Un d e rg ra d u a te Educator Ne two rk We b in a r

Undergraduate Educator Network Webinar Series Sponsored by Undergraduate Education Subcommittee SOT Education Committee December 15, 2015 1:00 PM ET (c) SOT2015

Un d e rg ra d u a te Educator Ne two rk We b in a r

Welcome Kristine Willett, PhD Co-Chair, Undergraduate Subcommittee UEN Webinar Moderator University of Mississippi

Joshua Gray, PhD Chair, Undergraduate Subcommittee US Coast Guard Academy

(c) SOT2015

Un d e rg ra d u a te Educator Ne two rk We b in a r

Objectives Viewers will be able to: 1. Adopt up to three examples of the use of fish (zebrafish and other types of fish) as model systems for undergraduate laboratory exercises focusing on toxicology. 2. Examine three examples of laboratory exercises that apply the process of science, quantitative reasoning (through dose-response relationships), evolution, and structure and function (through embryological development).

Un d e rg ra d u a te Educator Ne two rk We b in a r

Use of a Behavioral Assay to Determine the Chronic Effects of Chlorpyrifos on Developing Zebrafish Larissa M. Williams, PhD Assistant Professor Bates College Lewiston, ME

Extended protocols available in SOT Undergraduate Resource Curriculum

Un d e rg ra d u a te Educator Ne two rk We b in a r

(Zebra)Fish as Models in Developmental Toxicology • Vertebrate animals • External development; small, transparent embryos • High fecundity; short life cycle • Genetic and genomic tools • Well-developed transgenic technologies • Paralogous genes from ancestral genome duplication

Un d e rg ra d u a te Educator Ne two rk We b in a r

Behavioral Assays can be used as a Short Term Lab Project • Illustrates principles of development, neurobiology, and toxicology • Enables discussion and implementation of experimental design and data analysis • Limited preparation necessary • Can be a stand alone lab and completed in ~3 hours

Un d e rg ra d u a te Educator Ne two rk We b in a r

Neurodevelopment in Zebrafish

http://sivelab.wi.mit.edu/Ongoing%20Projects2.htm

Un d e rg ra d u a te Educator Ne two rk We b in a r

Zebrafish Development and Behavior

http://journal.frontiersin.org/article/10.3389/fnbeh.2010.00036/full

Un d e rg ra d u a te Educator Ne two rk We b in a r

Do Widely used Environmental Chemicals Affect Development?

USGS.gov

Un d e rg ra d u a te Educator Ne two rk We b in a r

Organophosphate Mechanism of Action

http://depts.washington.edu/opchild/acute.html

Un d e rg ra d u a te Educator Ne two rk We b in a r

Supplies for the Lab • • • • •

Adult zebrafish and IACUC approval Danieau’s or E2 medium Petri dishes, transfer pipets, and pipets Chlorpyrifos Dissecting scopes (and video capable cameras) • 16-mm diameter cylinder • Computers for data analysis

Un d e rg ra d u a te Educator Ne two rk We b in a r

Pre-Lab Protocol Day 1: Spawn zebrafish, collect embryos, start chronic dosing at 10 hpf Dosing regimes can be at single dose or multiple doses

Un d e rg ra d u a te Educator Ne two rk We b in a r

Behavioral Assay 1. Stage embryos at 2, 3, 4, or 5 days post fertilization 2. Test at least five fish per treatment for five minutes 3. Count or videotape the number of crossings

Figures from: Levin et al., 2004

Un d e rg ra d u a te Educator Ne two rk We b in a r

Data Analysis •

Graph number of segment crossings per:  Age  Dose  Age x Dose

•

Carry out statistical analysis

Figure from: Levin et al., 2004

Un d e rg ra d u a te Educator Ne two rk We b in a r

Student Deliverables

• • • •

Full lab report Short summary Results section Oral presentation

Un d e rg ra d u a te Educator Ne two rk We b in a r

Questions…. Send to “All Panelists” via Q&A panel.

