Translational and Clinical Research Treatment of Senile Osteoporosis in SAMP6 Mice by Intra–Bone Marrow Injection of Allogeneic Bone Marrow Cells KEIZO TAKADA, MUNEO INABA, NAOYA ICHIOKA, YUSUKE UEDA, MITSURU TAIRA, SUSUMU BABA, TOMOMI MIZOKAMI, XIAOLI WANG, HIROKO HISHA, HIROKAZU IIDA, SUSUMU IKEHARA First Department of Pathology, Department of Orthopedic Surgery, Department of Obstetrics and Gynecology, Transplantation Center, Kansai Medical University, Moriguchi City, Osaka, Japan Key Words. Senescence-accelerated mouse prone 6 mice • Osteoporosis • Intra– bone marrow • Bone marrow transplantation • Bone mineral density • Deoxypyridinoline

ABSTRACT A substrain of the senescence-accelerated mouse, SAMP6 (senescence-accelerated mouse prone 6), spontaneously develops osteoporosis early in life. Therefore, this strain is a useful animal model for developing new strategies for the treatment of osteoporosis in humans. We succeeded in treating osteoporosis in SAMP6 mice after the onset of this disease, using a newly developed method of bone marrow transplantation (BMT): Allogeneic bone marrow cells obtained from normal mouse strains were directly injected into the bone marrow cavity of irradiated SAMP6 mice (intra– bone marrow BMT [IBM-BMT]). After the treatment with IBM-BMT, hematolymphoid cells were completely reconstituted by donor-derived cells, and bone marrow stromal cells were also found to be of donor origin. The treated SAMP6

mice showed histologically-normal trabecular bone. In addition, bone mineral density and urinary deoxypiridinoline, a hallmark of bone destruction, were normalized. When the message levels of cytokines (tumor necrosis factor ␣, interleukin-6 [IL-6], IL-11, and receptor activator of nuclear factor–␬ B ligand [RANKL]) were examined, IL-11, RANKL (from bone marrow stromal cells), and IL-6 (from osteoclasts), which regulate bone remodeling, were restored to levels similar to those in normal B6 mice. These findings indicate that not only the hemopoietic system but also the bone marrow microenvironment were normalized after IBM-BMT, resulting in an amelioration of the imbalance between bone absorption and formation. STEM CELLS 2006; 24:399 – 405

INTRODUCTION

disease, no effective treatment of primary osteoporosis has yet been established. The increase in marrow adipogenesis associated with osteoporosis and age-related osteopenia is well known clinically [2]. Furthermore, it has been reported that various cytokines are involved in this complex phenomenon. Interleukin-11 (IL-11) inhibits adipogenesis and, thereby, enhances osteoblastogenesis in the bone marrow (BM). Therefore, the reduced expression of IL-11 might lead to a lower rate of osteoblastogenesis and, reciprocally, a greater rate of adipogenesis [3]. IL-6 is also

Osteoporosis, now defined as a disease characterized by low bone mass and a microarchitectural deterioration of bone tissue leading to enhanced bone fragility and fracture risk, is a major public health problem. It is estimated that 35% of women above the age of 65 suffer from primary osteoporosis [1]. The conventional hormonal therapies used to prevent and treat osteoporosis associated with menopause have recently been questioned due to the risk/benefit ratio of prolonged treatment. Though there is a critical need for safe and effective therapeutics for this

Correspondence: Susumu Ikehara, M.D., Ph.D., First Department of Pathology, Kansai Medical University, 10-15 Fumizono-cho, Moriguchi City, Osaka 570-8506, Japan. Telephone: 81-6-6993-9429; Fax: 81-6-6994-8283; e-mail: [email protected] Received February 18, 2005; accepted for publication July 12, 2005; first published online in STEM CELLS EXPRESS August, 18, 2005. ©AlphaMed Press 1066-5099/2006/$20.00/0 doi: 10.1634/stemcells.2005-0068

