UV Cross-Linking and Immunoprecipitation (CLIP)

Interest in RNA-protein interactions is booming as we begin to appreciate the role of RNA, not just in well-established processes such as transcription, splicing, and translation, but also in newer fields such as RNA interference and gene regulation by non-coding RNAs. CLIP is an antibody-based technique used to study RNA-protein interactions related to RNA immunoprecipitation (RIP), but differs from RIP in the use of UV radiation to cross-link RNA binding proteins to the RNA that they are bound to. This covalent bond is irreversible, allowing stringent purification conditions. Unlike RIP, CLIP provides information about the actual protein binding site on the RNA. Different types of CLIP exist, high-throughput sequencing-CLIP (HITS-CLIP), Photoactivatable-Ribonucleoside Enhanced CLIP (PAR-CLIP), and Individual CLIP (iCLIP). Here is a summary of the iCLIP protocol adapted from Konig et al. J. Vis. Exp. 2011. Konig, J., Zarnack, K., Rot, G., Curk, T., Kayikci, M. ., Zupan, B., Turner, D. J., Luscombe, N. M., Ule, J. “iCLIP Transcriptome-wide Mapping of Protein-RNA Interactions with Individual Nucleotide Resolution.” J. Vis. Exp. (50), e2638, DOI: 10.3791/2638 (2011).

Protocol summary 1.

UV irradiation to covalently cross-link in vivo Protein-RNA complexes.

2.

Cell lysis and partial RNA digestion.

3.

Immunoprecipitation (IP) and dephosphorylation to purify the protein of interest together with the bound RNA.

4.

Ligation of an RNA adapter to the 3' end of the RNA and radioactive labelling of the 5' end to allow for sequencespecific priming of reverse transcription.

5.

SDS-PAGE and membrane transfer to purify cross-linked protein-RNA complexes from free RNA.

6.

RNA isolation from the membrane by Proteinase K digestion of the protein to leave a polypeptide at the cross-link nucleotide.

7.

Reverse transcription (RT) that truncates at the remaining polypeptide and introduces two cleavable adapter regions and barcode sequences.

8.

Gel purification of cDNA by gel electrophoresis and size selection to remove free RT primer.

9.

Ligation of primer to the 5'end of the cDNA: Circularization and annealing of oligo-nucleotide to the cleavage site, then linearization to generate suitable templates for PCR amplification.

10. PCR amplification; high-throughput sequencing generates reads in which the barcode sequences are immediately followed by the last nucleotide of the cDNA. Since this nucleotide locates one position upstream of the cross-linked nucleotide, the binding site can be deduced with high resolution.

iCLIP protocol 1. UV cross-linking of tissue culture cells 1.1. Remove media and add ice-cold PBS to cells (e.g. use cells grown in a 10 cm plate for three experiments and add 6 ml PBS). 2

1.2. Remove lid, place on ice and irradiate once with 150 mJ/cm at 254 nm using a stratalinker. One or more negative controls should be maintained throughout the complete experiment. Knockout cells or tissue as well as non-cross-linked cells are good negative controls, while knockdown cells are not recommended.

Discover more at abcam.com/technical

1.3. Harvest cells with a cell scraper and transfer cell suspension to microtubes (e.g. 2 ml to each of three microtubes). 1.4. llet cells (spin at top speed for 10 sec at 4°C), then remove supernatant. 1.5. Snap-freeze cell pellets on dry ice and store at -80°C until use. Experiment could take up to a week. Avoid multiple cycles of freeze thaw. 1.6 Bead preparation 1.6.1 Add protein A (or protein G) beads (e.g. 100 µl magnetic beads per experiment) to a fresh microtube (use protein G beads for mouse or goat antibodies) and wash beads 2x with lysis buffer. 1.6.2 Resuspend beads in lysis buffer (100 µl), add antibody (2-10 µg) and rotate tubes at room temperature for 30-60 min. The amount of antibody required might need to be optimised. A no-antibody sample is a good negative control. 1.6.3. Wash beads 3x with lysis buffer (900 µl) and leave in the last wash until ready to proceed with the immunoprecipitation (step 3.1). If an antibody is working in IP, this is a good indication that it will work in CLIP. 2. Cell lysis and partial RNA digestion 2.1. Resuspend cell pellet in lysis buffer (1 ml) and transfer to 1.5 ml microtubes. 2.2. Add low RNase dilution (10 µl) and Turbo DNase (2 µl) to the cell lysate and incubate for exactly 3 min at 37°C, shaking at 1,100 rpm, then immediately transfer to ice. 2.3. Spin at 4°C at 22,000 g for 20 min and carefully collect the cleared supernatant (leave about 50 µl lysate with the pellet). Each member of the laboratory should use their own set of buffers and reagents to easier identify potential sources of contamination.Ideal conditions for the RNase digestions may need to be optimized for every new batch of RNase. 3. Immunoprecipitation and dephosphorylation of RNA 3'ends 3.1. Remove lysis buffer from the beads (step 1.1.3) and add cell lysate (from step 2.3). 3.2. Rotate the samples for 2 h at 4°C. 3.3. Discard the supernatant, wash beads 2x with high-salt buffer (900 µl) and then 2x with wash buffer (900 µl). Optimization and stringent washing conditions are very important. 3.4. Discard the supernatant, resuspend beads in PNK mix (20 µl) and incubate for 20 min at 37°C. 3.5. Add wash buffer (500 µl), wash 1x with high-salt buffer and then 2x with wash buffer. 4.