Un d e rg ra d u a te Educator Ne two rk We b in a r

A Multi-Week Toxicological Study using Zebrafish (Danio rerio) as a Model Mindy Reynolds, PhD Associate Professor Washington College Chestertown, MD

Extended protocols available in SOT Undergraduate Resource Curriculum and The Journal of Toxicological Education. Reynolds, M. (2013) A Toxicological Study using Zebrafish (Danio rerio) as a model. http://darchive.mblwhoilibrary.org/handle/1912/6314

Un d e rg ra d u a te Educator Ne two rk We b in a r

Lab Activity Objectives •

Introduce toxicological concepts

•

Understand normal zebrafish development from fertilization through 5 dpf

•

Develop skills to formulate an independent hypothesis and design an experiment

•

To write a scientific research proposal

Un d e rg ra d u a te Educator Ne two rk We b in a r

Zebrafish (Danio rerio)

Development is exceedingly fast! http://pharyngula.org/~pzmyers/MyersLab/research/stages.jpg

Un d e rg ra d u a te Educator Ne two rk We b in a r

Getting Started

• Approval • IACUC • Resources ZFIN: http://zfin.org/cgi-bin/webdriver?MIval=aa-ZDB_home.apg

Westerfield, M., Zon, L., and Detrich, W. (2009) Essential Zebrafish Methods: Cell and Developmental Biology. Academic Press.

Un d e rg ra d u a te Educator Ne two rk We b in a r

Adult Tank Maintenance

• • • • • • • •

Water temperature: 82 ºF Light/Dark Cycle:  14 hours light  10 hours dark Separate males and females (Zebrafish International Resource Center) Daily water changes Monitor ammonium and nitrate levels (Carolina Biological) Feed 2-3 times day

http://www.naturalhistorymag.com/0606/images/zebrafish.jpg

Un d e rg ra d u a te Educator Ne two rk We b in a r

Breeding • Place 1-2 breeding pairs into breeding tank in early evening. Separate males and females with divider • Pull divider when lights turn on in morning • Collect embryos 1-2 hours later and stage  Clean and store in embryo media  Maintain in an incubator at 28.6°C

Carolina Biological

http://www1.umn.edu/umnnews/img/assets/11502/larvae.jpg

Un d e rg ra d u a te Educator Ne two rk We b in a r

Week 1 Normal Zebrafish Development Purpose • Understand breeding, maintenance, and development • Understand how use digital equipment for analysis • Appreciate the exceedingly fast developmental process

Assessment • Figure depicting stages of development

Un d e rg ra d u a te Educator Ne two rk We b in a r

Week 1 Normal Zebrafish Development Post fertilization, hr

18

24

36

48

Un d e rg ra d u a te Educator Ne two rk We b in a r

Week 2 Zebrafish on Drugs Purpose • To compare how exposure to various toxicants effects overall development, behavior, notochord length, and dry weight. • Understand basic statistical analysis

Assessment • • •

Figure comparing control and two different toxicant concentrations Two figures examining notochord length, dry weight, or mortality Statistical analysis required

Un d e rg ra d u a te Educator Ne two rk We b in a r

Week 2 Zebrafish on Drugs Treatments • All-trans retinoic acid (0.01, 0.1, 1, and 10 nM) • Ethanol (1, 2, and 3%) • Nicotine (10, 20, and 40 mM)

Un d e rg ra d u a te Educator Ne two rk We b in a r

Week 2 Zebrafish on Drugs

Un d e rg ra d u a te Educator Ne two rk We b in a r

Weeks 3-5 Independent Project Purpose • Research a toxicant of their choice • Develop and write a formal research proposal • Execute independent experiment • Present findings to the class

Assessment • • • •

Searching and reading primary literature Research design Execution and collection of data Presentation of findings

Un d e rg ra d u a te Educator Ne two rk We b in a r

Weeks 3-5 Independent Project 16

6 ** Notochord Length, mm

*

Dead Larvae

12 8 4

0

UT

10-10 Accutane, M

10-7

4 * *

2

0

UT

10-10 Accutane, M

10-7

Un d e rg ra d u a te Educator Ne two rk We b in a r

Weeks 3-5 Independent Project Post fertilization, hr

UT

Accutane 10-7M

5

12

24

48

Un d e rg ra d u a te Educator Ne two rk We b in a r

Overall Conclusion • Lab is designed for instructors with little to no background experience with zebrafish • Lab introduces basic toxicological concepts and the use of an in vivo model system • Students become comfortable with experimental design and data analysis

Un d e rg ra d u a te Educator Ne two rk We b in a r

Questions…. Send to “All Panelists” via Q&A panel.

Un d e rg ra d u a te Educator Ne two rk We b in a r

Molecular Biology Lab Class as a Vehicle for Teaching Environmental Toxicology: Cloning and Expression Analysis of CYP1A cDNAs from Diverse Fish Species Wade H. Powell Biology Department Kenyon College Gambier, OH USA

Un d e rg ra d u a te Educator Ne two rk We b in a r

BIOL 264: Gene Manipulation • Intermediate lab course focused on skills development • Weekly, 3-hour class. • Collaborative, semester-long group project. • Course-based research.  A “high-impact practice”  Involves many students and makes science more inclusive (Bangera and Bronwell, CBE Life Sc. Educ 2014. 13:602-606).