STEM CELLS 2006;24:399 – 405 www.StemCells.com

Treatment of Osteoporosis in SAMP6 Mice

400

important in the regulation of osteoclastogenesis [4], and tumor necrosis factor ␣ (TNF-␣) can stimulate the production of IL-6, resulting in an augmentation of TRANCE/RANKL (TNF-related activation-induced cytokine receptor/ receptor activator of nuclear factor–␬ B ligand), which induces osteoclastogenesis [5]. Furthermore, transforming growth factor ␤ (TGF-␤) might also be involved in bone metabolism, especially osteoblastogenesis [6]. Thus, the onset of osteoporosis could be due to an imbalance of these various factors, and we are only now beginning to understand the mechanisms underlying the onset of osteoporosis. Therefore, at present, the treatment of osteoporosis is a combination of therapies, including pharmacological, dietary, and lifestyle interventions, and an effective procedure for treating primary osteoporosis needs to be established. A substrain of the senescence-accelerated mouse, SAMP6 (senescence-accelerated mouse prone 6), spontaneously develops osteoporosis early in life. Various indices related to osteoporosis, such as bone mass, deoxypyridinoline (DPD) in urine, and histological changes in the lumbar spine, become progressively aggravated in untreated SAMP6 mice, and this strain is therefore a useful model for examining the mechanisms and treatment of osteoporosis in humans. Recently, we have developed a new and effective method for BM transplantation (BMT): BM cells (BMCs) are directly injected into the BM cavity (the tibia) of recipient mice so that donor-derived hemopoietic cells accumulate in a microenvironment rich in stromal cells [7]. After the intra–BM injection of BMCs (IBM-BMT), the engraftment of donor-derived cells is much enhanced when compared with intravenous or portal venous BMT. In a previous report [8], we describe the application of IBM-BMT to SAMP6 mice to prevent the onset of osteoporosis. Various indices related to osteoporosis were retained at normal levels (similar to those observed in normal strains) for more than 1 year after the treatment with IBM-BMT. Furthermore, both hematolymphoid cells and stromal cells from the recipient SAMP6 mice treated with IBM-BMT were completely reconstituted with cells of donor origin, resulting in an improvement in the cytokine milieu; the production of IL-11 from the stromal cells and IL-6 from the osteoclasts was normalized. Therefore, after IBM-BMT, a BM microenvironment normal for bone formation is re-established, and this leads to the prevention of the early onset of osteoporosis in SAMP6 mice. In the present study, we have tried to treat osteoporosis after its onset in aged SAMP6 mice by IBM-BMT. After the treatment, no clinical signs of osteoporosis were observed, and the balance in cytokine production related to bone absorption and formation was restored.

MATERIALS

AND

Preparation and Inoculation of BMCs BMCs were collected from the femurs and tibias of B6 mice. The whole BMCs were directly injected into the BM cavity (IBM injection) to facilitate the early recovery of hemopoiesis and donor cell engraftment. IBM injection was carried out according to the method described previously [7, 8]. In brief, the knee was flexed to 90 degrees and the proximal side of the tibia was drawn to the anterior. A 26-gauge needle was inserted into the joint surface of the left tibia through the patellar tendon and then inserted into the BM cavity of the left tibia. Using a microsyringe (50 ␮l; Hamilton Company, Reno, NV, http:// www.hamiltoncompany.com), the donor BMCs (3 ⫻ 107/10 ␮l) were injected into the BM cavity, as shown in Figure 1.

Experimental Protocols SAMP6 mice (H-2d, 10 months old) were irradiated in fractionated doses (4.5 Gy ⫻ 2 ⫽ 9 Gy; 4-hour interval), and 1 day after the irradiation, the mice were transplanted with whole BMCs (3 ⫻ 107) from B6 mice (H-2b) via IBM injection (IBM-BMT). SAMP6 mice, irradiated and transplanted with syngeneic SAMP6 BMCs (3 ⫻ 107) by IBM injection [IBM-BMT (SAMP63 SAMP6)], were prepared as controls.

Surface Marker Analyses Spleen cells and BMCs were prepared from the recipient mice. To detect donor- or residual recipient-derived cells, the cells were stained with fluorescein isothiocyanate (FITC)– conjugated anti–H-2Kd and phycoerythrin (PE)– conjugated anti–H2Kb monoclonal antibodies (mAbs) (PharMingen, San Diego, CA, http://www.bdbiosciences.com/pharmingen). FITC- or PEconjugated mAbs against CD45R (B220), CD4, CD8, CD11b, and Gr-1 (PharMingen) were used to analyze the cells with mature lineage markers. The cells were analyzed using a FACScan (Becton, Dickinson and Company, Mountain View, CA, http://www.bd.com).

METHODS

Mice Female SAMP6/Ta mice (SAMP6, H-2d) were kindly donated by the Council for SAM Research (Kyoto, Japan, http://samrc. md.shinshu-u.ac.jp). The mice were maintained in our animal facility under specific pathogen-free conditions. C57BL/6 (B6, H-2b) and C3H/HeN mice (C3H, H-2k) were purchased from SLC (Shizuoka, Japan, http://www.jslc.co.jp). Those mice were maintained in our animal facilities under specific pathogen-free conditions until use.

Figure 1. Experimental protocol and IBM-BMT. SAMP6 mice at the age of 10 months were irradiated two times with 4.5 Gy, and BMCs from normal B6 mice were injected directly into the bone marrow cavity (IBM-BMT) of the left tibia as shown in the lower part of the figure. Abbreviations: BMC, bone marrow cell; IBM-BMT, intra– bone marrow bone marrow transplantation; SAMP6, senescence-accelerated mouse prone 6.