Linker ligation to RNA 3' ends and RNA 5' end labelling

4.1. Carefully remove the supernatant, resuspend beads in ligation mix A (20 µl) and incubate overnight at 16°C. 4.2. Add wash buffer (500 µl), wash 2x with high-salt buffer (1 ml) and then 2x with wash buffer (1 ml). 4.3. Remove the supernatant, resuspend beads in hot PNK mix (8 µl) and incubate for 5 min at 37°C. 4.4. Remove the hot PNK mix and resuspend beads in 1x SDS-PAGE loading buffer (20 µl).

Discover more at abcam.com/technical

4.5. Incubate on a thermomixer at 70°C for 10 min. 4.6. Immediately place on a magnet to precipitate the empty beads and load the supernatant on the gel (see step 5). 5.

SDS-PAGE and membrane transfer

5.1. Load samples as well as a pre-stained protein size marker (5 µl) on a precast 4-12% Bis-Tris gel, and run the gel for 50 min at 180 V in 1x MOPS running buffer (according to manufacturer's instructions). Gels with constant pH 7 are recommended. 5.2. Remove the gel front and discard as solid waste (contains free radioactive ATP). 5.3. Transfer the protein-RNA complexes from the gel to a nitrocellulose membrane using a wet transfer apparatus (transfer 1 h at 30 V depending on manufacturer's instructions). More information on SDS-PAGE and transfer can be found under our Western blot protocols ( 5.4. Following the transfer, rinse the membrane in PBS buffer, then wrap it in clingfilm and expose it to a film at -80°C for 30 min, 1h and then over night. A fluorescent sticker next to the membrane later allows to align the film and the membrane. The success of the experiment can be monitored at the autoradiograph of the protein-RNA complex after membrane transfer.

Figure 1: Schematic representation of a typical autoradiograph Control experiments should give no signal on autoradiograph. In the autoradiograph of the low-RNase samples, diffuse radioactivity should be seen above the molecular weight of the protein. For high-RNase samples, this radioactivity is focused closer to the molecular weight of the protein.

Discover more at abcam.com/technical

6.

RNA isolation

6.1. Isolate the protein-RNA complexes from the membrane using the autoradiograph from step 5.4 as a mask. Cut this piece of membrane into several small slices and place them into a 1.5 ml microtube. 6.2. Add PK buffer (200 µl) and proteinase K (10 µl) to the membrane pieces, and incubate shaking at 1,100 rpm for 20 min at 37°C. 6.3. Add PKurea buffer (200 µl) and incubate for 20 min at 37°C. 6.4. Collect the solution, add it together with RNA phenol/chloroform (400 µl) to a 2 ml Phase Lock Gel Heavy tube and incubate shaking at 1,100 rpm for 5 min at 30°C. 6.5. Separate the phases by spinning for 5 min at 13,000 rpm at room temperature. 6.6. Carefully transfer just the aqueous layer into a new tube. 6.7. Add glycoblue (0.5 µl) and 3 M sodium acetate pH 5.5 (40 µl) and mix. Then add 100% ethanol (1 ml), mix again and precipitate over night at -20°C. 7.

Reverse transcription

7.1. Spin for 20 min at 15,000 rpm at 4°C, then remove the supernatant and wash the pellet with 80% ethanol (0.5 ml). 7.2. Resuspend the pellet in RNA/primer mix (7.25 µl). For each experiment or replicate, use a different Rclip primer containing individual barcode sequences (see 11). 7.3. Incubate for 5 min at 70°C before cooling to 25°C. 7.4. Add RT mix (2.75 µl) and incubate 5 min at 25°C, 20 min at 42°C, 40 min at 50°C and 5 min at 80°C before cooling to 4°C. 7.5. Add TE buffer (90 µl), glycoblue (0.5 µl) and sodium acetate pH 5.5 (10 µl) and mix; then add 100% ethanol (250 µl), mix again and precipitate over night at -20°C. 8.