Un d e rg ra d u a te Educator Ne two rk We b in a r

BIOL 264: Gene Manipulation • A project with toxicological relevance. • Students clone cDNAs encoding Cytochrome P4501A (CYP1A) enzymes from fish. • They then use the sequences of the cDNA clones to: 1. Construct the phylogenetic history of the protein during vertebrate evolution. 2. Determine the effect of contaminant AHR agonists on the expression of the associated mRNAs.

Un d e rg ra d u a te Educator Ne two rk We b in a r

Learning Goals • Students gain experience in experimental design, performance, and data analysis. • Technical experience includes:       

Isolation, quantitation, and manipulation of nucleic acids. Electrophoresis. Polymerase chain reaction. Measurement of mRNA expression. Bioinformatics and use of public sequence databases. Figure construction. Scientific writing.

Un d e rg ra d u a te Educator Ne two rk We b in a r

Cytochrome P4501A (CYP1A) • Phase I monooxygenase with xenobiotic and endogenous substrates • mRNA strongly induced by contaminant agonists of the aryl hydrocarbon receptor (AHR)  Polycyclic aromatic hydrocarbons (e.g., benzo[a]pyrene, petroleum hydrocarbons)  Planar halogenated aromatic hydrocarbons (e.g., chlorinated dioxins, PCBs)

Un d e rg ra d u a te Educator Ne two rk We b in a r

Cytochrome P4501A (CYP1A) • Common to all vertebrates, including bony fish • Multiple paralogs in many vertebrate groups  e.g., CYP1A1 and CYP1A2 in mice and humans

• Most fish have a single CYP1A gene, but some have multiple paralogs

Un d e rg ra d u a te Educator Ne two rk We b in a r

CYP1A: A Useful Model for Undergraduate Molecular Biology Labs • High mRNA expression level  Facilitates cDNA cloning by inexperienced students using RT-PCR

• Environmental Toxicology  A useful biomarker of contaminant exposure.

• Molecular Evolution  Questions about gene duplication provide an interesting research question.

Un d e rg ra d u a te Educator Ne two rk We b in a r

Animal Collection and Exposure* • Sources:  Collected locally with minnow traps  Local bait shops  Gulf Specimen Marine Laboratories • Exposures (16-24 h):  IP: 10 ng/g TCDD in corn oil (5 ng/μl)  Waterborne: (1 nM TCDD, 0.1% corn oil)  Less toxic alternatives, e.g. β-NF • MS-222 anesthesia; dissect and freeze organs

Gulf killifish (Fundulus grandis) *All

Southern Redbelly Dace (Chrosomus erythrogaster)

protocols approved by Kenyon College IACUC

Central stoneroller minnow (Campostoma anomalum)

Creek Chub (Semotilus atromaculatus)

Bluegill (Lepomis macrochirus)

Photos: nanfa.org

Un d e rg ra d u a te Educator Ne two rk We b in a r

Total RNA Isolation and Analysis • RNA STAT-60 (Tel-Test CS-112; a TRIZOL-type reagent). • 100-200 mg of tissue allows all centrifugation steps to be performed in a microcentrifuge. • This is the most hazardous activity of the semester. Training, gloves, coats, face shields are crucial. • Assess integrity of total by electrophoresis. 5 µg/lane. • Promega RNA markers (G3191). 

Package insert provides recipes for denaturing load buffer and formaldehyde-free gels.

1 nt 6853 4981 3638 2604 1908 1383 955 623 281

2

28S

18S

Un d e rg ra d u a te Educator Ne two rk We b in a r

RT-PCR with Degenerate Primers •

•

•

•

•

•

Students design degenerate primers based on regions of amino acid conservation. Design principles outlined in Wilkie and Simon (1991).

HI for/rev

Student primers

Additional primers are derived from Iwata and Stegeman (2000; “HI primers”). Based bp on nucleotide sequences well conserved 2000 between all teleosts. 1500 1000 GeneAmp Gold RNA PCR Reagent Kit (Life 750 Technologies N8080143). 500 250

Reverse transcriptase reactions use 1 µg total RNA and random hexamer primers. PCR reactions use 1 µM degenerate primers, 45 cycles, 50˚ annealing temperature.

HI primers produce a product of ~430 bp. Primers designed in class will produce products of various predictable sizes.