Takada, Inaba, Ichioka et al.

Histological Findings The lumbar spine and femur of the recipient mice were removed, fixed in 10% formalin, and decalcified. The sections were stained with hematoxylin and eosin.

Microdensitometry Bone mass was roentgenologically assayed according to the method described in our previous paper [8], and statistical analyses of the bone mass of the recipient mice were performed using a t-test.

DPD Analysis Urine specimens were collected from the treated and nontreated SAMP6 and B6 mice, and urinary DPD was quantified by an ELISA (enzyme-linked immunosorbent assay) kit (Quidel Corp., San Diego, CA, http://www.quidel.com), to evaluate the bone loss.

Cultured Stromal Cells Cultured stromal cells were obtained as previously described [7, 8]. Donor BMCs were injected into the BM cavity of left tibia, and the stromal cells were obtained from the BM that had not been injected with donor BMCs. In brief, the femurs, right tibias, and humeri where BMCs had not been injected were cut into pieces after the BMCs had been extensively washed out from these bones, and the bone pieces were cultured in a flask. The medium (RPMI 1640 with fetal bovine serum [FBS]) in the flask was replaced weekly with the same volume of fresh culture medium. Three weeks later, nonadherent cells, if any, were extensively removed, and the adherent cells were then collected from the surface of flasks using Cell Dissociation Solution (Sigma, St. Louis, http://www.sigmaaldrich.com). The adherent cells were stained with stromal cell–specific anti-PA6 mAbs previously established in our lab [9], followed by PE–anti-Rat Immunoglobulin G (IgG) (Gibco-BRL, Gaithersburg, MD, http://www.gibcobrl.com). After blocking with normal rat IgG (PharMingen), the cells were further stained with FITC-conjugated anti–H-2Kd or anti–H-2Kb and analyzed by a FACScan. The cultured cells stained with isotype-matched Igs served as a negative control.

In Vitro Osteocyte Differentiation Assay Osteogenic differentiation was induced by culturing stromal cells for 3 weeks in differentiation medium: 10% FBS in Dulbecco’s modified Eagle’s medium supplemented with 50 ␮g/ml ascorbic acid (Sigma), 10 mM ␤-glycerophosphate (Sigma), and 0.01 ␮M dexamethasone (Sigma). The medium was refreshed every 2 days. Mineralized deposits specific for osteocytes were visualized by von Kossa staining.

Mixed Leukocyte Reaction Mixed leukocyte reaction (MLR) was performed as follows: The splenic T cells (2 ⫻ 105) were cultured with 2 ⫻ 105 responder T cells and 2 ⫻ 105 irradiated (12 Gy) stimulator spleen cells for 72 hours and pulsed with 0.5 ␮Ci of [3H]thymidine for the last 16 hours of the culturing period.

Isolation of CD11bⴙ Cells BMCs were stained with PE-conjugated anti-CD11b mAb (PharMingen), and CD11b⫹ cells were sorted as osteoclastwww.StemCells.com

401

lineage cells by an EPICS Altra (Beckman Coulter, Fullerton, CA, http://www.beckmancoulter.com).

Reverse Transcription–Polymerase Chain Reaction Assay The message level of cytokines related to the bone formation was determined by reverse transcription–polymerase chain reaction (RT-PCR). We prepared two pairs of primers for IL-11, (forward 1: 5⬘-TGTCGCCTGGTCCTGGTGGT-3⬘, reverse 1: 5⬘-TGCACGGCGCAGCCA-TTGTA-3⬘, and forward 2: 5⬘GAGTAGACTTGATGTCCTAC-3⬘, reverse 2: 5⬘-TAAATAAATAAGATC-TGGTT-3⬘). IL-11 cDNA was amplified by two pairs of primers under the following conditions: 96°C for 1 minute, 60°C for 1 minute, 72°C for 2 minutes 28 cycles and a final extension at 72°C for 10 minutes. Primers for IL-6 (forward: 5⬘-AAAGAGTTGTGCAATGGCAATTCT-3⬘, reverse: 5⬘-AAGTGCATCATCGTTGTTCATACA-3⬘), TNF␣ (forward: 5⬘-CTTCAGACCTTTCCAGACTCTTCC-3⬘, reverse: 5⬘-AGAGGTTCAGTGATGTAGCGACAG-3⬘), TGF-␤ (forward: 5⬘-TTTCGATTCAGCGCTCACTGCTCTTGTGAC-3⬘, reverse: 5⬘-ATGTTGGACAACTGCTCCACCTTGGGCTTGC-3⬘), receptor activator of nuclear factor–␬ B (RANK) (forward: 5⬘-TCCAGGTCACTCCTCC-ATGC, reverse: 5⬘GTTCCAGTGGTAGCCAGCCG), RANKL (forward: 5⬘-AAGCTTTGGATCCTAACAGAATATC, reverse:5⬘-AAGCTTCAGTCTATGTCCTGAACTT), and osteoprotegerin (OPG) (forward: 5⬘-CAATGAACAAGTGGCTGTGC, reverse: 5⬘TTCCTCCTCACTGTGCAGTG) were also prepared and used for RT-PCR (Nisshinbo Co., Ltd., Chiba, Japan, http:// www.nisshinbo.co.jp). The PCR products were electrophoresed on a 1% agarose gel, stained with ethidium bromide (0.5 ␮g/ml), and visualized by UV transilluminator (ATTO Corp., Tokyo, Japan, http://www.atto.co.jp).

