within internal elastic lamina (IEL) was determined using Image J software (http://rsb.info.nih.gov/ij/) and percent area stenosis was calculated (% area stenosis= [1-(luminal area/IEL area)] X 100).

2.27 Immunohistochemistry Paraffin embedded samples, after deparafinization and rehydration, were treated by steam heating for antigen retrieval (20-30 min) using DAKO Antigen Retrieval Solution. Slides were washed using PBS twice 5 min each. Endogenous peroxidase was inhibited by immersing the slides in a 3% hydrogen peroxide solution for 20 min. Slides were then washed twice for 5 min in PBS. After preincubation with 10% serum for respective primary antibody (VECTASTAIN Elite ABC system) in PBS for 1 hr to avoid unspecific binding, the samples were incubated with the PCNA primary antibodies mouse anti-PCNA (F-2) (Santa Cruz Biotech.) overnight at 4°C. Dilutions (1:200) of antibodies were prepared with PBS at room temperature. Slides were washed twice in PBS and consecutively incubated with biotinylated secondary antibody for 1 hr. Slides were washed twice with PBS and incubated with ABC solution (Vectastain Elite ABC system) for 30 min. Slides were washed twice again with PBS and finally incubated with 86

diamino benzidine (Vector Laboratories,USA) for 1 min. Immediately after staining, slides were washed with distilled water for 5 min and counterstained with hematoxylin for 7 sec (Fischer Scientific,USA). Slides were rinsed for 5 min with distilled water and dehydrated for 3–5 min each with 70–100% isopropanol. Finally samples were immersed in xylene for 5 min each and mounted by using Permount (Fischer Scientific,USA). Sections incubated without the primary antibody served as negative controls. All immunostaining was examined using an inverted microscope (Olympus), images were captured and stored as jpg-files.

2.28 Immunofluorescence After deparaffinization and rehydration, antigen retrieval was performed prior to immunostaining. Sections were incubated for 2 hr in block/permeabilizing solutions containing PBS, 0.25 % Triton X-100, 0.1 BSA, and 5% (v/v) goat serum at room temperature. The slides were subsequently incubated with primary antibody solutions including mouse anti-smooth muscle alpha actin (α-SMA) ( Santacruz biotech.), rabbit anti-SOCS-3 (Abcam) (1:100 antibodies, PBS, 0.1% Triton X-100, 10 mg/ml BSA and 1% goat serum) at 4oC overnight. After washing with PBS containing 0.1 % BSA three times for 5 min each, a secondary antibody (affinity purified goat anti-mouse and goat anti-rabbit cyanine 3 (cy3) antibody, 1:200) (Jackson immune) was applied to the sections for 1 hr in the dark. Negative controls were run in parallel with normal host IgG including chromPure mouse IgG, and chromPure rabbit IgG or complete omission of primary antibody. Sections were washed with PBS three times for 5 min. Slides were mounted using VECTASHIELD HardSet Mounting Medium with DAPI (Vector 87

Laboratories, USA). A single layer of nail polish was placed around the edge of slide to prevent escape of mounting media from the coverslip. Pictures were taken within 1 hr of mounting using Olympus DP71 camera.

2.29 ELISA Serum concentrations of IFN-λ, IL-6, TNF-α were detected by using porcine IFNλ, porcine IL-6, and porcine TNF-α ELISA kits (Ray Biotech, Inc., Norcross, GA) respectively. The IL-10 levels were examined by using swine IL-10 ELISA kit (eBioscience, San Diego, CA). Samples (100 μl) were added to 96-well plates coated with anti-porcine IFN-λ, anti-porcine IL-6, anti-porcine TNF-α, and anti-porcine IL-10 and plates were incubated for 2.5 hr at room temperature. Plates were then washed four times with wash buffer, and the following reagents were added: biotinylated monoclonal antibodies to porcine IFN-γ, IL-6, TNF-α, or IL-10. Plates were incubated for 1 hr at room temperature. Horseradish peroxidase-conjugated streptavidin was added, and plates were incubated for 45 min at room temperature. Standard curves were generated using recombinant porcine IFN-γ, IL-6, TNF-α, and IL-10 and used to calculate levels in the samples using a computer-generated four-parameter curve-fit for each cytokine.