Gel purification of cDNA

8.1. Spin down and wash the samples (see 7.1), then resuspend the pellets in water (6 µl). 8.2. Add 2x TBE-urea loading buffer (6 µl) and heat samples to 80°C for 3 min directly before loading on a precast 6% TBE-urea gel. Also load a low molecular weight marker for subsequent cutting (see below). 8.3. Run the gel for 40 min at 180 V depending on manufacturer’s instructions. This leads to a reproducible migration pattern of cDNAs and dyes (light and dark blue) in the gel.

Discover more at abcam.com/technical

Figure 3: Schematic representation of migration pattern of cDNAs. 8.4. Use a razor blade to cut (red line) three bands of cDNA fractions at 120-200 nt (high (H)), 85-120 nt (medium (M)) and 70-85 nt (low (L)). Start by cutting in the middle of the light blue dye, divide the medium and low fractions and trim the high and low fractions. Use vertical cuts guided by the pockets and the dye to separate the different lanes (in this example 1-4). The marker lane (m) can be stained and imaged to control sizes after the cutting. Fragment sizes are indicated on the right. 8.5. Add TE (400 µl) and crush the gel slice into small pieces using a 1 ml syringe plunger. Incubate shaking at 1,100 rpm for 2 h at 37°C. 8.6. Place two 1 cm glass pre-filters into a Costar SpinX column and transfer the liquid portion of the sample to the column. Spin for 1 min at 13,000 rpm into a 1.5 ml tube. 8.7. Add glycoblue (0.5 µl) and sodium acetate pH 5.5 (40 µl), then mix the sample. Add 100% ethanol (1 ml), mix again and precipitate over night at -20°C. 9.

Ligation of primer to the 5'end of the cDNA

9.1. Spin down and wash the samples (see 7.1), then resuspend pellets in ligation mix B (8 µl) and incubate for 1 h at 60°C. 9.2. Add oligo annealing mix (30 µl) and incubate for 1 min at 95°C. Then decrease the temperature every 20 sec by 1°C until 25°C are reached. 9.3. Add BamHI (2 µl) and incubate for 30 min at 37°C. 9.4. Add TE (50 µl) and glycoblue (0.5 µl) and mix. Add sodium acetate pH 5.5 (10 µl) and mix, then add 100% ethanol (250 µl) and mix again, then precipitate over night at -20°C. Avoid contamination with PCR products from previous experiments by spatially separating pre- and post-PCR steps. Ideally, analysis of PCR products and all subsequent steps should be performed in a separate room.

Discover more at abcam.com/technical

10. PCR amplification 10.1. Spin down and wash the samples (see 7.1), then resuspend the pellet in water (19 µl). 10.2. Prepare the PCR mix and run PCR programme: 94°C for 2 min, [94°C for 15 sec, 65°C for 30 sec, 68°C for 30 sec]25-35 cycles, 68°C for 3 min, 4°C for ever. The primer sequences used are for solexa sequencing, other systems may require adjustment of the primers. 10.3. Mix PCR product (8 µl) with 5x TBE loading buffer (2 µl) and load on a precast 6% TBE gel. Stain the gel with Sybrgreen I and analyse the PCR products with a gel imager; this allows monitoring of the success of the experiment prior to sequencing of the iCLIP library. The gel image of the PCR products should show a size range that corresponds to the cDNA fraction (high, medium or low) purified in step 8.4. Note that the PCR primers P3Solexa and P5Solexa introduce an additional 76 nt to the size of the cDNA. Primer dimer product can appear at about 140 nt. 10.4. The barcode in the Rclip primers allow to multiplex different samples before submitting for high throughput solexa sequencing. 10.5. Submit 15 µl of the library for sequencing and store the rest. Tip : Control experiments should give no products after PCR amplification, and high-throughput sequencing of control libraries should return very few unique sequences. 11. Linker and primer sequences 11.1. Pre-adenylated 3' linker DNA (aliquots of 20 µM of the DNA adapter): L3 /5rApp/AGATCGGAAGAGCGGTTCAG/3ddC/ 11.2. Rclip reverse transcriptase primers with different barcodes (desalted and not gel-purified): Rclip1 Rclip2 Rclip3 Rclip4 Rclip5 Rclip6 Rclip7 Rclip8 Rclip9 Rclip10 Rclip11 Rclip12 Rclip13 Rclip14 Rclip15 Rclip16