RESULTS BMT We have previously reported that BMT via IBM injection (IBMBMT) facilitates early donor cell engraftment without the development of any signs of graft-versus-host disease [7]; not only hemopoietic cells but also stromal cells are reconstituted with cells of donor origin. Using this method, we have succeeded in preventing osteoporosis in SAMP6 mice. Therefore, we applied this new strategy (IBM-BMT) to the treatment of osteoporosis. SAMP6 mice spontaneously develop osteoporosis at the age of 6 months, and the onset of osteoporosis has been determined by clinical indices, including bone mineral density (BMD), urinary DPD, and histopathological findings. Using these markers, we examined the effects of IBM-BMT on the treatment of osteoporosis after its onset. IBM-BMT was performed on SAMP6 mice at 10 months of age (Fig. 1). After the treatment of SAMP6 mice with IBM-BMT, the following analyses were carried out.

Cell Surface Antigens We carried out fluorocytometrical analyses of cells harvested from the recipient SAMP6 mice and examined the engraftment of donor-derived cells and also immunological functions. As shown in Table 1, the percentage of donor (B6)– derived cells (H-2b⫹) in the spleen approached 100%. The donor-derived cells with mature lineage markers (B220, CD4, CD8, Mac-1,

Treatment of Osteoporosis in SAMP6 Mice

402

Table 1. Analyses of cell surface antigens on donor-derived cells in SAMP6 mice treated with IBM-BMT Cell surface antigen (%) Mice (age)

B220

CD4

CD8

CD11b

H-2 typing (%) Gr-1

H-2d

H-2d

Untreated C57BL/6 (16 months) 52.1 ⫾ 5.5 17.7 ⫾ 1.4 15.0 ⫾ 2.7 6.9 ⫾ 1.2 7.9 ⫾ 1.3 0.0 ⫾ 0.0 99.8 ⫾ 0.3 Untreated SAMP6 (16 months) 53.6 ⫾ 5.6 24.7 ⫾ 1.3 11.6 ⫾ 1.1 12.2 ⫾ 4.3 9.7 ⫾ 5.2 99.7 ⫾ 0.0 0.0 ⫾ 0.0 SAMP6 treated with [IBM-BMT] (16 months) 63.2 ⫾ 5.2 16.4 ⫾ 1.9 7.4 ⫾ 0.9 7.8 ⫾ 0.5 6.4 ⫾ 1.1 0.02 ⫾ 0.1 99.4 ⫾ 0.8 Abbreviations: IBM-BMT, intra– bone marrow bone marrow transplantation; SAMP6, senescence-accelerated mouse prone 6.

and Gr-1) were generated at normal levels in the spleen (Table 1) and BM (data not shown) when assayed 6 months after the treatment with IBM-BMT. These recipients, which were completely reconstituted with donor-derived cells, have survived more than 18 months after the treatment (28 months of age), and the numbers and frequencies of cells in each lineage have remained at normal levels (data not shown), indicating that hemopoietic stem cells are also reconstituted with donor-derived cells, which are retained in the recipients. As stromal cells have been reported to be one of a number of crucial populations that participate in bone formation, we examined the reconstitution of stromal cells. Cultured stromal cells were double-stained with stromal cell–specific mAb (antiPA6 mAb) [9] and anti–H-2b mAb. Anti-PA6 mAb can inhibit pseudoemperipolesis and suppress the proliferation of hemopoietic stem cells, suggesting that this mAb reacts with molecules responsible for the interaction between hemopoietic stem cells and stromal cells. Anti-PA6 mAb was actually specific for the cells that can support hemopoiesis, such as MS5, or fetal/adult BM-derived stromal cells. However, mature and immature cells with hemopoietic lineages cannot be stained with this mAb. As shown in Figure 2, stromal cells collected from SAMP6 mice treated with IBM-BMT were confirmed to be of donor origin (H-2b⫹). The FACS (fluorescence-activated cell sorter) profile of stromal cells stained by anti–H-2d (H-2 of the recipient type) was similar to that stained by the isotype-matched control mAb or unrelated anti–H-2k mAb (data not shown). These findings indicate that not only the hemopoietic cell lineage but also cells of mesenchymal origin were reconstituted with donor-type cells after IBM-BMT. Furthermore, osteocytes, defined by von Kossa staining, were differentiated from stromal cells that were completely of donor origin when the stromal cells were cultured for a further 3 weeks in the presence of differentiation medium (data not shown). This strongly suggests that the osteocytes in the recipients are also of donor origin as hemopoietic lineage cells.