1 2 (-RT)

3

4

5

HI-for: 5’-ACAAGGACAACATCCGTGAC-3’ HI-rev: 5’-TCATGGTTGATCTGCCACTG-3’

Un d e rg ra d u a te Educator Ne two rk We b in a r

Cloning the Amplified cDNA •

Gel purify PCR products (QIAquick Gel Extraction Kit; QIAGEN 28704).

•

Clone into pGEM-T Easy (Promega).  TA cloning  Blue/White Screening

•

Transform ligations into chemically competent JM109 cells (Promega).

•

Plate on LB agar containing 100 µg/ml ampicillin, 0.1 mM IPTG, and 40 µg/ml XGal).

•

Grow 8-10 White colonies in 5 ml liquid LB with 100 µg/ml ampicillin. Plasmid minipreps are performed using the QIAprep kit (QIAGEN 27104).

Promega pGEM-T Easy

Colonies resulting from a blue/white cloning screen.

Un d e rg ra d u a te Educator Ne two rk We b in a r

Cloning the Amplified cDNA •

•

•

•

Screen minipreps for insert size by EcoRI digestion and electrophoresis on 1% agarose/1X TAE. Plasmids containing an insert of predicted size are sequenced. A central repository (LIMS) for results can be shared with students for bioinformatic analysis. Sequence 2-3 miniprep DNAs per pair of students (15-30 clones per class section).

white colonies

bp 4000 3000 2000 1500 1000 750 500 250

Vector (~3000 bp) Insert (~440 bp)

Un d e rg ra d u a te Educator Ne two rk We b in a r

Sequence Analysis: BLAST, Alignments, and Molecular Phylogenies Important questions students resolve: Q: Have you cloned a CYP1A cDNA? What is the specific orthology of your cDNA(s)? How will that affect naming? BLAST search, phylogeny of amino acid sequences

Q: Are your clones identical, or do they differ in nucleotide or amino acidsequence? Clustal alignments.

Q: Any evidence for multiple CYP1A genes in the species? How much sequence divergence would indicate multiple genes? What other types of evidence would you want to be sure?

Un d e rg ra d u a te Educator Ne two rk We b in a r

Sequence Analysis: BLAST, Alignments, and Molecular Phylogenies

Amino acid alignment of fish CYP1As

Bioinformatics Resources Many web-based tools for contig assembly, translation, alignment, and phylogenies are freely available. These change constantly. Encourage students to explore and find what they need! www.expasy.org www.bioinformatics.org

ncbi.nlm.nih.gov www.clustal.org

Phylogeny of vertebrate CYP1As. Neighbor-joining tree generated in Clustal X and visualized with TreeView.

Un d e rg ra d u a te Educator Ne two rk We b in a r

mRNA Expression Analysis •

Examine expression of the mRNA encoded by the student-generated CYP1A clone(s).

•

Experiment is built around a story from a contaminated site.

•

•

Use CYP1A expression as a biomarker of exposure.

•

Oil and fuel spills (local marinas and Deepwater Horizon) have garnered student interest.

Uses liver or gill from unexposed, TCDD-exposed or field-collected animals. •

Actual collections from potentially contaminated sites are preferred, but not necessary; exposures can also happen behind the scenes in the laboratory.

•

cDNA synthesis: TaqMan Reverse Transcription Reagents (LifeTech N8080234). Treat total RNA with DNase (Ambion, DNAfree Turbo) to remove residual genomic DNA.

•

PCR: Power SYBR Green PCR Master Mix (LifeTech 4368702). ABI 7500 Real Time PCR instrument.

•

Clean, uncontaminated work areas and pipettors are crucial! We use laminar flow hoods and cross-link all pipetmen with a UV Stratalinker (Stratagene) before use.

Un d e rg ra d u a te Educator Ne two rk We b in a r

mRNA Expression Analysis • PCR primers as designed by students in advance based on their sequences.

CYP1A Wolf Run +TCDD

• Universal primers for 18S rRNA are used for the endogenous control. 18Sfor: AAACGGCTACCACATCCAAG 18Srev: CCTCCAATGGATCCTCGTTA

• Threshold cycle (Ct) is determined from amplification plots. • Relative abundance of CYP1A mRNAs is calculated using the ∆∆Ct method.

-TCDD

Un d e rg ra d u a te Educator Ne two rk We b in a r

Typical Course Schedule Week

Activity

1 Check-in; introduction Insert background info here

Week

Activity

8

Transformations; Writing Workshop IIpeer review of recent assignment.

2

Isolate total RNA

9

Plasmid Minipreps; restriction digest

3

RNA electrophoresis. Degenerate Primer Design

10

Electrophoresis of digested plasmids; Prepare for sequencing.

