ANNALS O F CLIN ICA L AND LABORATORY SCIEN C E, Vol. 23, No. 3 Copyright © 1993, Institute for C linical Science, Inc.

Use of Polymerase Chain Reaction for Laboratory Diagnosis of Herpes Simplex Virus Encephalitis* JABER ASLANZADEH, P h.D .,t JO SE PH G. GARNER, Ph.D.,* HENRY M. F E D E R , Ph.D.,§ and RAYMOND W. RYAN, P h .D .t Department o f Laboratory Medicine, Division o f Clinical Microbiology, t Department o f Pediatric Infectious Diseases,§ University o f Connecticut Health Center, Farmington, CT 06030 and Division o f Infectious Diseases,t New Britain General Hospital, New Britain, CT 06050

ABSTRACT Polym erase chain reaction was used to d etect herpes sim plex virus (HSV) specific deoxyribonucleic acid (DNA) sequences in acute and con­ valescent cerebrospinal fluid (CSF) and brain tissue of a 78-year-old m an and in CSF of a neonate who died of complications owing to herpes sim ­ plex virus encephalitis (HSVE). Polym erase chain reaction (PCR) was car­ ried out for 35 cycles with a set of prim ers that bracketed a 92 base pair segm ent unique to the HSV DNA polym erase gene. Amplified DNA was electrophoresed on 3 percent agarose gel, blotted onto a nylon m em brane, and probed w ith 32p-labeled oligonucleotide internal to the prim ers. The HSV specific DNA sequences w ere detected in the specim ens from both patients. No HSV specific DNA was detected in CSFs from 20 patients w ith suspected Lyme disease or neurosyphilis. Polymerase chain reaction is a rapid and noninvasive technique for the diagnosis of HSVE.

Introduction H e rp e s sim p lex virus e n c e p h a litis (HSVE) is rare b u t frequently a fatal dis­ ease. R ecent reports on the efficacy of antiviral agents, such as acyclovir adminAddress reprint requests to: Jaber Aslanzadeh, Ph.D., Department of Laboratory Medicine, Uni­ versity of Connecticut Health Center, Farmington, CT 06030.

istered early during the infection, has m ade rapid diagnosis of HSVE of great im portance.17,22 Unfortunately, the clini­ cal presentation of HSVE is not diagnos­ tic and may mimic other central nervous system (CNS) d iso rd e rs.23 C u ltu re of c e re b ro sp in a l flu id (C SF) is u su a lly negative. Serologic analysis of sim u l­ taneously drawn CSF and serum samples as well as dem onstration of intrathecally synthesized IgM may be diagnostic, b u t

196 0091-7370/93/0500-0196 $01.20 © Institute for Clinical Science, Inc.

USE OF PCR FOR LABORATORY DIAGNOSIS OF HSV ENCEPHALITIS

not until after 3 to 10 days following the onset of neurological symptoms.8’12,13,15,20 Although the detection of viral antigen in the CSF may lead to a diagnosis during this antibody negative period, routine procedures w ith adequate specificity and sensitivity are not yet available.5,14 Cur­ rently, culture of a brain biopsy is the m ost reliable m ethod to diagnose accu­ rately this infection.8,9 H ow ever, it is an invasive procedure w hich is perform ed with reluctance. Polym erase chain reaction (PCR) is a w idely used and pow erful technique to detect the presence of an infectious agent in clinical sp ecim en s.7,18 T he m ethod involves p rim e r m ed ia te d , enzym atic a m p lif ic a tio n o f th e s p e c if ic D N A s e q u e n c e . T h e te c h n iq u e has b e e n shown to be effective in detecting HSV in specim ens of CSF from patients with docum ented HSVE as early as 24 hours after the onset of clinical symptoms.2,3,19 The use of PCR is reported for detecting HSV DNA in brain autopsy tissue and/or CSF from two patients who died of herpes sim plex virus m eningoencephalitis. Case History Patient #1 A 78-year-old male with hypertension and spinal stenosis presented with confusion and aphasia. The patient was in his usual state of health until three days prior to admission when he became lethargic and slept for nearly 24 hours. He had begun taking flurbiprofen for back pain three days previously. This medication was discontinued and on the day prior to admission he spoke little and seemed inter­ mittently confused. During the night prior to admis­ sion, he got out of bed and began dressing, putting on multiple layers of clothing. He was brought to the hospital the next morning. In the emergency department, he was agitated and unable to follow commands. His rectal tem­ perature was 100.6°F, pulse 83 per minute, blood pressure 147/90 mm Hg, and respirations 21 per minute. Neurologic examination revealed a Wer­ nicke’s aphasia without motor, sensory, or cerebel­ lar deficits. Babinski’s sign was absent and muscle stretch reflexes were normal. The remainder of the physical examination was unremarkable. Admission laboratory data showed a white blood count of 11,000 per p.1. with 71 percent polymorpho­ nuclear cells and 16 percent band cells; hemoglo­ bin and hematocrit were 13.2 g per dl and 37.5;

