JOURNAL OF CLINICAL MICROBIOLOGY, Mar. 2009, p. 533–540 0095-1137/09/$08.00⫹0 doi:10.1128/JCM.01565-08 Copyright © 2009, American Society for Microbiology. All Rights Reserved.

Vol. 47, No. 3

Utilization of Microsatellite Polymorphism for Differentiating Herpes Simplex Virus Type 1 Strains䌤† C. Deback,1,2* D. Boutolleau,1,2 C. Depienne,3 C. E. Luyt,4 P. Bonnafous,1,2 A. Gautheret-Dejean,1,2,5 I. Garrigue,6 and H. Agut1,2 UPMC Universite´ Paris 06, UPRES EA 2387, Paris F-75013, France1; Service de Virologie, Groupe Hospitalier Pitie´-Salpeˆtrie`re, AP-HP, Paris F-75013, France2; De´partement de Ge´ne´tique et de Cytoge´ne´tique, Centre de Ge´ne´tique Mole´culaire et Chromosomique, Groupe Hospitalier Pitie´-Salpeˆtrie`re, AP-HP, Paris F-75013, France3; Service de Re´animation Me´dicale, Institut de Cardiologie, Groupe Hospitalier Pitie´-Salpeˆtrie`re, AP-HP, Paris F-75013, France4; Laboratoire de Microbiologie, UPRES EA 4065, Universite´ Paris Descartes, Faculte´ des Sciences Pharmaceutiques et Biologiques, Paris F-75006 France5; and Laboratoire de Virologie EA2968 and IFR66, Universite´ Bordeaux 2, Bordeaux F-33076, France6 Received 12 August 2008/Returned for modification 10 October 2008/Accepted 17 December 2008

The herpes simplex virus type 1 (HSV-1) genome is a linear double-stranded DNA of 152 kpb. It is divided into long and short regions of unique sequences termed UL and US, respectively, and these are flanked by regions of inverted internal and terminal repeats. Microsatellites are short tandem repeats of 1- to 6-nucleotide motifs; they are often highly variable and polymorphic within the genome, which raises the question of whether they may be used as molecular markers for the precise differentiation of HSV-1 strains. In this study, 79 different microsatellites (mono-, di-, and trinucleotide repeats) in the HSV-1 complete genome were identified by in silico analysis. Among those microsatellites, 45 were found to be distributed in intergenic or noncoding inverted repeat regions, while 34 were in open reading frames. Length polymorphism analysis of the PCR products was used to investigate a set of 12 distinct HSV-1 strains and allowed the identification of 23 polymorphic and 6 monomorphic microsatellites, including two polymorphic trinucleotide repeats (CGT and GGA) within the UL46 and US4 genes, respectively. A multiplex PCR method that amplified 10 polymorphic microsatellites was then developed for the rapid and accurate genetic characterization of HSV-1 strains. Each HSV-1 strain was characterized by its own microsatellite haplotype, which proved to be stable over time in cell culture. This relevant innovative tool was successfully applied both to confirm the close relationship between sequential HSV-1 isolates collected from patients with multiple recurrent infections and to investigate putative nosocomial infections. cum. Eczema herpeticum, or Kaposi-Juliusberg disease, is an uncommon herpes simplex virus superinfection that occurs in patients with atopic dermatitis. Additionally, HSV-1 accounts for about half of the new cases of genital herpes in developed countries (14). The HSV-1 genome is a linear double-strand DNA molecule of 152,261 bp (strain 17, GenBank accession number X14112) that encodes at least 77 genes (24, 28). It is composed of two covalently linked regions of unique sequences, termed the unique long (UL) and unique short (US) sequences, which are bracketed by inverted repeats. Moreover, HSV-1 US and UL undergo inversions resulting from recombination events that yield four genomic isomers in equimolar accounts (17). The differentiation of unrelated HSV-1 strains has been used to trace the spread of infection in cases of nosocomial outbreaks (1, 6, 16); pathogenesis investigations (31, 32); and epidemiological studies, which also suggest that HSV-1 strains among the same geographic or ethnic groups are evolutionarily more closely related (5, 37, 39). HSV-1 strains differ slightly in their DNA sequences, which are used as molecular markers of genomic polymorphism. The method generally used to differentiate HSV-1 strains is restriction fragment length polymorphism (RFLP) analysis of total HSV-1 DNA (4, 7, 26, 36) or RFLP-PCR-based analysis (23, 49, 53). Determination of the nucleotide sequences of PCR-amplified DNA fragments encompassing reiterated regions (33) is another approach currently used to characterize the genomes of HSV-1 strains.

Herpes simplex virus type 1 (HSV-1) is a member of the subfamily Alphaherpesvirinae. The seroprevalence of HSV-1 infection increases progressively from childhood and is inversely proportional to an individual’s socioeconomic background (35). Primary HSV-1 infections in children are typically asymptomatic but can give rise to herpetic gingivostomatitis. After primary infection of the orofacial region, HSV-1 is transported in a retrograde manner to the nuclei of the trigeminal sensory neurons through their axons, which innervate the infected area. HSV-1 then establishes a life-long latent infection in the nuclei of sensory neurons, where the genome lies in a nonreplicating chromatin-associated state. Recurrent HSV-1 lesions occur following the reactivation of latent HSV-1, axonal transport of the reactivated virus, and HSV-1 replication on the skin and mucous membranes. Recurrent infections typically give rise to herpes labialis or may be responsible for more severe clinical manifestations, including keratitis, meningoencephalitis, bronchopneumonitis (22), chronic or disseminated infections in immunosuppressed patients, or eczema herpeti-

* Corresponding author. Mailing address: Service de Virologie, CERVI, Groupe Hospitalier Pitie´-Salpeˆtrie`re AP-HP, 47-83 Boulevard de l’Ho ˆpital, Paris 75013, France. Phone: 33 1 42 17 74 02. Fax: 33 1 42 17 74 11. E-mail: [email protected]. † Supplemental material for this article may be found at http://jcm .asm.org/. 䌤 Published ahead of print on 24 December 2008. 533

534

DEBACK ET AL.