2.30 Statistical and sample size analysis In order to determine the statistical significance, data was analyzed using GraphPad Prism 5.0 biochemical statistical package (GraphPad Software, Inc., San Diego, CA). Values of all measurements were expressed as mean ± SEM. Statistical analysis was performed using two-tailed unpaired student t test or one-way ANOVA 88

with Bonferroni’s multiple comparison test to analyze statistically significant differences between groups. Differences at p or =60 y. Am J Clin Nutr 80: 752-758. 319. Bischoff-Ferrari HA, Dawson-Hughes B, Willett WC, Staehelin HB, Bazemore MG, et al. (2004) Effect of Vitamin D on falls: a meta-analysis. JAMA 291: 1999-2006. 320. Cantorna MT, Hayes CE, DeLuca HF (1996) 1,25-Dihydroxyvitamin D3 reversibly blocks the progression of relapsing encephalomyelitis, a model of multiple sclerosis. Proc Natl Acad Sci U S A 93: 7861-7864. 321. Cantorna MT, Hayes CE, DeLuca HF (1998) 1,25-Dihydroxycholecalciferol inhibits the progression of arthritis in murine models of human arthritis. J Nutr 128: 6872.

188

322.

Cantorna

MT,

Munsick

C,

Bemiss

C,

Mahon

BD

(2000)

1,25-

Dihydroxycholecalciferol prevents and ameliorates symptoms of experimental murine inflammatory bowel disease. J Nutr 130: 2648-2652. 323. Merlino LA, Curtis J, Mikuls TR, Cerhan JR, Criswell LA, et al. (2004) Vitamin D intake is inversely associated with rheumatoid arthritis: results from the Iowa Women's Health Study. Arthritis Rheum 50: 72-77. 324. Costenbader KH, Feskanich D, Holmes M, Karlson EW, Benito-Garcia E (2008) Vitamin D intake and risks of systemic lupus erythematosus and rheumatoid arthritis in women. Ann Rheum Dis 67: 530-535. 325. Munger KL, Levin LI, Hollis BW, Howard NS, Ascherio A (2006) Serum 25hydroxyvitamin D levels and risk of multiple sclerosis. JAMA 296: 2832-2838. 326. Froicu M, Cantorna MT (2007) Vitamin D and the vitamin D receptor are critical for control of the innate immune response to colonic injury. BMC Immunol 8: 5. 327. Froicu M, Weaver V, Wynn TA, McDowell MA, Welsh JE, et al. (2003) A crucial role for the vitamin D receptor in experimental inflammatory bowel diseases. Mol Endocrinol 17: 2386-2392. 328. Podolsky DK (1991) Inflammatory bowel disease (1). N Engl J Med 325: 928-937. 329. Podolsky DK (1991) Inflammatory bowel disease (2). N Engl J Med 325: 10081016. 330. Ulitsky A, Ananthakrishnan AN, Naik A, Skaros S, Zadvornova Y, et al. (2011) Vitamin D deficiency in patients with inflammatory bowel disease: association with disease activity and quality of life. JPEN J Parenter Enteral Nutr 35: 308316.

189

331. Andreassen H, Rungby J, Dahlerup JF, Mosekilde L (1997) Inflammatory bowel disease and osteoporosis. Scand J Gastroenterol 32: 1247-1255. 332. Andreassen H, Rix M, Brot C, Eskildsen P (1998) Regulators of calcium homeostasis and bone mineral density in patients with Crohn's disease. Scand J Gastroenterol 33: 1087-1093. 333. Tangpricha V, Spina C, Yao M, Chen TC, Wolfe MM, et al. (2005) Vitamin D deficiency enhances the growth of MC-26 colon cancer xenografts in Balb/c mice. J Nutr 135: 2350-2354. 334. Lappe JM, Travers-Gustafson D, Davies KM, Recker RR, Heaney RP (2007) Vitamin D and calcium supplementation reduces cancer risk: results of a randomized trial. Am J Clin Nutr 85: 1586-1591. 335. Garland CF, Gorham ED, Mohr SB, Grant WB, Giovannucci EL, et al. (2007) Vitamin D and prevention of breast cancer: pooled analysis. J Steroid Biochem Mol Biol 103: 708-711. 336. Garland CF, Comstock GW, Garland FC, Helsing KJ, Shaw EK, et al. (1989) Serum 25-hydroxyvitamin D and colon cancer: eight-year prospective study. Lancet 2: 1176-1178. 337. Wu K, Feskanich D, Fuchs CS, Willett WC, Hollis BW, et al. (2007) A nested case control study of plasma 25-hydroxyvitamin D concentrations and risk of colorectal cancer. J Natl Cancer Inst 99: 1120-1129. 338. Feskanich D, Ma J, Fuchs CS, Kirkner GJ, Hankinson SE, et al. (2004) Plasma vitamin D metabolites and risk of colorectal cancer in women. Cancer Epidemiol Biomarkers Prev 13: 1502-1508.