Figure 2. Analysis of stromal cells from SAMP6 mice treated with IBM-BMT. The bone pieces without BMCs from SAMP6 mice treated with IBM-BMT were cultured for 3 weeks, and then the adherent cells were collected. The adherent cells were stained with anti-PA6 mAb followed by phycoerythrin-conjugated anti-Rat IgG, then blocked with normal rat IgG. They were further stained with FITC-conjugated anti– H-2Db mAb (donor type) or anti–H-2Dd mAb (recipient type). The histogram shows that stromal cells (positive for anti-PA6 mAb) are of donor origin (line). The profile of the cells stained with FITC-conjugated anti–H-2Dd mAb (dotted line) is similar to that stained with an isotype-matched Ig control (histogram not shown). Abbreviations: BMC, bone marrow cell; FITC, fluorescein isothiocyanate; IBM-BMT, intra– bone marrow bone marrow transplantation; IgG, immunoglobulin G; mAb, monoclonal antibody; SAMP6, senescence-accelerated mouse prone 6.

mice (24 months old) were examined (Fig. 4C) However, SAMP6 mice treated with IBM-BMT showed a marked increase in trabecular bone at 24 months of age (14 months after the treatment) (Fig. 4D). It should be noted that osteoporosis was observed in SAMP6 mice that had received syngeneic SAMP6 BMCs [IBM-BMT (SAMP63 SAMP6)] when assayed at 18 months of age (data not shown).

Immunological Functions Newly developed T cells showed tolerance to both host (SAMP6)–type and donor (B6)–type major histocompatibility complex determinants, whereas they showed normal responses to third party (C3H) cells when examined in MLR (Fig. 3).

Histopathological Findings The aged SAMP6 mice exhibited histopathological findings of osteoporosis. Figure 4 shows the histology of a lumbar spinal vertebral body. Untreated SAMP6 mice showed a significant loss of trabecular and cortical bone thickness at 12 months of age (Fig. 4B) when compared with that of young (2 months) SAMP6 mice (Fig. 4A). This was more prominent when older

BMD and Urinary DPD As shown in Figure 5, normal B6 mice showed the highest BMD at 12 months of age, and this then gradually decreased, whereas the highest BMD was observed at 5– 6 months of age in [IBMBMT (SAMP63 SAMP6)] mice, and this thereafter rapidly decreased. After the treatment of SAMP6 mice at 10 months of age with IBM-BMT, the BMD was similar to or higher than that of normal B6 mice. An increase in urinary DPD is one of the clinical hallmarks of osteoporosis, and the curative effect of IBM-BMT was also observed in the measurement of DPD. DPD in SAMP6 mice treated with IBM-BMT remained continuously low until 17

Takada, Inaba, Ichioka et al.

Figure 3. Mixed leukocyte reaction. The splenic responder T cells (2 ⫻ 105) were cultured with 2 ⫻ 105 irradiated (12 Gy) stimulator spleen cells for 72 hours and pulsed with 0.5 ␮Ci of [3H]-thymidine for the last 16 hours of the culturing period. Abbreviations: IBM-BMT, intra– bone marrow bone marrow transplantation; SAMP6, senescence-accelerated mouse prone 6.

Figure 4. The lumbar spinal vertebral body of the untreated SAMP6 mouse at 2 months (A), 12 months (B), and 24 months (C) after the birth. Significant loss of trabecular bone and cortical bone thickness was observed at 12 months of age or older. SAMP6 mouse treated with IBM-BMT showed an increase in trabecular bones at 24 months of age (14 months after the treatment) (D). Abbreviations: IBM-BMT, intra– bone marrow bone marrow transplantation; SAM, senescence-accelerated mouse; SAMP6, senescence-accelerated mouse prone 6.

months of age (7 months after IBM-BMT) and was similar to or lower than that observed in normal B6 mice (Fig. 6). Untreated SAMP6 mice showed kinetic changes in DPD similar to those observed in [IBM-BMT (SAMP63 SAMP6)] mice (data not shown). From these findings, it can be concluded that IBM-BMT is effective in treating osteoporosis, and the reconstitution of both donor-derived hematolymphoid cells and stromal cells (mesenchymal origin) might be important in ameliorating osteoporosis in SAMP6 mice. Therefore, the cytokines produced from these cells and involved in bone formation were investigated next.