Differences in the sizes of specific fragments among strains are detected in a PCR-based assay and are attributed to a variation in copy numbers or in the nucleotide sequences of these hypervariable reiterations, which have been identified within the ICP34.5 gene (8), the “a” sequence (10), the US10 and US11 genes, the introns of the US1 and US12 genes (23, 47, 48), and the glycoprotein G (gG) and gI genes (27). Microsatellites are short tandem repeats of 1 to 6 bp and are the most mutable DNA sequences found in eukaryote, prokaryote, and some virus genomes, particularly in intergenic regions and introns (11, 43). While they are hypermutable, microsatellites have been used as molecular markers in numerous ecology, evolutionary genetics, and genome mapping studies. Moreover, the instability of these microsatellites, which are mainly homopolymer nucleotide repeats, may improve frameshift mutations that provide phenotypic changes and an adaptive advantage in the evolution of some mutated viral strains (12). The identification and genetic mapping of highly polymorphic microsatellite loci in human cytomegalovirus (HCMV) have been reported previously (9). Therefore, microsatellite polymorphism analysis proved to be a rapid and accurate tool for studying the epidemiology of HCMV infections (29, 51). To our knowledge, this strategy has never been applied to HSV-1 infections. The aim of our study was to establish the map and characterize the short microsatellites within the full-length HSV-1 genome and to confirm the utility of microsatellites as precise molecular markers for the differentiation of HSV-1 strains. MATERIALS AND METHODS Cells and virus strains. Vero cells (African green monkey kidney cells) and human embryonic lung fibroblasts (MRC5 cells) were propagated in minimum essential medium (GIBCO, Cergy, France) supplemented with 3% fetal bovine serum (GIBCO), amikacin (20 ␮g/ml; Bristol-Myers Squibb, Rueil-Malmaison, France), vancomycin (20 ␮g/ml; Lilly, Suresnes, France), glutamine (1%; Eurobio, Courtaboeuf, France), and a nonessential amino acid solution (1%; Sigma, Saint-Quentin Fallavier, France), referred to hereafter as the culture medium. A total of 21 isolates and one laboratory strain (strain KOS) were used in this study. The clinical isolates were obtained on Vero cells from oral, bronchoalveolar lavage, or cutaneous specimens from unrelated patients submitted for the diagnosis of clinical herpes reactivations. Determination of the HSV type of each strain was performed by means of an immunofluorescence assay with specific monoclonal antibodies, as described previously (44). Microsatellite identification. The MsatFinder program was used to search the HSV-1 whole-genome sequence data (strain 17, GenBank accession number X14112) for microsatellites (45). The output results were filtered to include only short microsatellites with at least four trinucleotide, five dinucleotide, or nine mononucleotide repeats units, as previously described by Davis et al. (9). Microsatellite characterization by sequencing. DNA was extracted from HSV1-infected cells exhibiting a full cytopathic effect by using a QIamp DNA blood kit (Qiagen, Courtaboeuf, France), according to the manufacturer’s instructions. We analyzed 29 microsatellites using 25 PCR primer pairs (Table 1). PCRs containing a reaction mixture with 1⫻ buffer (Invitrogen), 2 mM MgCl2, 0.2 mM each deoxynucleoside triphosphate, 200 nM each forward and reverse primers, and 0.2 U of proofreading Taq polymerase (Platinum, Invitrogen) were performed in a Mastercycler ep thermal cycler (Eppendorf, France). The reaction conditions were 1 cycle of denaturation (2 min at 96°C), 30 cycles (30 s at 96°C, 60 s at 55°C, 60 s at 68°C), and a final elongation step (10 min at 68°C). Negative controls were included in each run, and the specificity of the PCR was evaluated by including in each PCR run DNA extracted from noninfected Vero and MRC5 cells. Sequencing was carried out on a 3100 ABI sequencer, and all reported sequences were determined twice in each direction. Before sequencing of the PCR products, they were purified by using a Microcon kit (Millipore). Microsatellite characterization by length polymorphism analysis. Each PCR was performed as described above by using a forward primer that was labeled at the 5⬘ end with a fluorescent phosphoramidite dye (6-carboxyfluorescein). One

J. CLIN. MICROBIOL. microliter of each PCR product was diluted with distilled water (1:300) and prepared by adding 0.5 ␮l of an internal size standard (GeneScan-500 ROX or GeneScan-600 ROX; Applied Biosystems) and highly purified deionized formamide (Applied Biosystems) for a final volume of 16 ␮l. One previously sized control sample was amplified and run on each gel to ensure that the amplicons were sized correctly. All products were analyzed on 3730 ABI sequencer (Applied Biosystems), according to the manufacturer’s instructions. Fragment sizing was performed by using GeneMapper software (version 4.0; Applied Biosystems). Multiplex PCR. Ten primer pairs that were able to be multiplexed into the same PCR run and that were able to produce amplicons simultaneously analyzable within a single gel lane were then selected (Table 1). Multiplex PCRs were performed in a Mastercycler ep thermal cycler (Eppendorf) with a PCR mixture containing 0.7⫻ buffer (Invitrogen); 4 mM MgCl2; 0.2 mM each deoxynucleoside triphosphate; 240 nM primer M69; 400 nM primers M5 and M22; 500 nM primer M23; 600 nM primers M30, M10, M41, M26, and M31/32; 1 ␮M primer M14; and 0.3 U of proofreading Taq polymerase (Platinum; Invitrogen). The reaction conditions were 1 cycle of denaturation (2 min at 96°C), 30 cycles (30 s at 96°C, 60 s at 65°C, 60 s at 72°C), and a final elongation step (10 min at 72°C). The multiplex PCR products were prepared as described above. The specificity of the multiplex PCR was confirmed by comparing the amplicons obtained by multiplex PCR with those obtained by means of single PCRs whose products were secondarily pooled for capillary electrophoresis. The sizes of the amplicons were determined by using an internal size standard (GeneScan-500 ROX; Applied Biosystems), as described above.