197

platelet count was 184,000 per mm3. Electrolytes were normal; total bilirubin was 2 . 8 mg per dl, and the serum aspartase aminotransaminase (AST) was 50 IU per L. A specimen of CSF contained no white or red blood cells. The CSF glucose was 72 mg per dl, and the total protein was 48 mg per dl. The viral culture of CSF was negative. A computed tomogra­ phy (CT) scan with contrast revealed that the left temporal area appeared slightly hypodense. Shortly after admission he developed myoclonic jerking of his right quadriceps muscle. Acyclovir in the dosage of 10 mg per kg every 8 hours intravenously was initiated for suspected herpes simplex encephalitis. The next day a second lumbar puncture yielded CSF containing 110 leu­ kocytes per mm 3 with 8 6 percent monocytes, 1 0 percent lymphocytes, and 4 percent polymorphonu­ clear cells. The CSF total protein was 79 mg per dL. The viral culture of CSF was negative. An electro­ encephalogram (EEG) showed left temporal sharp waves at 3 second intervals with a diffusely slow background. A magnetic resonance imaging (MRI) scan dem onstrated edem atous changes of the medial portion of the left temporal lobe. Both the EEG and MRI were interpreted as being typical of herpes simplex encephalitis. D espite treatm ent with acyclovir his clinical status w orsened, he remained aphasic and was only intermittently alert. He expired on the 14th day following admission. Postmortem examination revealed non-hemorrhagic softening of the left temporal lobe. Micro­ scopic examination showed large foci of necrosis with marked infiltration by macrophages, perivas­ cular cuffing by lymphocytes and monocytes, and broad gliosis in the left temporal lobe and adjacent basal ganglia. A few neuronal, astrocytic, oligodendroglial, and endothelial cell nuclei were positive for herpex simplex virus on immunoperoxidase stains. The final pathological diagnosis was herpes simplex encephalitis. Patient #2 A one-month-old female infant was brought to the emergency room because of irritability and cessa­ tion of feeding. Past medical history revealed a birth weight o f2300 grams and a gestation age of 34 weeks. She was born by vacuum extraction because of premature rupture of membranes. At birth, the mother was colonized with group B beta hemolytic streptococci. However, because the infant was well appearing, blood cultures were obtained which were negative, and the infant was not treated. The mother and father denied a history of herpes sim­ plex infections and the mother had no genital lesions on delivery. Cultures of HSV of the mother and infant were not done. The infant was dis­ charged from the hospital at two weeks of age at which time she was normal and w eighed 2500 grams. From 3 to 4 weeks of age, the infant had episodes of flexing of arms and legs, vomiting, and listlessness for which no diagnostic or therapeutic interventions w ere done because they always resolved spontaneously. On the day of admission, the infant was difficult to arouse and was brought to the emergency room.

198

ASLANZADEH, GARNER, FEDER, AND RYAN

On physical examination she was listless but irrita­ ble. Her rectal temperature was 99.6°F, pulse 138 per min, respirations 24 per min, blood pressure 90/50 mm Hg, and weight 2450 grams. There were no abnormal focal findings. The skin was normal. Laboratory studies included a WBC of 6800 per mm 3 with 32 percent bands, 44 percent polymor­ phonuclear cells, 1 2 percent mononuclear cells, and 42 percent lymphocytes. A specimen of CSF con­ tained 152 white blood cells (WBC) (1 percent poly­ morphonuclear cells and 99 percent mononuclear cells), 6 red blood cells (RBC), glucose 27 mg per dl, and protein 940 mg per dl. Other abnormal findings included aspartate aminotransferase (AST) of 181 and an alanine aminotransferase (ALT) of 206. Treatment was initiated with ampicilin and gentamicin intravenously for possible sepsis. Over the next four hours, the patient became hypotensive, was intubated, and transferred to our institution. Acyclovir in the dosage of 10 mg per kg was added to her therapy. Over the next 24 hours the hypother­ mia persisted, and she developed generalized sei­ zures. Repeat specimens of CSF revealed 145 WBC (98 percent mononuclear cells and 2 percent poly­ morphonuclear cells), 1335 RBCs, protein 550 mg per dl, and glucose 14 mg per dl. Bacterial and viral cultures of the nasopharynx (NP), rectum, and CSF were negative. Over the next 72 hours, the patient continued to deteriorate neurologically. A head CT scan showed hypodensities throughout her cortex and an EEG showed no activity. Supportive mea­ sures were stopped, and the patient expired in 48 hours. The parents refused an autopsy. Cerebral spinal fluid saved from the second lumbar puncture was positive for HSV by PCR.