190

339. Ng K, Meyerhardt JA, Wu K, Feskanich D, Hollis BW, et al. (2008) Circulating 25hydroxyvitamin d levels and survival in patients with colorectal cancer. J Clin Oncol 26: 2984-2991. 340. Ahonen MH, Tenkanen L, Teppo L, Hakama M, Tuohimaa P (2000) Prostate cancer risk and prediagnostic serum 25-hydroxyvitamin D levels (Finland). Cancer Causes Control 11: 847-852. 341. Hanchette CL, Schwartz GG (1992) Geographic patterns of prostate cancer mortality. Evidence for a protective effect of ultraviolet radiation. Cancer 70: 2861-2869. 342. Lokeshwar BL, Schwartz GG, Selzer MG, Burnstein KL, Zhuang SH, et al. (1999) Inhibition of prostate cancer metastasis in vivo: a comparison of 1,23dihydroxyvitamin D (calcitriol) and EB1089. Cancer Epidemiol Biomarkers Prev 8: 241-248. 343. Getzenberg RH, Light BW, Lapco PE, Konety BR, Nangia AK, et al. (1997) Vitamin D inhibition of prostate adenocarcinoma growth and metastasis in the Dunning rat prostate model system. Urology 50: 999-1006. 344. Veldman CM, Cantorna MT, DeLuca HF (2000) Expression of 1,25dihydroxyvitamin D(3) receptor in the immune system. Arch Biochem Biophys 374: 334-338. 345. Brennan A, Katz DR, Nunn JD, Barker S, Hewison M, et al. (1987) Dendritic cells from human tissues express receptors for the immunoregulatory vitamin D3 metabolite, dihydroxycholecalciferol. Immunology 61: 457-461.

191

346. Sigmundsdottir H, Pan J, Debes GF, Alt C, Habtezion A, et al. (2007) DCs metabolize sunlight-induced vitamin D3 to 'program' T cell attraction to the epidermal chemokine CCL27. Nat Immunol 8: 285-293. 347. Banchereau J, Briere F, Caux C, Davoust J, Lebecque S, et al. (2000) Immunobiology of dendritic cells. Annu Rev Immunol 18: 767-811. 348. van Halteren AG, van Etten E, de Jong EC, Bouillon R, Roep BO, et al. (2002) Redirection of human autoreactive T-cells Upon interaction with dendritic cells modulated by TX527, an analog of 1,25 dihydroxyvitamin D(3). Diabetes 51: 21192125. 349. Berer A, Stockl J, Majdic O, Wagner T, Kollars M, et al. (2000) 1,25Dihydroxyvitamin D(3) inhibits dendritic cell differentiation and maturation in vitro. Exp Hematol 28: 575-583. 350. Bhalla AK, Amento EP, Serog B, Glimcher LH (1984) 1,25-Dihydroxyvitamin D3 inhibits antigen-induced T cell activation. J Immunol 133: 1748-1754. 351. Rigby WF, Stacy T, Fanger MW (1984) Inhibition of T lymphocyte mitogenesis by 1,25-dihydroxyvitamin D3 (calcitriol). J Clin Invest 74: 1451-1455. 352. Canning MO, Grotenhuis K, de Wit H, Ruwhof C, Drexhage HA (2001) 1-alpha,25Dihydroxyvitamin D3 (1,25(OH)(2)D(3)) hampers the maturation of fully active immature dendritic cells from monocytes. Eur J Endocrinol 145: 351-357. 353. Griffin MD, Lutz WH, Phan VA, Bachman LA, McKean DJ, et al. (2000) Potent inhibition of dendritic cell differentiation and maturation by vitamin D analogs. Biochem Biophys Res Commun 270: 701-708. 354. Jonuleit H, Schmitt E, Schuler G, Knop J, Enk AH (2000) Induction of interleukin 10-producing, nonproliferating CD4(+) T cells with regulatory properties by 192

repetitive stimulation with allogeneic immature human dendritic cells. J Exp Med 192: 1213-1222. 355. Griffin MD, Lutz W, Phan VA, Bachman LA, McKean DJ, et al. (2001) Dendritic cell modulation by 1alpha,25 dihydroxyvitamin D3 and its analogs: a vitamin D receptor-dependent pathway that promotes a persistent state of immaturity in vitro and in vivo. Proc Natl Acad Sci U S A 98: 6800-6805. 356. Mannon PJ, Fuss IJ, Mayer L, Elson CO, Sandborn WJ, et al. (2004) Antiinterleukin-12 antibody for active Crohn's disease. N Engl J Med 351: 2069-2079. 357. Marth T, Zeitz M, Ludviksson BR, Strober W, Kelsall BL (1999) Extinction of IL-12 signaling promotes Fas-mediated apoptosis of antigen-specific T cells. J Immunol 162: 7233-7240. 358. Lemire JM, Archer DC, Beck L, Spiegelberg HL (1995) Immunosuppressive actions of 1,25-dihydroxyvitamin D3: preferential inhibition of Th1 functions. J Nutr 125: 1704S-1708S. 359. Penna G, Adorini L (2000) 1 Alpha,25-dihydroxyvitamin D3 inhibits differentiation, maturation, activation, and survival of dendritic cells leading to impaired alloreactive T cell activation. J Immunol 164: 2405-2411. 360. Moore KW, de Waal Malefyt R, Coffman RL, O'Garra A (2001) Interleukin-10 and the interleukin-10 receptor. Annu Rev Immunol 19: 683-765. 361. Stio M, Martinesi M, Bruni S, Treves C, Mathieu C, et al. (2007) The Vitamin D analogue TX 527 blocks NF-kappaB activation in peripheral blood mononuclear cells of patients with Crohn's disease. J Steroid Biochem Mol Biol 103: 51-60. 362. Barrat FJ, Cua DJ, Boonstra A, Richards DF, Crain C, et al. (2002) In vitro generation of interleukin 10-producing regulatory CD4(+) T cells is induced by 193