RESULTS Short microsatellite distribution in the complete sequence of HSV-1 genome. The in silico analysis by use of the MsatFinder algorithm revealed that the HSV-1 genome (strain 17, GenBank accession number X14112) contained at least 79 targeted short repeat sites (arbitrarily numbered HSV1-M1 to HSV1-M79), including 35 mononucleotide repeat units, 16 dinucleotide repeats, and 28 trinucleotide repeats (Fig. 1). As expected, they were mainly localized in noncoding sequences, including terminal repeat regions (TRL, TRS) and inverted internal repeat regions (IRL, IRS) as well as intergenic regions, while 34 were in open reading frames (Fig. 1). The maximum number of repeat units of dinucleotide or trinucleotide motif was 6 [M33-(GC)6 and M41-(CGT)6], while the longest mononucleotide tract was 15 bases [M70-(C)15] (Table 2). Among these microsatellites, 29 were selected and 25 primer pairs were designed in order to synthesize amplicons containing these target repeats (Table 1). Characterization of HSV-1 microsatellites. We first surveyed the 29 selected microsatellites in strain KOS and 11 HSV-1 clinical isolates (isolates A to K) using the 25 different PCR primer pairs separately (Table 1). The study of the corresponding amplified fragments by means of capillary electrophoresis showed that 19 of these loci were polymorphic, with microsatellites M24, M28, M33, M36, M39, and M42 being monomorphic among the panel of HSV-1 isolates tested. The polymorphic alleles are presented in Table S1 in the supplemental material. At the same time, the variability of each microsatellite was confirmed by sequencing methods. As expected, mononucleotide repeats were more variable, with 5 to 7 variants detected among the 12 strains tested. M21, M39, and M51 were considered impure microsatellites since they presented polymorphisms in both their lengths and sequences. Polymorphic trinucleotide microsatellites were found within two protein-coding genes: M41(CGT)6, which encodes a stretch of aspartic acid residues within the UL46 gene, which encodes the tegument protein, and M69(GGA)4, which codes

VOL. 47, 2009

HSV-1 MICROSATELLITES

535

TABLE 1. Characteristics of amplicons containing HSV-1 microsatellite sequences Microsatellite namea

a

Primer sequenceb

Expected sizec (bp)

Target repeat

Positiond

Locuse

No. of variantsf

HSV1-M5

F, ATACACATGGCCCCTTTGAC R, CAGGGAAACACCCAGACATC

477

(G)9

2997–3005

RL2

7

HSV1-M10

F, CTATAGGGCAACAAAGGATGG R, CTGTGATTCTCTGGCTGCAC

174

(G)11

6181–6191

TRL

6

HSV1-M11

F, TCCTCCGTATCCTCGCTTTA R, CAATGACCCACGTACTCCAA

182

(C)10

6561–6570

TRL

7

HSV1-M14

F, ACCACGTGGGTAGGTGATGT R, AGAAAGGCCCAGAGTCATTG

229

(G)10

7794–7803

TRL

5

HSV1–20/21

F, TTCGGGTCGTTATTCAGTCC R, ACCTGCTGGTAGAGGTGCTG

396

(C)10 (G)11

11668–11677 11772–11782

Inter-UL3-UL4

8 (2)

HSV1-M22

F, GTAATGGCGCTGACGCTCT R, CGGTGAACTTTAGCACCCTA

300

(G)10

20563–20572

Inter-UL8-UL9

6

HSV1-M23

F, CGCCGTTGGTAGCTGTTT R, GGAGGTCGTCTCGCTGAC

410

(C)13

24717–24729

Inter-UL10-UL11

7

HSV1-M24

F, GACTCCATTTCCGAGACGAC R, GGTTTCCCGGTTACCAGTATT

398

(TG)5

27053–27062

UL13

1

HSV1-M25

F, TATTCCGGAAAACGGAACG R, GGCATCCAGGGAGAAACC

369

(G)12

34869–34880

Inter-UL15-UL18

5

HSV1-M26

F, CAAGGTCCACCGAAAGACAC R, TTTATCGCCACCAACCAAAT

378

(C)11

40797–40807

Inter-UL19-UL20

5

HSV1-M28

F, GAACTGGGCGTAGTTCGTG R, TGTTGAGATCCCCAGGTAGG

386

(GC)5

45585–45594

UL22

1

HSV1-M30

F, GGAGCTGGGTTAGCGTTT R, CTCCTCCATCCGGTCTCC

143

(T)11

50769–50779

Inter-UL25-UL26

7

HSV1-M31/32

F, GCCGATTTGTTCGTCTCTCA R, ACACCCAAGTTCCCAACAAA

452

(G)12 (CA)5

52880–52891 52991–53000

Inter-UL26.5-UL27

9

HSV1-M33

F, CACGTTCTCGACGCTGTAAT R, CTGACGAAGCGGTCGTTG

384

(GC)6

56495–56506

UL28

1

HSV1-M34

F, GGGACCTTGATGGTGGTTG R, GCACCTGACCGTAAGCATCT

294

(G)9

62142–62150

Inter-UL29-UL30

6

HSV1-M36

F, GGCACACCAGACACCAAAG R, CTCGCGTCTGACGACTCC

479

(GC)5

72495–72504

UL36

1

HSV1-M38

F, TTCCCCTGATTAGGCTACGA R, GTCGAGGACGACGAGATGAT

223

(C)11

80640–80650

Inter-UL36-UL37

7

HSV1-M39

F, GCCATTACCTCTCGGATGG R, GAAGCTGCTGTCGGGAGAC

243

(CG)5

81328–81337

UL37

1 (2)