Analyses of Cytokines Several cytokines are related to bone formation or remodeling. IL-11 is known to enhance osteoblastogenesis, TNF-␣ and IL-6 www.StemCells.com

403

Figure 5. Age-related changes in bone mineral density. Symbols and vertical bars represent the means ⫾ SDs of five mice. Abbreviations: IBM-BMT, intra– bone marrow bone marrow transplantation; SAMP6, senescence-accelerated mouse prone 6.

Figure 6. Kinetic changes of urinary DPD. DPD was measured by ELISA and was normalized in SAMP6 mice treated with IBM-BMT, compared with that of normal B6. Symbols and vertical bars represent the means ⫾ SDs of five mice. Abbreviations: DPD, deoxypiridinoline; ELISA, enzyme-linked immunosorbent assay; IBM-BMT, intra– bone marrow bone marrow transplantation; SAMP6, senescence-accelerated mouse prone 6.

are known to augment osteoclast functions [10], and TGF-␤, which is produced by osteoblasts and stored in substantial amounts in the bone matrix, is an important regulator of both skeletal development and homeostasis of bone metabolism [11]. Furthermore, the osteoprotegerin/RANKL/RANK system seems to be an essential signaling pathway by which osteoblasts control the pool size of active osteoclasts [12]. Therefore, we next examined some of these cytokines at the message level by RT-PCR in cultured BM stromal cells. Stromal cells were collected from the SAMP6 mice treated with IBM-BMT and control mice (untreated young and aged B6 or SAMP6 mice). The message level of these cytokines from treated SAMP6 was compared with those of controls. As shown in Figure 7, the expression of IL-11 was found to decrease in stromal cells derived from untreated SAMP6 mice at the age of 20 months when compared with that of young SAMP6 (2 months) or the same-aged (20 months) normal B6 mice. It should be noted that after IBM-BMT (29 months of age, 19 months after IBM-BMT), the message level of IL-11 in the stromal cells was restored to a level similar to that observed in

404

normal B6 mice. The expression of IL-11 in the stromal cells of IBM-BMT (B63 B6) mice or IBM-BMT (SAM3 SAM) mice was similar to that of untreated B6 or untreated SAMP6 mice with corresponding ages, respectively (data not shown). Furthermore, the expression of IL-6 was determined in the sorted CD11b⫹ BMCs as osteoclast lineage cells. After IBM-BMT, IL-6 that had increased in untreated SAMP6 mice (20 months) was restored to the normal levels observed in untreated normal control B6 mice (2 months and 20 months of age) (Fig. 7). Furthermore, the message levels of RANKL, which had decreased in untreated SAMP6 mice (20 months), also increased to the normal level. The other cytokines, TNF-␣ and TGF-␤, were uniformly expressed in the cells from treated, untreated, or normal control B6 mice. Furthermore, the expression of RANK, OPG (osteoprotegerin as an inhibitor of RANK–RANKL interaction), and SDF-1 (stromal cell– derived factor-1) messages remained unchanged. These results indicate that IBM-BMT can reconstitute BM stromal cells and osteoclasts with normal donor-origin cells and therefore normalize the BM microenvironment for bone formation where the reconstituted stromal cells and osteoclasts can do cell– cell interaction through related cytokines and their ligands, which results in an amelioration of the imbalance between bone formation and resorption in osteoporosis-prone SAMP6 mice.

DISCUSSION Osteoporosis is a disorder of decreased bone mass, microarchitectural deterioration, and fragility fractures. Osteoporosis is widespread and can affect people of all ethnic backgrounds as well as many older women and men. An essential element in preventing osteoporosis is the achievement of normal peak bone mass, and essential elements in achieving peak bone mass are adequate nutrition, appropriate intake of calcium and vitamin D, regular menstrual cycles, and a well-balanced exercise program. After its onset, the present treatment of osteoporosis is combi-

Figure 7. Analyses of cytokine messages. mRNA was extracted from the stromal cells derived from SAMP6 mice treated with IBM-BMT, and the cytokines related to bone formation and remodeling were measured by reverse transcription–polymerase chain reaction. It is noted that the expression of IL-11, IL-6, and RANKL was normalized after IBM-BMT. Abbreviations: G3PDH, glyceraldehyde-3-phosphate dehydrogenase; IBM-BMT, intra– bone marrow bone marrow transplantation; IL, interleukin; OPG, osteoprotegerin; RANK, receptor activator of nuclear factor–␬ B; RANKL, receptor activator of nuclear factor–␬ B ligand; SAMP6, senescence-accelerated mouse prone 6; TGF, transforming growth factor; TNF, tumor necrosis factor.