immunosuppressive drugs and inhibited by T helper type 1 (Th1)- and Th2inducing cytokines. J Exp Med 195: 603-616. 363. Jirapongsananuruk O, Melamed I, Leung DY (2000) Additive immunosuppressive effects of 1,25-dihydroxyvitamin D3 and corticosteroids on TH1, but not TH2, responses. J Allergy Clin Immunol 106: 981-985. 364. Kunkel EJ, Butcher EC (2002) Chemokines and the tissue-specific migration of lymphocytes. Immunity 16: 1-4. 365. Zittermann A, Schleithoff SS, Koerfer R (2005) Putting cardiovascular disease and vitamin D insufficiency into perspective. Br J Nutr 94: 483-492. 366. Zittermann A, Scheld K, Stehle P (1998) Seasonal variations in vitamin D status and calcium absorption do not influence bone turnover in young women. Eur J Clin Nutr 52: 501-506. 367. Douglas AS, Dunnigan MG, Allan TM, Rawles JM (1995) Seasonal variation in coronary heart disease in Scotland. J Epidemiol Community Health 49: 575-582. 368. Grimes DS, Hindle E, Dyer T (1996) Sunlight, cholesterol and coronary heart disease. QJM 89: 579-589. 369. Rostand SG (1997) Ultraviolet light may contribute to geographic and racial blood pressure differences. Hypertension 30: 150-156. 370. Lee WP, Lin LW, Yeh SH, Liu RH, Tseng CF (2002) Correlations among serum calcium, vitamin D and parathyroid hormone levels in the elderly in southern Taiwan. J Nurs Res 10: 65-72. 371. Chen S, Law CS, Grigsby CL, Olsen K, Hong TT, et al. (2011) Cardiomyocyte-specific deletion of the vitamin D receptor gene results in cardiac hypertrophy. Circulation 124: 1838-1847. 194

372. Hypponen E, Power C (2006) Vitamin D status and glucose homeostasis in the 1958 British birth cohort: the role of obesity. Diabetes Care 29: 2244-2246. 373. Ford ES, Ajani UA, McGuire LC, Liu S (2005) Concentrations of serum vitamin D and the metabolic syndrome among U.S. adults. Diabetes Care 28: 1228-1230. 374. Pilz S, Tomaschitz A, Ritz E, Pieber TR (2009) Vitamin D status and arterial hypertension: a systematic review. Nat Rev Cardiol 6: 621-630. 375. Zittermann A, Schleithoff SS, Tenderich G, Berthold HK, Korfer R, et al. (2003) Low vitamin D status: a contributing factor in the pathogenesis of congestive heart failure? J Am Coll Cardiol 41: 105-112. 376. Poole KE, Loveridge N, Barker PJ, Halsall DJ, Rose C, et al. (2006) Reduced vitamin D in acute stroke. Stroke 37: 243-245. 377. Xiang W, Kong J, Chen S, Cao LP, Qiao G, et al. (2005) Cardiac hypertrophy in vitamin D receptor knockout mice: role of the systemic and cardiac reninangiotensin systems. Am J Physiol Endocrinol Metab 288: E125-132. 378. Young KA, Snell-Bergeon JK, Naik RG, Hokanson JE, Tarullo D, et al. (2011) Vitamin D deficiency and coronary artery calcification in subjects with type 1 diabetes. Diabetes Care 34: 454-458. 379. Wang L, Manson JE, Song Y, Sesso HD (2010) Systematic review: Vitamin D and calcium supplementation in prevention of cardiovascular events. Ann Intern Med 152: 315-323. 380. Bostick RM, Kushi LH, Wu Y, Meyer KA, Sellers TA, et al. (1999) Relation of calcium, vitamin D, and dairy food intake to ischemic heart disease mortality among postmenopausal women. Am J Epidemiol 149: 151-161.