HSV1-M41

F, CACGCAGACGTTTTCGTAGA R, GCCACGTATTACACGCACAT

369

(CGT)6

99188–99205

UL46

2

HSV1-M42

F, CTGCGGTTCAGCTCCTGT R, GCACAGGTCAAAGTAGGCAAC

248

(ACG)4

111131–111142

UL52

1

HSV1-M48

F, ACTCACAAGCGGCAGAGG R, ACCACGTGGGTAGGTGATGT

248

(C)10

118568–118577

IRL

5

HSV1-M49/50

F, ATGAACACTCGGGGTTACCG R, GCAGGTGTCTAACCTACCTGGA

297

(T)9 (C)10

119301–119309 119356–119365

IRL

5

HSV1-M51/52

F, CAATGACCCACGTACTCCAA R, CTATAGGGCAACAAAGGATGG

581

(G)10 (C)11

119801–119810 120180–120190

IRL

8 (2)

HSV1-M69

F, GTTCCCACCAACGTCTCCT R, GGACTGGGGTAGGGTGTCA

246

(GGA)4

136977–136988

US4

2

HSV1-M70

F, GCATGTCTGCTTGAGCTCCT R, CTGGTTAGCCCGGTGTTGT

242

(C)15

138013–138027

Inter-US5-US6

5

The 10 microsatellites in boldface are those that were selected for testing by multiplex PCR. F, forward; R, reverse. Expected length of the PCR fragment according to the annotation of the reference HSV-1 complete sequence (strain 17, GenBank accession number X14112). d According the annotation of the same reference sequence. e A gene name in italics indicates that the target repeat was located within an open reading frame, according to the annotation of the same reference sequence. f Number of variant alleles among the panel of the first 12 HSV-1 strains studied, as determined by both length analysis and nucleotide sequencing. M21, M39, and M51 were considered impure microsatellites, since some strains presented both length and sequence polymorphisms. The numbers in parentheses indicate the number of sequence variants. b c

536

DEBACK ET AL.

J. CLIN. MICROBIOL.

FIG. 1. Linear map of genomic distribution of HSV-1 microsatellites. The linear double-stranded DNA is represented with the nucleotide scale at the bottom according to the sequence of strain 17 (GenBank accession number X14112). The unique UL and US sequences are shown as heavy solid lines, and the terminal and internal inverted repeats (TRL, IRL, IRS, and TRS) are shown as hatched boxes. The open reading frames on both the forward and the reverse strands are represented by open arrows. Each vertical line represents one microsatellite locus; the dotted lines and the dashed lines represent monomorphic and polymorphic microsatellites in the samples tested, respectively. This map is restricted to sites with at least four trinucleotide, five dinucleotide, or nine mononucleotide repeats units.

for a polyglutamyl stretch within US4, which encodes virion gG (Table 1). At these two sites, two variant sequences were found among all strains tested in this study (Fig. 2). From this preliminary analysis, it was concluded that short microsatellites corresponding to mono-, di-, and trinucleotide repeats were highly polymorphic in the HSV-1 genome and can be consid-

ered potential molecular markers for the precise differentiation of HSV-1 strains. Microsatellite haplotypes obtained by multiplex assay for different HSV-1 strains. Ten primer pairs amplifying polymorphic sites that could be multiplexed in the same PCR run were chosen in order to facilitate the rapid differentiation of HSV-1

TABLE 2. Determination of microsatellite haplotypes for strain KOS and the 21 clinical isolates studied Straina

Length (bp) of the following allele: Site

Date (mo/day/yr)

KOS Clinical isolates R K B G L1 L2 F I N1 N2 O1 O2 H D A J C E P1 P2 Q a

Face Throat Throat Throat Lip Cornea Throat Throat Mouth Mouth Tongue Lip Lip Lip Throat Throat Throat Throat Nose Lip Genitals

11/20/2006 09/12/2005 10/10/2005 05/12/2005 10/17/2005 12/14/2005 04/15/2005 04/13/2005 10/03/2007 11/10/2007 04/23/2007 05/18/2007 01/14/2005 04/20/2005 01/10/2005 11/12/2005 12/22/2004 04/04/2005 03/07/2007 03/19/2007 11/20/2006

M30

M10

M14

M69

M22

M41

M26

M23

M31/32

M5

162

170

225

245

296

366

371

400

456

471

137 138 138 138 138 138 139 139 140 140 140 140 140 140 140 141 147 149 157 157 158

174 172 174 174 175 175 171 172 170 170 171 171 172 173 173 166 174 173 172 172 170

228 229 225 226 226 226 224 223 224 224 227 227 225 224 225 223 224 226 229 229 224

245 242 242 245 245 245 245 242 245 245 245 245 245 242 242 242 242 242 245 245 245

297 294 303 294 297 297 296 297 295 295 294 294 297 296 303 293 295 297 296 296 295

366 366 363 366 366 366 366 363 366 366 363 363 363 366 363 363 363 366 366 366 366

371 374 370 372 371 371 371 370 374 374 369 369 372 371 370 374 369 370 371 371 374

403 400 408 400 401 401 400 406 406 406 407 407 400 410 411 405 403 411 409 409 406

447 459 450 459 459 459 460 452 450 450 448 448 458 448 452 449 456 457 451 451 449

469 471 469 470 469 469 470 474 473 473 474 474 473 469 470 476 472 471 475 475 472

Strain pairs L1-L2, N1-N2, O1-O2, and P1-P2 were obtained from the same patient at two different times.

VOL. 47, 2009

HSV-1 MICROSATELLITES

537

FIG. 2. Sequences of two polymorphic trinucleotide microsatellites present in HSV-1 genes. (A) Microsatellite analysis of M41(CGT)6, which codes for a stretch of aspartic acid residues (residues 582 to 587) within the UL46 gene, showed two variants, M41(CGT)6 and M41(CGT)5, that led to alleles 366 and 363, respectively. The two variants represented 70% and 30% of the HSV-1 strains tested in this study, respectively. (B) Microsatellite analysis of M69(GGA)4, which codes for a polyglutamyl stretch (residues 79 to 82) within the US4 gene showed two variants, M69(GGA)4 and M69(GGA)5, that led to alleles 242 and 245, respectively. The two variants represented 42% and 58% of the HSV-1 strains tested in this study, respectively.