Treatment of Osteoporosis in SAMP6 Mice nation therapy consisting of pharmacological and dietary interventions. However, the protocols have recently been questioned due to the risk/benefit ratio of prolonged treatment. Thus, there is a critical need for safe and effective alternative therapeutics for this disease. We have previously found that BMT has a curative effect on various diseases, including organ-specific or systemic autoimmune diseases [13–15], by reconstituting the abnormal hematolymphoid system with normal cells. Furthermore, we have found that stromal cells are important for the success of BMT, because they support the early engraftment of donor-derived progenitor cells, and also have the capacity to retain hemopoietic stem cells to maintain long-term hemopoiesis and reconstitution by donor-derived cells [16 –19]. Based on these studies, we have established a new and effective method for BMT, the IBM injection of BMCs (IBM-BMT) [7]. IBM-BMT facilitates the engraftment of donor-derived hematolymphoid cells, in contrast to intravenous or portal venous BMT. Importantly, the stromal cells were also found to be reconstituted with donorderived cells, and it is of note that we have never detected donor-derived stromal cells in the BMCs of recipient mice after i.v. BMT. However, we did observe donor-derived stromal cells when we carried out (a) i.v. BMT with bone grafts [17], (b) PV BMT (portal venous injection of BMCs) [16], or (c) IBM-BMT [7]. Therefore, it is feasible that osteoporosis could be prevented or treated by IBM-BMT, because its onset is possibly due to an imbalance between bone resorption and bone formation, which are governed by osteoclasts of hematopoietic GM-CFU (granulocyte-macrophage colony-forming units) origin [20, 21] and osteoblasts of pluripotent mesenchymal stem cell origin [22]. In line with this hypothesis, we performed IBM-BMT on SAMP6 mice and succeeded in preventing the onset of osteoporosis [8]. In this paper, we have applied this new strategy to the treatment of osteoporosis after its onset in aged SAMP6 mice. As described, osteoporosis observed in the aged SAMP6 mice was ameliorated by IBM-BMT; reduced urinary DPD and increased BMD were observed along with the reconstitution of hematolymphoid cells and stromal cells with donor-type cells. We noted that the production of cytokines related to both osteoblastogenesis and osteoclastogenesis was normalized, resulting in a normalization of the imbalance between osteoblastogenesis and osteoclastogenesis. It has been reported that the expression of an osteogenic cytokine, IL-11, decreases in SAMP6 mice [23] and that IL-11 transcription largely depends on activator protein 1 (AP-1) transcription factors, the activities of which decrease in SAMP6 mice [9]. Therefore, diminished AP-1 activity and the resultant decline in IL-11 expression by BM stromal cells may play a role in impaired bone formation in the aged SAMP6 mice [9]. In our experiment, the message level of IL-11 was restored to normal by IBM-BMT. Furthermore, the recent discovery of RANKL– RANK interaction confirms the well-known hypothesis that osteoblasts play an essential role in osteoclast differentiation. Osteoblasts express RANKL as a membrane-associated factor. Osteoclast precursors that express RANK (a receptor for RANKL) recognize RANKL through the cell– cell interaction and differentiate into osteoclasts. Recent studies have shown that lipopolysaccharide and inflammatory cytokines such as TNF receptor-alpha and IL-1 directly regulate osteoclast differentiation and function through a mechanism independent of the

Takada, Inaba, Ichioka et al. RANKL–RANK interaction [24]. Accordingly, we determined the message levels of RANKL and RANK, the former being restored after IBM-BMT to that observed in untreated normal B6 mice, though the message levels of RANK in osteoclast lineage cells remained stable and unchanged. Because the survival and activity of osteoclasts require M-CSF and RANKL [25], the normalization of RANKL production supports the regulatory function of osteoclasts that are reconstituted with donor hematopoietic cell origin. These results clearly indicate that IBM-BMT can reconstitute BM stromal cells and osteoclasts with cells of normal donor origin and therefore normalize the BM microenvironment. In the normal BM microenvironment, the imbalance between bone formation and resorption observed in the osteoporosis-prone SAMP6 mice has been ameliorated through the restored cell– cell interaction via related cytokines and their ligands.

405

nium program of the Ministry of Education, Culture, Sports, Science and Technology, a grant from the Science Frontier program of the Ministry of Education, Culture, Sports, Science and Technology, a grant from The 21st Century Center of Excellence (COE) program of the Ministry of Education, Culture, Sports, Science and Technology, a grant-in-aid for scientific research (B) 11470062, grants-in-aid for scientific research on priority areas (A)10181225 and (A)11162221, and Health and Labour Sciences research grants (Research on Human Genome, Tissue Engineering Food Biotechnology) and also a grant from the Department of Transplantation for Regeneration Therapy (sponsored by Otsuka Pharmaceutical Co., Ltd.), a grant from Molecular Medical Science Institute, Otsuka Pharmaceutical Co., Ltd., and a grant from Japan Immunoresearch Laboratories Co., Ltd. (JIMRO). We thank Mr. Hilary Eastwick-Field and Ms. K. Ando for their help in the preparation of the manuscript.