Materials and Methods P olym erase chain reaction was p e r­ formed on CSF and brain autopsy tissue a c c o r d in g to s ta n d a r d p r o c e d u r e s . Briefly, two slides containing three brain autopsy tissue sections (4 to 6 |xm) were deparaffinized by incubating the slides in three changes of xylene (5 m in each) and w ashed w ith 95 percent ethanol for 5 min. T he slides w ere d ried and rehy­ drated in distilled water, and tissue sec­ tions w ere scraped w ith a cover slip and w ashed w ith 50 (jd of lysis buffer [0.32 M sucrose, 10 mM Tris-H Cl (pH 7.5), 5 mM M gCl2, 1 p e rc e n t triton X-100] into a 1-ml microfuge tube. Proteinase K (3 |ig) was added to each tube and incubated at 56°C for 60 m in, followed by boiling for 10 min.

Polym erase chain reaction was p e r­ form ed on 5 |xl of this specim en as w ell as 5 (jlI of each of the specim ens of CSF in individual m icrofuge tubes containing 10 pmol of each of two 22-base oligonucleo­ tide w hich flank a 92 bp segm ent specific for HSV DNA polym erase gene (Prim er 1-CATCACCG ACCCG GA GAG GG AC; P rim er 2-G G G C C A G G C G C T T G T T G GTGTA) (6), 0.5 |xl of enzym e Taq poly­ m erase, 200 mM of each dNTPs,* 5 |jl1 of 10X reaction buffer (500 mM KCl, 100 mM tris-H Cl, 15 mM MgCl2, and 0.01 percent gelatin), and 29.5 (il of H PLC grade distilled w ater (final volume 50 |xl). The tubes w ere overlaid w ith 70 jxl of m ineral oil and su b jected to 35 PCR cycles (94°C 60 Sec, 55°C 60 Sec, and 72°C 90 Sec). Each test run included one positive control (PCR reagents plus 10 ng of HSV DNA) and three negative controls (PCR reagents b u t no target DNA) to m onitor contam ination. Am plified PCR products w ere then electrophoresed in 3 percent agarose gel containing 1 jjLg per ml ethidium brom ide at 120 volts. Follow ing the electrophoresis, eth id ­ ium brom ide stained DNA bands w ere view ed under an ultraviolet (UV) translum inator and photographed. The gel was then placed in denaturing (0.4 N NaOH to 0.6 M NaCl) and in neutralizing (1.5 M NaCl to 0.5 M Tris-HCl, pH 7.5) solu­ tions on a rotary shaker at room tem pera­ ture (30 m in each). The DNA bands w ere then blotted onto a nylon m em brane in a Southern blot apparatus filled w ith 10x sodium ch loride/sodium citrate (SSC) buffer (1.5 M NaCl, 0.15 M Na citrate) overnight. The m em brane was baked at 80°C for 3 hr and incubated in prehybrid­ ization solution (6x SSC buffer, 50 per­ cent formamide, 5 x D enhardt’s solution, 0.5 percent SDS, 100 |xg per ml dena­ tured salmon testes DNA for 4 hr).

* Perkin Elmer Cetus CO. Norwalk, CT.