strains by their microsatellite haplotypes (Table 1). In the present study, the haplotype was defined as the combination of the lengths of the 10 PCR products obtained from the multiplex PCR assay and analyzed by polyacrylamide capillary electrophoresis (Fig. 3). The optimization of the multiplex reaction conditions led to the final definition of the technique described in Materials and Methods. The interassay reproducibility of

the multiplex PCR was assessed by amplifying sample A in 50 independent reactions, and no variation in the haplotype was observed. The microsatellite haplotypes of the 21 clinical isolates and strain KOS are presented in Table 2. As expected, the haplotypes corresponding to distinct HSV-1 isolates obtained from different individuals were all different. Considering the number of variants described for each of these 10 microsatel-

FIG. 3. Electropherograms of multiplex PCR products illustrating the haplotype characteristics used to differentiate the HSV-1 strains. The haplotype was defined as the combination of the lengths of 10 amplicons labeled at the 5⬘ end with 6-carboxyfluorescein and containing HSV-1 microsatellite sequences obtained from the multiplex assay and analyzed by polyacrylamide capillary electrophoresis. The numbers 100 to 500 indicate the sizes (in base pairs) of the PCR amplicons. The haplotypes of strain B (top panel) and strain F (bottom panel) represented here display the length polymorphisms for the 10 loci.

538

DEBACK ET AL.

lites, it was computed that this strategy would be able, in theory, to identify more than 107 different haplotypes. Therefore, the multiplex assay was found to be simple, reproducible, and highly discriminative. The stability of the microsatellites was investigated by prolonged serial propagation of HSV-1 in cell cultures. Strain KOS and four clinical isolates (isolates A, B, C, and F) were plaque purified three times and were then serially propagated for 15 passages on Vero cells. In order to take the impact of the cellular environment into account, we also used different cellular systems. For that purpose, two strains (strains KOS and A) were propagated in separate trials: on Vero cells alone, on human MRC5 fibroblasts alone, and under a third condition that used the repetitive rotation of Vero and MRC5 cells. At each of the 15 passages and in the contexts of the different host cells, the microsatellite haplotypes of the strains were analyzed. No variation was observed, with each of the five strains keeping its own haplotype, depicted in Table 2, at each passage (data not shown). These data suggest that the HSV-1 microsatellites remained stable during viral replication. This led us to conclude that the multiplex PCR and length polymorphism analysis could be used as a rapid and precise tool for the identification of HSV-1 strains. Differentiation of clinical HSV-1 isolates. The microsatellite haplotypes of two serial isolates from the same individual were compared (Table 2). Isolate L1 was isolated from a patient’s lip vesicles; isolate L2 was isolated 59 days later from the same patient’s herpetic keratitis lesions. Isolates N1 and N2 were isolated 39 days apart from a patient with a stem cell allograft who presented with chronic HSV-1 infection of the oral mucosa. Isolates O1 and O2 were isolated from the same individual from two different herpetic recurrence lesions on the tongue and on the inferior lip, respectively. Isolates P1 and P2 came from a patient who developed herpetic vesicles 2 weeks apart, first on the skin around the nose and then on the lip. The microsatellite haplotype was identical in each case, even though the locations of the herpes lesions slightly differed over time. These results indicate that in these cases the strain haplotype remained stable in vivo through distinct or chronic herpetic episodes in the same individual. Finally, strains Q and R were from two different patients attending the same care unit. The first patient, an immunosuppressed 80-year-old woman, was hospitalized with a case of severe genital herpes due to HSV-1 that required intravenous acyclovir treatment. The second patient was hospitalized for acute eczematous lesions of facial atopic dermatitis and who developed a HSV-1 superinfection at exactly the same time. While this might have suggested the transmission of HSV-1 by hand carriage from the first patient to the second, the haplotypes of the two isolates were very different, thus indicating, on the contrary, that the infections originated from different viral strains (Table 2). DISCUSSION This study reports for the first time the presence of numerous microsatellite loci across the HSV-1 genome, found mostly, as expected, in noncoding regions and characterized by a high level of length polymorphism. Short microsatellite poly-

J. CLIN. MICROBIOL.

morphisms have already been used for the precise characterization of HCMV strains (9, 29, 51), and a similar proposal has been made for human herpesvirus 6 strains regarding the specific copy number of telomeric repeat sequences located at the ends of the genome (25). In comparison with reiterated regions in the US component still currently used for HSV-1 strain differentiation (33), short microsatellites have the advantage of being distributed across all parts of the HSV-1 genome. The HSV-1 microsatellites remain stable for any given strain after serial propagation in cell culture in vitro and in vivo. The results of this preliminary longitudinal study indicate that sequential HSV-1 isolates obtained from one individual present the same microsatellite profiles. Moreover, the multiplex PCRbased analysis of microsatellites presented here is a simple, specific, precise, and reproducible method that rapidly provides results that can be used to compare HSV-1 strains. Altogether, these results establish the potential use of microsatellite polymorphism analysis in epidemiological studies of HSV-1 infections. As far as the mechanism of microsatellite variability is concerned, the changes in repeat numbers at microsatellite loci are generally caused by slip-strand mispairing errors during DNA replication (42). It has been recognized that in prokaryotic cells, as well as in eukaryotic cells, the integrity of the genome is under the control of complex DNA repair systems, including the mismatch repair system. Their functions are used to recognize and repair erroneous insertions, deletions, and the misincorporation of bases that can arise during DNA replication and recombination, as well as to repair some forms of DNA damage (2, 15, 50). It is known that some mutational events are normally proofread during replication by the HSV-1 DNA polymerase, which possesses an intrinsic 3⬘ to 5⬘ exonuclease activity that attends to the removal of incorrectly incorporated deoxyribonucleoside triphosphates (41). Furthermore, during HSV-1 infection, some host cell DNA repair proteins are recruited to nuclear replication compartments (20, 52). The recruitment of host DNA repair proteins seems to benefit viral replication, but their actual roles need to be confirmed. The influence of the recruitment of the mismatch repair system by HSV-1 on the stability or instability of its microsatellite sequences has not yet been studied. Additionally, some authors have demonstrated that the reduced DNA binding of the UL42 processivity subunit of the HSV-1 DNA polymerase is associated with a significant decrease in replication fidelity (18). All these elements could underlie the diversity of HSV-1 microsatellites observed in our study. Regarding their impact on the physiology of HSV-1, microsatellites might exert subtle influences on the regulation of DNA metabolic processes and viral gene expression as well as chromatin organization, as shown in eukaryote and prokaryote genomes. There is abundant evidence indicating that changes in gene sequence length could inactivate, affect, or change protein function, as shown in human cancer and genetic disorders and by the modification of pathogenesis in bacteria (19). Microsatellites may provide a molecular basis for fast adaptation to environmental changes or selective pressure. For instance, many of the mutations associated with the acyclovirresistant HSV-1 isolates contain insertions or deletions in short homopolymeric G or C sequences in the thymidine kinase (TK) gene (40). Some of these regions are remarkably instable