195

381. Wang TJ, Pencina MJ, Booth SL, Jacques PF, Ingelsson E, et al. (2008) Vitamin D deficiency and risk of cardiovascular disease. Circulation 117: 503-511. 382. Rajasree S, Rajpal K, Kartha CC, Sarma PS, Kutty VR, et al. (2001) Serum 25hydroxyvitamin D3 levels are elevated in South Indian patients with ischemic heart disease. Eur J Epidemiol 17: 567-571. 383. Scragg R, Jackson R, Holdaway IM, Lim T, Beaglehole R (1990) Myocardial infarction is inversely associated with plasma 25-hydroxyvitamin D3 levels: a community-based study. Int J Epidemiol 19: 559-563. 384. Pittas AG, Chung M, Trikalinos T, Mitri J, Brendel M, et al. (2010) Systematic review: Vitamin D and cardiometabolic outcomes. Ann Intern Med 152: 307-314. 385. Elamin MB, Abu Elnour NO, Elamin KB, Fatourechi MM, Alkatib AA, et al. (2011) Vitamin D and cardiovascular outcomes: a systematic review and meta-analysis. J Clin Endocrinol Metab 96: 1931-1942. 386. Smith PK, Krohn RI, Hermanson GT, Mallia AK, Gartner FH, et al. (1985) Measurement of protein using bicinchoninic acid. Anal Biochem 150: 76-85. 387. Toutouzas K, Colombo A, Stefanadis C (2004) Inflammation and restenosis after percutaneous coronary interventions. Eur Heart J 25: 1679-1687. 388. Shah PK (2003) Inflammation, neointimal hyperplasia, and restenosis: as the leukocytes roll, the arteries thicken. Circulation 107: 2175-2177. 389. Serrano CV, Jr., Ramires JA, Venturinelli M, Arie S, D'Amico E, et al. (1997) Coronary angioplasty results in leukocyte and platelet activation with adhesion molecule expression. Evidence of inflammatory responses in coronary angioplasty. J Am Coll Cardiol 29: 1276-1283.

196

390. Michos ED, Melamed ML (2008) Vitamin D and cardiovascular disease risk. Curr Opin Clin Nutr Metab Care 11: 7-12. 391. Carrelli AL, Walker MD, Lowe H, McMahon DJ, Rundek T, et al. (2011) Vitamin D deficiency is associated with subclinical carotid atherosclerosis: the Northern Manhattan study. Stroke 42: 2240-2245. 392. Seol SH, Kim DI, Han YC, Kim KH, Kim DK, et al. (2009) Multiple sequential complications after sirolimus-eluting stent implantation: very late stent thrombosis, stent fracture, in-stent restenosis, and peri-stent aneurysm. Korean Circ J 39: 439-442. 393. Pilz S, Marz W, Wellnitz B, Seelhorst U, Fahrleitner-Pammer A, et al. (2008) Association of vitamin D deficiency with heart failure and sudden cardiac death in a large cross-sectional study of patients referred for coronary angiography. J Clin Endocrinol Metab 93: 3927-3935. 394. Vaidya A, Sun B, Larson C, Forman JP, Williams JS (2012) Vitamin D3 Therapy Corrects the Tissue Sensitivity to Angiotensin II Akin to the Action of a Converting Enzyme Inhibitor in Obese Hypertensives: An Interventional Study. J Clin Endocrinol Metab. 395. Forouhi NG, Ye Z, Rickard AP, Khaw KT, Luben R, et al. (2012) Circulating 25hydroxyvitamin D concentration and the risk of type 2 diabetes: results from the European Prospective Investigation into Cancer (EPIC)-Norfolk cohort and updated meta-analysis of prospective studies. Diabetologia. 396. Deluca HF, Cantorna MT (2001) Vitamin D: its role and uses in immunology. FASEB J 15: 2579-2585.

197

397. Chung I, Han G, Seshadri M, Gillard BM, Yu WD, et al. (2009) Role of vitamin D receptor in the antiproliferative effects of calcitriol in tumor-derived endothelial cells and tumor angiogenesis in vivo. Cancer Res 69: 967-975. 398. Wu-Wong JR (2007) Vitamin D receptor: a highly versatile nuclear receptor. Kidney Int 72: 237-239. 399. Jones G, Strugnell SA, DeLuca HF (1998) Current understanding of the molecular actions of vitamin D. Physiol Rev 78: 1193-1231. 400. Hewison M, Zehnder D, Bland R, Stewart PM (2000) 1alpha-Hydroxylase and the action of vitamin D. J Mol Endocrinol 25: 141-148. 401. Seifert M, Tilgen W, Reichrath J (2009) Expression of 25-hydroxyvitamin D1alpha-hydroxylase