USE OF PCR FOR LABORATORY DIAGNOSIS OF HSV ENCEPHALITIS

A

199

B

1 2 3 4 5 6 7 8 1 23 4 5 6 78

m

m

FIGURE 1. Composite prints of agarose gel electrophoresis of herpes simplex virus (HSV) deoxyribo­ nucleic acid (DNA) amplified by polymerase chain reaction (PCR): Panel A, lane 1, 123 bp ladder molecular weight (MW) Standard; lane 2, positive control; lanes 3 through 5, negative controls; lanes 6 , 7, 8 , acute, convalescent cerebrospinal fluid (CSF) and brain autopsy tissue from patient number 1, respec­ tively. Panel B, lane 1, positive control; lanes 2 and 3, negative controls; lane 4, CSF from patient number 2; lanes 5, 6 and 8 , blank; and lane 7, 123 bp ladder MW standard.

O ligonucleotide probes (GTCCTCACCGCCGAACTGAG) com plem entary to the inner portion of the DNA sequence am plified during the PCR w ere labeled w ith 32P gamma adenosine triphosphatet (ATP) using T4 polynucleotide kinase a c c o rd in g to m e th o d s d e s c r ib e d by Maxam et al.16 T he labeled probe was added to the m em brane in the prehybrid­ ization solution and incubated overnight at 42°C. T h e m em b ran e was w ashed three tim es in 2 x SSC buffer containing 0.1 percent sodium dodecyl sulfate (SDS) for 30 min each and exposed to Kodak X-Ray film for 24 hrs. Results Polym erase chain reaction was p e r­ formed on acute and convalescent CSF, and form alin fixed paraffin em b ed d ed brain autopsy tissue from patient num ber 1. The acute and convalescent CSF HSV titers obtained 11 days apart w ere 1:1 and t Amersham, Arlington Heights, IL.

1:4, respectively. A single specim en of CSF obtained 10 days after the onset of c lin ic a l sym ptom s was a v a ila b le on patient num ber 2. The HSV titer was 1: 10. Agarose gel electrophoresis of the PCR products revealed that both acute and convalescent CSF as well as brain autopsy tissue on patient num ber 1 and the CSF on patient num ber 2 w ere posi­ tive for a 92 bp DNA sequence unique to HSV (figure 1). This was fu rth er vali­ dated by Southern blot analysis of the PCR product with a 32P labeled oligonu­ cleotide internal to the PCR prim ers (fig­ ure 2). No HSV specific DNA sequence was detected in three negative controls included in each PCR run. Similarly, no H SV s p e c if ic D N A s e q u e n c e w as d e te c te d in 20 sam ples o f C S F from patients with suspected Lyme disease or neurosyphilis (data not shown). Discussion Herpes simplex virus is the most com­ mon etiology of necrotizing encephalitis

200

ASLANZADEH, GARNER, FEDER, AND RYAN

A 1

B 2 3 4 5 6 7 8

1

2

3

4

5 6 7 8

%

FIG U R E 2. Composite prints of Southern blot analysis of herpes simplex virus (HSV) deoxyribonucleic acid (DNA) amplified by polymerase chain reaction (PCR): Panel A, lane 2, positive control; lanes 3 through 5, negative controls; lanes 6 , 7, and 8 , acute convalescent and brain autopsy tissue from patient number 1, respectively. Panel B, lane 1, positive control; lanes 2 and 3, negative controls; and lane 4, cerebrospinal fluid (CSF) from patient number 4.

with an annual incidence of 0.3 case per 100,000 people.21 H erpes simplex virus 1 is re s p o n s ib le for th e o v e rw h e lm in g majority of the cases. In adults, the virus is believed to travel by retrograde trans­ port from the trigem inal ganglion to the CNS, especially to the tem poral lobe. The pathogenesis of HSVE is different in neonates in that the virus dissem inates from skin or m ucous m em branes into m ultiple visceral organs including lung, liver, and CNS. A lthough several non-invasive te c h ­ niques, such as serology, antigen detec­ tion tests, EEG , and radionucleide brain scanning, have b een used to diagnose HSVE, brain biopsy rem ains the gold stan d ard .4’5’8'9’10’12’13’14’15’20 H ow ever, many physicians are reluctant to perform

a brain biopsy ow ing to th e invasive n a tu re and d an g er of th e p ro ce d u re . A n d e rso n e t al. re p o rte d th a t o f 29 patients who had clinical presentations com patible with HSVE and underw ent brain biopsy, only eight had a positive culture for HSV and in one patient the biopsy was com plicated by a fatal intra­ cranial hem orrhage.1 R ecent studies have dem onstrated that PCR can detect HSV DNA sequences in CSF from patients w ith HSVE as early as 24 hours post onset of clinical sym ptom s.19 S im ila r ly , HSV s p e c if ic D N A sequences have been detected in paraffin em b ed d ed sections of hum an brain at necropsy. D espite the known sensitivity of PCR, false negative results owing to the presence of PCR inhibitors, such as