4

Bioinformatics Workshop: Databases and Construction of Phylogenetic Trees

11

Introduction to Real-Time PCR; Primer Design; Sequence analysis

5

RT-PCR

12

cDNA synthesis; organize PCR reactions

6

Electrophoresis of RT-PCR products; Writing Workshop I-published papers.

13

Real Time PCR Reactions

7

Gel purification and ligation

14

Data Analysis and Check-out

Un d e rg ra d u a te Educator Ne two rk We b in a r

Final Assignment: Scientific Manuscript Students use cloning, sequence analysis, and expression data to craft a manuscript. Each student can choose the focus: 1.

An environmental toxicology paper • Focuses on CYP1A expression in fish from the contaminated site. • Cloning and phylogenies are important elements of biomarker development.

2.

A molecular evolution paper. • Focuses on the orthology and number of CYP1As. • Expression data provide important evidence that the sequence is actually a CYP1A.

Un d e rg ra d u a te Educator Ne two rk We b in a r

Reflections •

Molecular biology lab courses offer excellent opportunities to address topics and techniques of toxicological significance.

•

Special value for life sciences programs that lack specific toxicology courses.

•

CYP1A, which is strongly induced by exposure to numerous environmental contaminants, is especially well suited for cloning and expression studies.

•

Course-based research is a high-impact practice that make science more inclusive.

•

Student surveys indicate that they overwhelmingly value a lab class centered on a single research project. They also value the broadly transferable skills developed in this course.

•

Approximately 78% of Biochemistry/Molecular Biology majors in this course go on to have significant research experiences at Kenyon College and/or elsewhere (2002-2012).

Un d e rg ra d u a te Educator Ne two rk We b in a r

References and Additional Resources •

•

•

•

Berndtson, A.K., T.T. Chen. 1994. Two unique CYP1 genes are expressed in response to 3- methylcholanthrene treatment in rainbow trout. Arch Biochem Biophys; 310:187–95. Goldstone, Heather M. H., and John J. Stegeman. 2006. A Revised Evolutionary History of the CYP1A Subfamily: Gene Duplication, Gene Conversion, and Positive Selection. J Molec Evol 62.6: 708-17 Hogg, K. 2014. A primer for designing degerate primers. http://bitesizebio.com/18992/a-primer-for-designingdegenerate-primers/ Mahata, Shyamal C., Ryoichi Mitsuo, Jun-Ya Aoki, Hironori Kato, and Takao Itakura. 2003. Two Forms of Cytochrome P450 CDNA from 3-methylcholanthrene-treated European Eel Anguilla anguilla. Fisheries Sci 69.3: 615-24.

Un d e rg ra d u a te Educator Ne two rk We b in a r

References and Additional Resources, cont’d •

•

•

•

Powell, W.H. 2005. "Real Time PCR: Sample Data." http://biology.kenyon.edu/HHMI/Real_Time_PCR/Sample_D ata.htm. Powell, W.H. 2007. Comparison of Protein Sequences: BLAST Searching and Phylogenetic Tree Construction. Inquiry-based Integrated Instructional Unit, Teaching Genomics at Small Colleges Workshop, Vassar College. http://serc.carleton.edu/genomics/units/19100.html Whitehead, A., et al. 2011. Genomic and physiological footprint of the Deepwater Horizon oil spill on resident marsh fishes. PNAS 109:20298-20202. Wilkie, TM and MI Simon 1991. Cloning Multigene Families with Degenerate PCR Primers. Methods: A companion to Meth Enzymol 2:32-41

Un d e rg ra d u a te Educator Ne two rk We b in a r

Questions and Comments Send to “All Panelists” via Q&A panel.

Un d e rg ra d u a te Educator Ne two rk We b in a r

SOT Undergraduate Toxicology curriculum Resources

www.toxicology.org/education/edu/resources.asp

Un d e rg ra d u a te Educator Ne two rk We b in a r

Undergraduate Educator Network Webinars • • • • •

Using Open Source Biological Pathway Databases for Education and Discovery Evidence-Based Instructional Practices in Undergraduate Science Courses The Use of Technology to Teach Toxicology and Related Disciplines Education and Enrichment Activities for Educators Having It All: Teaching, Research, and Service at a Small Liberal Arts College: A Toxicologist’s Perspective www.toxicology.org/education/edu/ugWebinars.asp

Un d e rg ra d u a te Educator Ne two rk We b in a r

Questions and Comments Send to “All Panelists” via Q&A panel.

Un d e rg ra d u a te Educator Ne two rk We b in a r

Undergraduate Educator Network Webinar Series Thank you for participating!

(c) SOT2015