(1alphaOHase,

CYP27B1)

splice

variants

in

HaCaT

keratinocytes and other skin cells: modulation by culture conditions and UV-B treatment in vitro. Anticancer Res 29: 3659-3667. 402. Adams JS, Hewison M (2012) Extrarenal expression of the 25-hydroxyvitamin D-1hydroxylase. Arch Biochem Biophys. 403. Smith DC, Johnson CS, Freeman CC, Muindi J, Wilson JW, et al. (1999) A Phase I trial of calcitriol (1,25-dihydroxycholecalciferol) in patients with advanced malignancy. Clin Cancer Res 5: 1339-1345. 404. Zittermann A (2003) Vitamin D in preventive medicine: are we ignoring the evidence? Br J Nutr 89: 552-572. 405. Chen S, Nakamura K, Gardner DG (2005) 1,25-dihydroxyvitamin D inhibits human ANP gene promoter activity. Regul Pept 128: 197-202.

198

406. Wu J, Garami M, Cao L, Li Q, Gardner DG (1995) 1,25(OH)2D3 suppresses expression and secretion of atrial natriuretic peptide from cardiac myocytes. Am J Physiol 268: E1108-1113. 407. Chen S, Olsen K, Grigsby C, Gardner DG (2007) Vitamin D activates type A natriuretic peptide receptor gene transcription in inner medullary collecting duct cells. Kidney Int 72: 300-306. 408. Manolagas SC, Yu XP, Girasole G, Bellido T (1994) Vitamin D and the hematolymphopoietic tissue: a 1994 update. Semin Nephrol 14: 129-143. 409. Cardus A, Gallego C, Muray S, Marco MP, Parisi E, et al. (2003) [Differential effect of vitamin D analogues on the proliferation of vascular smooth muscle cells]. Nefrologia 23 Suppl 2: 117-121. 410. Rajasree S, Umashankar PR, Lal AV, Sarma PS, Kartha CC (2002) 1,25dihydroxyvitamin D3 receptor is upregulated in aortic smooth muscle cells during hypervitaminosis D. Life Sci 70: 1777-1788. 411. Murayama A, Takeyama K, Kitanaka S, Kodera Y, Kawaguchi Y, et al. (1999) Positive and negative regulations of the renal 25-hydroxyvitamin D3 1alphahydroxylase gene by parathyroid hormone, calcitonin, and 1alpha,25(OH)2D3 in intact animals. Endocrinology 140: 2224-2231. 412. Kaufmann M, Prosser DE, Jones G (2011) Bioengineering anabolic vitamin D-25hydroxylase activity into the human vitamin D catabolic enzyme, cytochrome P450 CYP24A1, by a V391L mutation. J Biol Chem 286: 28729-28737. 413. Wu-Wong JR, Nakane M, Ma J, Ruan X, Kroeger PE (2006) Effects of Vitamin D analogs on gene expression profiling in human coronary artery smooth muscle cells. Atherosclerosis 186: 20-28. 199

414. Kenagy RD, Hart CE, Stetler-Stevenson WG, Clowes AW (1997) Primate smooth muscle cell migration from aortic explants is mediated by endogenous plateletderived growth factor and basic fibroblast growth factor acting through matrix metalloproteinases 2 and 9. Circulation 96: 3555-3560. 415. Chang Y, Uen YH, Chen CC, Lin SC, Tseng SY, et al. (2011) Platonin inhibited PDGF-BB-induced proliferation of rat vascular smooth muscle cells via JNK1/2dependent signaling. Acta Pharmacol Sin 32: 1337-1344. 416. Hedlund TE, Moffatt KA, Miller GJ (1996) Vitamin D receptor expression is required for growth modulation by 1 alpha,25-dihydroxyvitamin D3 in the human prostatic carcinoma cell line ALVA-31. J Steroid Biochem Mol Biol 58: 277-288. 417. Hedlund TE, Moffatt KA, Miller GJ (1996) Stable expression of the nuclear vitamin D receptor in the human prostatic carcinoma cell line JCA-1: evidence that the antiproliferative effects of 1 alpha, 25-dihydroxyvitamin D3 are mediated exclusively through the genomic signaling pathway. Endocrinology 137: 15541561. 418. Cospedal R, Abedi H, Zachary I (1999) Platelet-derived growth factor-BB (PDGFBB) regulation of migration and focal adhesion kinase phosphorylation in rabbit aortic vascular smooth muscle cells: roles of phosphatidylinositol 3-kinase and mitogen-activated protein kinases. Cardiovasc Res 41: 708-721. 419. Owens GK (1995) Regulation of differentiation of vascular smooth muscle cells. Physiol Rev 75: 487-517. 420. van der Loop FT, Gabbiani G, Kohnen G, Ramaekers FC, van Eys GJ (1997) Differentiation of smooth muscle cells in human blood vessels as defined by