USE OF PCR FOR LABORATORY DIAGNOSIS OF HSV ENCEPHALITIS

hem oglobin, have b e e n reported. T he single m ost im portant problem , however, w ith the use of PCR is false positivity ow ing to contam inating am plicons from previous am plification. T herefore, the specificity o f PCR depends on laboratory techniques that can prevent carry over o f am plim ers from one rea c tio n tu b e to an other. In our laboratory, several procedures w ere im p lem en ted to p re ­ ven t PCR cross contam ination, such as physical separation of the area for sam­ ple preparation and post PCR steriliza­ tio n of th e am plicons w ith hydroxylam ine hydrochloride. In both of these patients, PCR was an invaluable tool for the acute diagnosis of HSV infection. In the adult, the case was clarified by PCR, and the diagnosis of HSV e n c e p h a litis was m ad e w ith o u t doing a brain biopsy. In th e pediatric case, PCR was again invaluable, as this patient had a som ew hat unusual presen­ tation and did not show symptoms com­ p a tib le w ith HSVE for several w eeks post partum . T he m other, in this case, was asymptomatic and denied previous infection w ith genital herpes. It is possi­ b le that the m other was asymptomatically shedding the virus and the baby acquired it intrapartum . T he baby could have also acquired the infection postpartum either at the nursery or in the com m unity owing to contact w ith an infected individual. How ever, the baby had no skin lesions com patible w ith HSV infection. O ur find­ ings support the reliability of PCR for detecting HSV in CSF and brain tissue o f p a tie n ts w ith e n c e p h a litis . T h e technique is a rapid, sensitive, and noninvasive m ethod for laboratory diagnosis of HSVE.

2.

encephalitis. J. Neurol. Neurosurg. Psychiatry 54:21001-21003, 1991.

A s l a n z a d e h , J., O s m o n , D. R., W i l h e l m , M. P., E s p y , M. J., and S m i t h , T. F.: A pro­

.

spective study of the polymerase chain reaction for detection of herpes simplex virus in cere­ b ro sp in al fluid su b m itted to th e clinical virology laboratory. Molecular Cellular Probes 6:376-373, 1992. A u r e l i u s , E ., J o h a n s s o n , B., S k o l d e n b e r g , B., S t a l a n d , A ., and F o r s g r e n , M.: Rapid diagnosis of herpes simplex encephalitis by nested polymerase chain reaction assay of cere­ brospinal fluid. Lancet 337:189-192, 1991. B a m b o r s c h k e , S., P o r r , A., H u b e r , M., and H e i s s , W . D.: Demonstration of herpes sim­ plex virus DNA in CSF cells by in situ hybrid­ ization for early diagnosis of herpes encephali­ tis. Neurology 237:73—76, 1990. Bos, C. A., O l d i n g -S t e n k v i s t , E., W i l t e r DINK, J. B., and SC H EFFER, A. J.: Detection of viral antigen in cerebrospinal fluid of patients with herpes simplex virus encephalitis. J. Med. Virol. 22:169-178, 1987. C a o , M., X i a o , X ., E g b e r t , B ., D a r r a g h , T. M., and Y e n , T. S. B .: Rapid detection of cutaneous herpes simplex virus infection with polymerase chain reaction. J. Invest. Dermatol. 82:391-392, 1989. E i s e n s t e i n , B. I.: The polymerase chain reac­ tion a new method of using molecular genetics for medical diagnosis. New Engl. J. Med. 322: 178-183, 1990. E l i t s u r , Y., C a r m i , R., a n d S a r o v , I.: HSV-

9.

s p e c if ic s e r u m /C S F a n t ib o d y ra tio in a s s o c ia ­ t io n w it h HSV s e r u m I g M a n t ib o d ie s in d ia g ­ n o s is o f h e r p e s e n c e p h a lit is in in fa n ts . I s r a e li J. M e d . S e i. 19:943-945, 1983. F i s h m e n , R. A.: N o , brain biopsy need not to

3.

4.

5.

6.

7.

8

10.

11.

12.

13.