VOL. 47, 2009

HSV-1 MICROSATELLITES

and likewise give to the TK-negative mutants the possibility to revert to a TK-positive phenotype, while the phenotype gives the virus the advantage of being able to reactivate and grow in ganglia (13). These variations in the length of the sequence of the TK gene of HSV-1 illustrate the adaptive mechanisms that permit the virus to evade acyclovir therapy yet retain its pathogenicity. In our study, the screen that identified 79 microsatellites does not yet constitute an exhaustive survey of the HSV-1 genome; we looked only for total repeats longer than the chosen cutoff (microsatellites of four trinucleotides, five dinucleotides, or nine mononucleotides). This cutoff explains why homopolymeric G or C sequences in the TK gene were not included. In our study, two polymorphic trinucleotide microsatellites were found within two protein sequences. This may result in changes in the UL46 tegument protein, which modulates the transcriptional induction of alpha genes (3, 54), and US4, which encodes gG, which is a viral envelope glycoprotein that is assumed to contribute to viral entry through the apical surfaces of polarized cells (46). In the second case, our results confirmed the sequence variations of the GAG tandem repeat flanking GAA in gG that were already reported by others (27, 30). To date, these amino acid sequence modifications and their biological significance have not yet been reported. Otherwise, although the effects of polymorphisms in microsatellites on the physiology of HSV-1 are largely unknown, the fact that microsatellites were more often found in noncoding regions than in open reading frames suggests that they have no influence on either the virulence of the strain or the evolution of the virus. Since these variations must likely occur at random without offering any replicative or adaptive advantage, these microsatellites may thereby be considered neutral molecular markers. In every instance, they might be used in studies in which HSV-1 strain tracing is necessary: in physiological and epidemiological studies (34) or when nosocomial HSV-1 infections (21, 38) or reinfection with a novel strain (31) are suspected. Our study has indentified 23 polymorphic microsatellite loci that may be used as molecular markers for epidemiological analysis of HSV-1 strains and HSV-1 strain differentiation. Furthermore, microsatellite-based phylogeny and principal-component analyses, which are the methods usually described in the literature, might be applied to show the clustering of HSV-1 strains. Microsatellites accurately characterized the HSV-1 strains from patients evaluated in the present study and were used to ascertain the identity between strains isolated sequentially from the same patient, as well as to differentiate strains in the case of the hypothetical nosocomial transmission of HSV-1 strains. Our preliminary results are promising and should have implications for further epidemiological studies of the transmission and the evolution of HSV-1 strains. ACKNOWLEDGMENTS This work was supported in part by a grant from IFR113 Immunite´, Cancer et Infection Groupe Hospitalier Pitie´-Salpeˆtrie`re. We thank Flore Rozenberg for providing strain KOS and Ariel Bardi for proofreading the manuscript. The authors have no conflicting financial interests. REFERENCES 1. Adams, G., B. H. Stover, R. A. Keenlyside, T. M. Hooton, T. G. Buchman, B. Roizman, and J. A. Stewart. 1981. Nosocomial herpetic infections in a pediatric intensive care unit. Am. J. Epidemiol. 113:126–132.