200

smoothelin, a novel marker for the contractile phenotype. Arterioscler Thromb Vasc Biol 17: 665-671. 421. Kocher O, Gabbiani F, Gabbiani G, Reidy MA, Cokay MS, et al. (1991) Phenotypic features of smooth muscle cells during the evolution of experimental carotid artery intimal thickening. Biochemical and morphologic studies. Lab Invest 65: 459-470. 422. Millette E, Rauch BH, Kenagy RD, Daum G, Clowes AW (2006) Platelet-derived growth factor-BB transactivates the fibroblast growth factor receptor to induce proliferation in human smooth muscle cells. Trends Cardiovasc Med 16: 25-28. 423. Reitman JS, Mahley RW, Fry DL (1982) Yucatan miniature swine as a model for diet-induced atherosclerosis. Atherosclerosis 43: 119-132. 424. Tanaka H, Sukhova G, Schwartz D, Libby P (1996) Proliferating arterial smooth muscle cells after balloon injury express TNF-alpha but not interleukin-1 or basic fibroblast growth factor. Arterioscler Thromb Vasc Biol 16: 12-18. 425. Zimmerman MA, Selzman CH, Reznikov LL, Miller SA, Raeburn CD, et al. (2002) Lack of TNF-alpha attenuates intimal hyperplasia after mouse carotid artery injury. Am J Physiol Regul Integr Comp Physiol 283: R505-512. 426. Fernandez-Martin JL, Kurian S, Farmer P, Nanes MS (1998) Tumor necrosis factor activates a nuclear inhibitor of vitamin D and retinoid-X receptors. Mol Cell Endocrinol 141: 65-72. 427. Halloran BP, DeLuca HF (1981) Appearance of the intestinal cytosolic receptor for 1,25-dihydroxyvitamin D3 during neonatal development in the rat. J Biol Chem 256: 7338-7342.

201

428. Dokoh S, Donaldson CA, Haussler MR (1984) Influence of 1,25-dihydroxyvitamin D3 on cultured osteogenic sarcoma cells: correlation with the 1,25dihydroxyvitamin D3 receptor. Cancer Res 44: 2103-2109. 429. Szeto FL, Sun J, Kong J, Duan Y, Liao A, et al. (2007) Involvement of the vitamin D receptor in the regulation of NF-kappaB activity in fibroblasts. J Steroid Biochem Mol Biol 103: 563-566. 430. Brand K, Page S, Rogler G, Bartsch A, Brandl R, et al. (1996) Activated transcription factor nuclear factor-kappa B is present in the atherosclerotic lesion. J Clin Invest 97: 1715-1722. 431. Landry DB, Couper LL, Bryant SR, Lindner V (1997) Activation of the NF-kappa B and I kappa B system in smooth muscle cells after rat arterial injury. Induction of vascular cell adhesion molecule-1 and monocyte chemoattractant protein-1. Am J Pathol 151: 1085-1095. 432. Bourcier T, Sukhova G, Libby P (1997) The nuclear factor kappa-B signaling pathway participates in dysregulation of vascular smooth muscle cells in vitro and in human atherosclerosis. J Biol Chem 272: 15817-15824. 433. Miyake T, Aoki M, Morishita R (2008) Inhibition of anastomotic intimal hyperplasia using a chimeric decoy strategy against NFkappaB and E2F in a rabbit model. Cardiovasc Res 79: 706-714. 434. Wang YJ, Wang JT, Fan QX, Geng JG (2007) Andrographolide inhibits NFkappaBeta activation and attenuates neointimal hyperplasia in arterial restenosis. Cell Res 17: 933-941. 435. Schleithoff SS, Zittermann A, Tenderich G, Berthold HK, Stehle P, et al. (2006) Vitamin D supplementation improves cytokine profiles in patients with 202

congestive heart failure: a double-blind, randomized, placebo-controlled trial. Am J Clin Nutr 83: 754-759. 436. Thorand B, Zierer A, Huth C, Linseisen J, Meisinger C, et al. (2011) Effect of serum 25-hydroxyvitamin D on risk for type 2 diabetes may be partially mediated by subclinical inflammation: results from the MONICA/KORA Augsburg study. Diabetes Care 34: 2320-2322.

203

PEER-REVIEWED PUBLICATIONS 

Gupta GK, Agrawal DK. CpG oligodeoxynucleotides as TLR9 agonists: therapeutic application in allergy and asthma. BioDrugs. 2010; 24:225-235.



Gupta GK, Dhar K, Del Core MG, Hunter WJ, 3rd, Hatzoudis GI, Agrawal DK. Suppressor of cytokine signaling-3 and intimal hyperplasia in porcine coronary arteries following coronary intervention. Exp Mol Pathol. 2011; 91:346-352.