References 1. A n d e r s o n , N. E., W i l l o u g h b y , E. W., Sy n e k , B. J., C r o x o n , M. C., and G l a s g o w , G.L.: Brain biopsy in the management of focal

201

14.

be done in every patient suspected of having herpes simplex encephalitis. Arch. Neurol. 44: 1291-1292, 1987. H a n l e y , D. F., J o h n s o n , R. T., and W h i t e l y , R. J.: Yes, brain biopsy should be a prerequisite for herpes sim plex encephalitis treatm ent. Arch. Neurol. 44:1289-1290, 1987. J o h n s o n , R. T., O l s o n , L. C., and B u e s c h e r , E. L.: Herpes simplex virus infection of the nervous system. Arch. Neurol. 28:260-264, 1968. K a h l o n , J., C h a t t r r j e e , S ., L a k e m a n , F. D., L e e , F., N a h m i a s , A. J., and W h i t e l y , R. J.: Detection of antibodies to herpes simplex virus in the cerebrospinal fluid of patients with herpes encephalitis. J. Infect. Dis. 55:38-44, 1987. K e u n e n , R. W . M., t e r B r ü g g e n , J. P ., Kuijp e r , E. J., P e e t e r s , M. F., O p d e C o u l , A. A. W ., and VAN LOON, A. M.: Rapid diagno­ sis of herpes encephalitis by enzyme immuno­ assay. Clin. Neurol. Neurosurg. 89:97-101, 1987. L a k e m a n , F. D., K o g a , J., and W h i t e l y , R. J.: Detection of antigen to herpes simplex virus in cerebrospinal fluid from patients with herpes simplex encephalitis. J. Infect. Dis. 55:11721178, 1987.

202 15.

16. 17.

18. 19.

20.

ASLANZADEH, GARNER, FEDER, AND RYAN M a c C u l l u m , F . O., C h i n n , I. J., and G o s t LING, J. V. T.: Antibodies to herpes-simplex

virus in the cerebrospinal fluid of patients with herpetic encephalitis. J. Med. Microbiol. 7: 325-331, 1974. M A X A M , A. M. and G IL B E R T , W.: Sequencing End-labeled DNA with base-specific chemical cleavages. Methods Enzymol. 65:499, 1980. N a h i m a s , A . J., W h i t e l y , R. J., V i s i n t i n e , A . N ., T a k e i , Y ., and A l f o r d , C . A ., J r .: Herpes simplex virus encephalitis: Laboratory evaluation and their diagnostic significance. J. Infect. Dis. 245:829-836, 1982. O s t e , C.: Polymerase chain reaction. Biotech­ niques 6:162-167, 1988. R o w l e y , A . H., W h i t l e y , R . J., L a k e m a n , F . D ., a n d W OLINSKY, S . M .: R a p id d e t e c t io n o f h e r p e s - s i m p l e x - v i r u s D N A in c e r e b r o s p in a l f lu id o f p a t ie n t s w it h h e r p e s s im p le x e n c e p h a lit is . L a n c e t 335:440—441, 1990. V a n L o o n , A . M., V a n D e r L o g t , J. T. M., H e e s s e n , F . W . A , P o s t m a , B ., a n d P e e t e r s ,

M. F.: D iagnosis of h erpes sim plex virus encephalitis by detection of virus specific immunoglobulins A and G in serum and cere­ brospinal fluid by using an antibody-capture enzyme linked immunosorbant assay. J. Clin. Microbiol. 27:1983-1987, 1989. 21. W H I T E L Y , R. J.: Viral encephalitis. New Engl. J . Med. 323:242-250, 1990. 22. W h i t e l y , R., A r v i n , A ., P r o b e r , C ., B u r ­ c h e t t , S ., C o r e y , L., P o w e l l , D., P l o t k i n , S ., S t a r r , S ., A l f o r d , C ., C o n n e r , J., J a c o b s ,

R., N a h m i a S, A ., and SOONG, S.: A controlled trial comparing vidarabine with acyclovir in neonatal herpes simplex virus infection. New Engl. J. Med. 324:444-449, 1991. 23. W h i t e l y , R. J., C o b b s , C . G., A l f o r d , C . A . J r ., S o o n g , S ., H i r s c h , M . S ., C o n n o r , J. D ., C o r e y , L., a n d H a n l e y , D . F.: D i s e a s e s th a t m im ic h e r p e s s im p le x e n c e p h a lit is : d ia g n o s is , p r e s e n t a tio n , a n d o u t c o m e . J. A m . M e d . A ss.

262:234-239, 1989.