539

2. Baranovskaya, S., J. L. Soto, M. Perucho, and S. R. Malkhosyan. 2001. Functional significance of concomitant inactivation of hMLH1 and hMSH6 in tumor cells of the microsatellite mutator phenotype. Proc. Natl. Acad. Sci. USA 98:15107–15112. 3. Barker, D. E., and B. Roizman. 1990. Identification of three genes nonessential for growth in cell culture near the right terminus of the unique sequences of long component of herpes simplex virus 1. Virology 177:684– 691. 4. Bowden, R., H. Sakaoka, P. Donnelly, and R. Ward. 2004. High recombination rate in herpes simplex virus type 1 natural populations suggests significant co-infection. Infect. Genet. Evol. 4:115–123. 5. Bowden, R., H. Sakaoka, R. Ward, and P. Donnelly. 2006. Patterns of Eurasian HSV-1 molecular diversity and inferences of human migrations. Infect. Genet. Evol. 6:63–74. 6. Buchman, T. G., B. Roizman, G. Adams, and B. H. Stover. 1978. Restriction endonuclease fingerprinting of herpes simplex virus DNA: a novel epidemiological tool applied to a nosocomial outbreak. J. Infect. Dis. 138:488–498. 7. Chaney, S. M., K. G. Warren, and J. H. Subak-Sharpe. 1983. Variable restriction endonuclease sites of herpes simplex virus type 1 isolates from encephalitic, facial and genital lesions and ganglia. J. Gen. Virol. 64(Pt 12):2717–2733. 8. Chou, J., and B. Roizman. 1990. The herpes simplex virus 1 gene for ICP34.5, which maps in inverted repeats, is conserved in several limitedpassage isolates but not in strain 17syn⫹. J. Virol. 64:1014–1020. 9. Davis, C. L., D. Field, D. Metzgar, R. Saiz, P. A. Morin, I. L. Smith, S. A. Spector, and C. Wills. 1999. Numerous length polymorphisms at short tandem repeats in human cytomegalovirus. J. Virol. 73:6265–6270. 10. Davison, A. J., and N. M. Wilkie. 1981. Nucleotide sequences of the joint between the L and S segments of herpes simplex virus types 1 and 2. J. Gen. Virol. 55:315–331. 11. Field, D., and C. Wills. 1996. Long, polymorphic microsatellites in simple organisms. Proc. Biol. Sci. 263:209–215. 12. Garcia-Barreno, B., T. Delgado, and J. A. Melero. 1994. Oligo(A) sequences of human respiratory syncytial virus G protein gene: assessment of their genetic stability in frameshift mutants. J. Virol. 68:5460–5468. 13. Griffiths, A., M. A. Link, C. L. Furness, and D. M. Coen. 2006. Low-level expression and reversion both contribute to reactivation of herpes simplex virus drug-resistant mutants with mutations on homopolymeric sequences in thymidine kinase. J. Virol. 80:6568–6574. 14. Gupta, R., T. Warren, and A. Wald. 2007. Genital herpes. Lancet 370:2127– 2137. 15. Ham, M. F., T. Takakuwa, W. J. Luo, A. Liu, A. Horii, and K. Aozasa. 2006. Impairment of double-strand breaks repair and aberrant splicing of ATM and MRE11 in leukemia-lymphoma cell lines with microsatellite instability. Cancer Sci. 97:226–234. 16. Hammer, S. M., T. G. Buchman, L. J. D’Angelo, A. W. Karchmer, B. Roizman, and M. S. Hirsch. 1980. Temporal cluster of herpes simplex encephalitis: investigation by restriction endonuclease cleavage of viral DNA. J. Infect. Dis. 141:436–440. 17. Hayward, G. S., R. J. Jacob, S. C. Wadsworth, and B. Roizman. 1975. Anatomy of herpes simplex virus DNA: evidence for four populations of molecules that differ in the relative orientations of their long and short components. Proc. Natl. Acad. Sci. USA 72:4243–4247. 18. Jiang, C., Y. T. Hwang, J. C. Randell, D. M. Coen, and C. B. Hwang. 2007. Mutations that decrease DNA binding of the processivity factor of the herpes simplex virus DNA polymerase reduce viral yield, alter the kinetics of viral DNA replication, and decrease the fidelity of DNA replication. J. Virol. 81:3495–3502. 19. Li, Y. C., A. B. Korol, T. Fahima, and E. Nevo. 2004. Microsatellites within genes: structure, function, and evolution. Mol. Biol. Evol. 21:991–1007. 20. Lilley, C. E., C. T. Carson, A. R. Muotri, F. H. Gage, and M. D. Weitzman. 2005. DNA repair proteins affect the lifecycle of herpes simplex virus 1. Proc. Natl. Acad. Sci. USA 102:5844–5849. 21. Linnemann, C. C., Jr., T. G. Buchman, I. J. Light, and J. L. Ballard. 1978. Transmission of herpes-simplex virus type 1 in a nursery for the newborn. Identification of viral isolates by D.N.A. “fingerprinting.” Lancet i:964–966. 22. Luyt, C. E., A. Combes, C. Deback, M. H. Aubriot-Lorton, A. Nieszkowska, J. L. Trouillet, F. Capron, H. Agut, C. Gibert, and J. Chastre. 2007. Herpes simplex virus lung infection in patients undergoing prolonged mechanical ventilation. Am. J. Respir. Crit. Care Med. 175:935–942. 23. Maertzdorf, J., L. Remeijer, A. Van Der Lelij, J. Buitenwerf, H. G. Niesters, A. D. Osterhaus, and G. M. Verjans. 1999. Amplification of reiterated sequences of herpes simplex virus type 1 (HSV-1) genome to discriminate between clinical HSV-1 isolates. J. Clin. Microbiol. 37:3518–3523. 24. McGeoch, D. J., M. A. Dalrymple, A. J. Davison, A. Dolan, M. C. Frame, D. McNab, L. J. Perry, J. E. Scott, and P. Taylor. 1988. The complete DNA sequence of the long unique region in the genome of herpes simplex virus type 1. J. Gen. Virol. 69(Pt 7):1531–1574. 25. Mirandola, P., T. Ravaioli, and E. Cassai. 1997. PCR analysis of human telomeric repeats present on HHV-6A viral strains. Virus Genes 15:29–32. 26. Norberg, P., T. Bergstrom, and J. A. Liljeqvist. 2006. Genotyping of clinical

540

27.

28.

29.

30.

31.

32.

33.

34.

35.

36.

37.

38.

39.

40.