Gupta GK, Agrawal T, Delcore MG, Mohiuddin SM, Agrawal DK (2012) Vitamin D deficiency induces cardiac hypertrophy and inflammation in epicardial adipose tissue in hypercholesterolemic swine. Exp Mol Pathol 93: 82-90.



Agrawal T, Gupta GK, Agrawal DK. Calcitriol Decreases Expression of Importin α3 and Attenuates RelA Translocation in Human Bronchial Smooth Muscle Cells. Journal of Clinical Immunology.2012 (in press)(PMID: 22526597)



Agrawal T, Gupta GK, Agrawal DK (2012) Vitamin D deficiency decreases the expression of VDR and prohibitin in the lungs of mice with allergic airway inflammation. Exp Mol Pathol 93: 74-81.



Gupta GK, Agrawal T, Del Core MG, Hunter WJ, 3rd, Agrawal DK. Decreased expression of vitamin d receptors in neointimal lesions following coronary artery angioplasty in atherosclerotic swine. PloS one. 2012;7:e42789



Gupta GK, Agrawal T, Del Core MG, Hunter WJ, 3rd, Agrawal DK. Vitamin D Supplementation Reduces Restenosis Following Coronary Intervention in hypercholesterolemic swine. (Submitted)



Agrawal T, Gupta GK, Agrawal DK. Vitamin D Supplementation Reduces Airway Hyperresponsiveness and Allergic Airway Inflammation in a Murine Model. (Submitted)

ABSTRACTS AND POSTERS 

Gupta GK, Agrawal T, DelCore MG, Hunter WJ,III, and Agrawal DK. Vitamin D Deficiency Potentiates Restenosis Following Coronary Angioplasty in hypercholesterolemic swine. Accepted at Annual Arteriosclerosis, Thrombosis and Vascular Biology Meeting, 2012, Chicago, IL



Gupta GK, Agrawal T, DelCore MG, and Agrawal DK. Cardiac Hypertrophy and Epicardial Fat Inflammation in Vitamin D-Deficient and Hypercholesterolemic Swine Accepted at Annual Arteriosclerosis, Thrombosis and Vascular Biology Meeting, 2012, Chicago, IL



Gupta GK, Agrawal T, and Agrawal DK. Effect of Growth Factors on Vitamin D Receptor and its Role in Vitamin D-Mediated Growth Suppression in Porcine Coronary Artery Smooth Muscle Cells. Presented at Annual American Society for Bone and Mineral Research Meeting, 2011, San Diego, CA



Gupta GK, Agrawal T, and Agrawal DK. Effect of Calcitriol Treatment on Proliferation, Migration and Phenotypic Modulation in Porcine Coronary Artery Smooth Muscle Cells: A Novel Candidate for the therapy in Coronary Restenosis. Presented at Annual Arteriosclerosis, Thrombosis and Vascular Biology Meeting, 2011, Chicago, IL



Gupta GK, DelCore MG, Hatzoudis GI, Hunter WJ,III, and Agrawal DK. Vitamin D Receptor and Tumor Necrosis Factor- α Cross-talk in Percutaneous Transluminal Coronary Angioplasty-induced Intimal Hyperplasia . Presented at Annual Arteriosclerosis, Thrombosis and Vascular Biology Meeting, 2011, Chicago, IL



Agrawal DK, Gupta GK, Dhar K, Del Core MG, Hatzoudis GI, and Hunter WJ, III. Suppressor of Cytokine Signaling-3 and Intimal Hyperplasia in Porcine Coronary Arteries following Coronary Intervention. Presented at Annual European Atherosclerosis Society Meeting, 2011, Gothenburg, Sweden Hatzoudis GI, Agrawal A, Gupta GK, and Agrawal DK. Vitamin D and Circulating CD4+CD25+ Regulatory T cells in Patients with Sepsis. Presented at Annual Faculty Club Meeting,2010, Omaha, NE





DelCore MG, Gupta GK, and Agrawal DK. Circulating CD4+CD25+ Regulatory T cells and Vitamin D in Coronary Artery Disease. Presented at Annual Faculty Club Meeting,2010, Omaha, NE



Gupta GK, Agrawal DK: Effect of Calcitriol on Vitamin D Receptor, its Metabolizing Enzymes and Cell Proliferation in Porcine Coronary Artery Smooth Muscle Cells. Presented at Annual American Society for Bone and Mineral Research Meeting, 2010, Toronto, Canada

AWARDS 

First prize in poster presentation at Creighton University St. Albert's Day/University Research Day celebration , 2012



First prize in poster presentation at Creighton University St. Albert's Day/University Research Day celebration , 2011



First Prize in poster presentation at Faculty Club Research Meeting, Omaha, NE, 2010