X33NNAACCNNNAGATCGGAAGAGCGTCGTGgatcCTGAACCGC X33NNACAANNNAGATCGGAAGAGCGTCGTGgatcCTGAACCGC X33NNATTGNNNAGATCGGAAGAGCGTCGTGgatcCTGAACCGC X33NNAGGTNNNAGATCGGAAGAGCGTCGTGgatcCTGAACCGC X33NNCGCCNNNAGATCGGAAGAGCGTCGTGgatcCTGAACCGC X33NNCCGGNNNAGATCGGAAGAGCGTCGTGgatcCTGAACCGC X33NNCTAANNNAGATCGGAAGAGCGTCGTGgatcCTGAACCGC X33NNCATTNNNAGATCGGAAGAGCGTCGTGgatcCTGAACCGC X33NNGCCANNNAGATCGGAAGAGCGTCGTGgatcCTGAACCGC X33NNGACCNNNAGATCGGAAGAGCGTCGTGgatcCTGAACCGC X33NNGGTTNNNAGATCGGAAGAGCGTCGTGgatcCTGAACCGC X33NNGTGGNNNAGATCGGAAGAGCGTCGTGgatcCTGAACCGC X33NNTCCGNNNAGATCGGAAGAGCGTCGTGgatcCTGAACCGC X33NNTGCCNNNAGATCGGAAGAGCGTCGTGgatcCTGAACCGC X33NNTATTNNNAGATCGGAAGAGCGTCGTGgatcCTGAACCGC X33NNTTAANNNAGATCGGAAGAGCGTCGTGgatcCTGAACCGC

11.3. X33 = 5’ phosphate 11.4. Cut_oligo: GTTCAGGATCCACGACGCTCTTCaaaa 11.5. P5Solexa: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT 11.6. P3Solexa: CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT

Discover more at abcam.com/technical

12. Reagents Lysis buffer 50 mM Tris-HCl, pH 7.4 100 mM NaCl 1% NP-40 0.1% SDS 0.5% sodium deoxycholate Protease inhibitors (add fresh each time)

High salt buffer 50 mM Tris-HCl, pH 7.4 1 M NaCl 1 mM EDTA 1% NP-40 0.1% SDS 0.5% sodium deoxycholate

Low RNase dilution 1/500 RNase I dilutions for library preparation

High RNase dilution 1/50 RNase I dilutions to control for antibody specificity

Wash buffer 20 mM Tris-HCl, pH 7.4 10 mM MgCl2 0.2% Tween-20

PNK mix 15 µl water 4 µl 5x PNK pH 6.5 buffer [350 mM Tris-HCl, pH 6.5; 50 mM MgCl2; 25 mM dithiothreitol]; 0.5 µl PNK enzyme 0.5 µl RNasin

Ligation mix A 9 µl water 4 µl 4x ligation buffer [200 mM Tris-HCl; 40 mM MgCl2; 40 mM dithiothreitol] 1 µl RNA ligase 0.5 µl RNasin 1.5 µl pre-adenylated linker L3 [20 µM] 4 µl PEG400

Hot PNK mix 0.4 µl PNK 32 0.8 µl P-γ-ATP 0.8 µl 10x PNK buffer 6 µl water

PK buffer 100 mM Tris-HCl pH 7.4 50 mM NaCl 10 mM EDTA

PKurea buffer 100 mM Tris-HCl pH 7.4 50 mM NaCl 10 mM EDTA 7 M urea

RNA/primer mix 6.25 µl water 0.5 µl Rclip primer [0.5 pmol/µl] 0.5 µl dNTP mix [10 mM]

RT mix 2 µl 5x RT buffer 0.5 µl 0.1M DTT 0.25 µl Superscript III reverse transcriptase

Ligation mix B 6.5 µl water 0.8 µl 10x CircLigase Buffer II 0.4 µl 50 mM MnCl2 0.3 µl Circligase II

Oligo annealing mix 26 µl water 3 µl FastDigest Buffer 1 µl cut oligo [10 µM]

PCR mix 19 µl cDNA 1 µl primer mix P5/P3 solexa 10 µM each 20 µl Accuprime Supermix 1 enzyme

Useful references: Further information on the iCLIP protocol can be found at Konig, J., Zarnack, K., Rot, G., Curk, T., Kayikci, M. ., Zupan, B., Turner, D. J., Luscombe, N. M., Ule, J. “iCLIP - Transcriptome-wide Mapping of Protein-RNA Interactions with Individual Nucleotide Resolution.” J. Vis. Exp. (50), e2638, DOI: 10.3791/2638 (2011).

Discover more at abcam.com/technical