DEBACK ET AL. herpes simplex virus type 1 isolates by use of restriction enzymes. J. Clin. Microbiol. 44:4511–4514. Norberg, P., T. Bergstrom, E. Rekabdar, M. Lindh, and J. A. Liljeqvist. 2004. Phylogenetic analysis of clinical herpes simplex virus type 1 isolates identified three genetic groups and recombinant viruses. J. Virol. 78:10755–10764. Perry, L. J., and D. J. McGeoch. 1988. The DNA sequences of the long repeat region and adjoining parts of the long unique region in the genome of herpes simplex virus type 1. J. Gen. Virol. 69(Pt 11):2831–2846. Picone, O., Y. Ville, J. M. Costa, C. Rouzioux, and M. Leruez-Ville. 2005. Human cytomegalovirus (HCMV) short tandem repeats analysis in congenital infection. J. Clin. Virol. 32:254–256. Rekabdar, E., P. Tunback, J. A. Liljeqvist, and T. Bergstrom. 1999. Variability of the glycoprotein G gene in clinical isolates of herpes simplex virus type 1. Clin. Diagn. Lab. Immunol. 6:826–831. Remeijer, L., J. Maertzdorf, J. Buitenwerf, A. D. Osterhaus, and G. M. Verjans. 2002. Corneal herpes simplex virus type 1 superinfection in patients with recrudescent herpetic keratitis. Investig. Ophthalmol. Vis. Sci. 43:358– 363. Remeijer, L., J. Maertzdorf, P. Doornenbal, G. M. Verjans, and A. D. Osterhaus. 2001. Herpes simplex virus 1 transmission through corneal transplantation. Lancet 357:442. Rixon, F. J., M. E. Campbell, and J. B. Clements. 1984. A tandemly reiterated DNA sequence in the long repeat region of herpes simplex virus type 1 found in close proximity to immediate-early mRNA 1. J. Virol. 52:715–718. Roest, R. W., W. F. Carman, J. Maertzdorf, A. Scoular, J. Harvey, M. Kant, W. I. Van Der Meijden, G. M. Verjans, and A. D. Osterhaus. 2004. Genotypic analysis of sequential genital herpes simplex virus type 1 (HSV-1) isolates of patients with recurrent HSV-1 associated genital herpes. J. Med. Virol. 73:601–604. Roizman, B., D. M. Knipe, and R. Whitley. 2007. Herpes simplex viruses, p. 2501–2601. In D. M. Knipe, P. M. Howley, et al. (ed.), Fields virology, 5th ed. Lippincott Williams & Wilkins, Philadelphia, PA. Roizman, B., and M. Tognon. 1983. Restriction endonuclease patterns of herpes simplex virus DNA: application to diagnosis and molecular epidemiology. Curr. Top. Microbiol. Immunol. 104:273–286. Sakaoka, H., K. Kurita, Y. Iida, S. Takada, K. Umene, Y. T. Kim, C. S. Ren, and A. J. Nahmias. 1994. Quantitative analysis of genomic polymorphism of herpes simplex virus type 1 strains from six countries: studies of molecular evolution and molecular epidemiology of the virus. J. Gen. Virol. 75(Pt 3):513–527. Sakaoka, H., Y. Saheki, K. Uzuki, T. Nakakita, H. Saito, K. Sekine, and K. Fujinaga. 1986. Two outbreaks of herpes simplex virus type 1 nosocomial infection among newborns. J. Clin. Microbiol. 24:36–40. Sakaoka, H., H. Saito, K. Sekine, T. Aomori, L. Grillner, G. Wadell, and K. Fujinaga. 1987. Genomic comparison of herpes simplex virus type 1 isolates from Japan, Sweden and Kenya. J. Gen. Virol. 68(Pt 3):749–764. Sasadeusz, J. J., F. Tufaro, S. Safrin, K. Schubert, M. M. Hubinette, P. K.

J. CLIN. MICROBIOL.

41. 42. 43. 44. 45. 46.

47. 48. 49.

50. 51. 52.

53.

54.

Cheung, and S. L. Sacks. 1997. Homopolymer mutational hot spots mediate herpes simplex virus resistance to acyclovir. J. Virol. 71:3872–3878. Song, L., M. Chaudhuri, C. W. Knopf, and D. S. Parris. 2004. Contribution of the 3⬘- to 5⬘-exonuclease activity of herpes simplex virus type 1 DNA polymerase to the fidelity of DNA synthesis. J. Biol. Chem. 279:18535–18543. Tachida, H., and M. Iizuka. 1992. Persistence of repeated sequences that evolve by replication slippage. Genetics 131:471–478. Tautz, D., and M. Renz. 1984. Simple sequences are ubiquitous repetitive components of eukaryotic genomes. Nucleic Acids Res. 12:4127–4138. Thi, T. N., C. Deback, I. Malet, P. Bonnafous, Z. Ait-Arkoub, and H. Agut. 2006. Rapid determination of antiviral drug susceptibility of herpes simplex virus types 1 and 2 by real-time PCR. Antivir. Res. 69:152–157. Thurston, M. I., and D. Field. 2005. MsatFinder: detection and characterization of microsatellites. CEH Oxford, Oxford, United Kingdom. http//www .genomics.ceh.ac.uk/msatfinder/. Tran, L. C., J. M. Kissner, L. E. Westerman, and A. E. Sears. 2000. A herpes simplex virus 1 recombinant lacking the glycoprotein G coding sequences is defective in entry through apical surfaces of polarized epithelial cells in culture and in vivo. Proc. Natl. Acad. Sci. USA 97:1818–1822. Umene, K., and T. Kawana. 2003. Divergence of reiterated sequences in a series of genital isolates of herpes simplex virus type 1 from individual patients. J. Gen. Virol. 84:917–923. Umene, K., and M. Yoshida. 1989. Reiterated sequences of herpes simplex virus type 1 (HSV-1) genome can serve as physical markers for the differentiation of HSV-1 strains. Arch. Virol. 106:281–299. Vogel, J. U., B. Weber, and H. W. Doerr. 1994. Typing and strain differentiation of clinical herpes simplex virus type 1 and 2 isolates by polymerase chain reaction and subsequent restriction fragment length polymorphism analysis. Zentralbl. Bakteriol. Parasitenkd. Infektkrankh. Hyg. Abt. 1 Orig. 281:502–512. Wagner, R., Jr., and M. Meselson. 1976. Repair tracts in mismatched DNA heteroduplexes. Proc. Natl. Acad. Sci. USA 73:4135–4139. Walker, A., S. J. Petheram, L. Ballard, J. R. Murph, G. J. Demmler, and J. F. Bale, Jr. 2001. Characterization of human cytomegalovirus strains by analysis of short tandem repeat polymorphisms. J. Clin. Microbiol. 39:2219–2226. Wilkinson, D. E., and S. K. Weller. 2004. Recruitment of cellular recombination and repair proteins to sites of herpes simplex virus type 1 DNA replication is dependent on the composition of viral proteins within prereplicative sites and correlates with the induction of the DNA damage response. J. Virol. 78:4783–4796. Yoshida, M., and K. Umene. 2003. Close association of predominant genotype of herpes simplex virus type 1 with eczema herpeticum analyzed using restriction fragment length polymorphism of polymerase chain reaction. J. Virol. Methods 109:11–16. Zhang, Y., and J. L. McKnight. 1993. Herpes simplex virus type 1 UL46 and UL47 deletion mutants lack VP11 and VP12 or VP13 and VP14, respectively, and exhibit altered viral thymidine kinase expression. J. Virol. 67: 1482–1492.