ACKNOWLEDGMENTS This work was supported by a grant from Haiteku Research Center of the Ministry of Education, a grant from the Millen-

DISCLOSURES

REFERENCES

14 Oyaizu N, Yasumizu R, Inaba-Miyama M et al. (NZW x BXSB)F1 mouse, a new model of idiopathic thrombocytopenic purpura. J Exp Med 1988;167:2017–2022.

1

Lan JM, Russell L, Kan SN. Osteoporosis. Clin Orthop 2000;372:139–150.

2

Nuttall ME, Gimble JM. Controlling the balance between osteoblastogenesis and adipogenesis and the consequent therapeutic implications. Curr Opin Pharmacol 2004;4:290 –294.

3

Kawashima I, Ohsumi J, Mita-Honjo K et al. Molecular cloning of cDNA encoding adipogenesis inhibitory factor and identity with interleukin-11. FEBS Lett 1991;283:199 –202.

4

Tamura T, Udagawa N, Takahashi N et al. Soluble interleukin-6 receptor triggers osteoclast formation by interleukin 6. Proc Natl Acad Sci U S A 1993;90:11924 –11928.

The authors indicate no potential conflicts of interest.

15 Nishimura M, Toki J, Sugiura K et al. Focal segmental glomerular sclerosis, a type of intractable chronic glomerulonephritis, is a stem cell disorders. J Exp Med 1994;179:1053–1058. 16 Kushida T, Inaba M, Takeuchi K et al. Treatment of intractable autoimmune diseases in MRL/lpr mice using a new strategy for allogeneic bone marrow transplantation. Blood 2000;95:1862–1868. 17 Ishida T, Inaba M, Hisha H et al. Requirement of donor-derived stromal cells in the bone marrow for successful allogeneic bone marrow transplantation: Complete prevention of recurrence of autoimmune diseases in MRL/lpr mice by transplantation of bone marrow plus bone (stromal cells) from the same donor. J Immunol 1994;152:3119 –3127.

5

Roggia C, Gao Y, Cenci S et al. Up-regulation of TNF-producing T cells in the bone marrow: A key mechanism by which estrogen deficiency induces bone loss in vivo. Proc Natl Acad Sci U S A 2001;98:13960 – 13965.

6

Mundy GR, Boyce B, Hughes D et al. The effects of cytokines and growth factors on osteoblastic cells. Bone 1995;17(suppl 2):71S–75S.

18 Takeuchi K, Inaba M, Miyashima S et al. A new strategy for treatment of autoimmune diseases in chimeric resistant MRL/l pr mice. Blood 1998;91:4616 – 4623.

7

Kushida T, Inaba M, Hisha H et al. Intra-bone marrow injection of allogeneic bone marrow cells: A powerful new strategy for treatment of intractable autoimmune diseases in MRL/lpr mice. Blood 2001;97:3292–3299.

19 Kushida T, Inaba M, Hisha H et al. Crucial role of donor-derived stromal cells in successful treatment for intractable autoimmune diseases in MRL/lpr mice by BMT via portal vein. STEM CELLS 2001;19:226 –235.

8

Ichioka N, Inaba M, Kushida T et al. Prevention of senile osteoporosis in SAMP6 mice by intrabone marrow injection of allogeneic bone marrow cells. STEM CELLS 2002;20:542–551.

9

Izumi-Hisha H, Soe T, Ogata H et al. Monoclonal antibodies against a preadipose cell line (MC3T3ⱖ2/P6) which can support hemopoiesis. Hybridoma 1991;10:103–112.

10 Tohjima E, Inoue D, Yamamoto N et al. Decreased AP-1 activity and interleukin-11 expression by bone marrow stromal cells may be associated with impaired bone formation in aged mice. J Bone Miner Res 2003;18:1461–1470. 11 Park BL, Han IK, Lee HS et al. Identification of novel variants in transforming growth factor-beta 1 (TGF␤1) gene and association analysis with bone mineral density. Hum Mutat 2003;22:257–258. 12 Takahashi N, Udagawa N, Suda T. A new member of tumor necrosis factor ligand family, ODF/OPGL/TRANCE/RANKL, regulates osteoclast differentiation and function. Biochem Biophys Res Commun 1999;256:449 – 455. 13 Ikehara S, Good RA, Nakamura T et al. Rationale for bone marrow transplantation in the treatment of autoimmune disease. Proc Natl Acad Sci U S A 1985;82:2483–2487.

www.StemCells.com

20 Kurihara N, Chenu C, Miller M et al. Identification of committed mononuclear precursors for osteoclast-like cells formed in long term human marrow cultures. Endocrinology 1990;126:2733–2741. 21 Hattersley G, Kerby JA, Chambers TJ. Identification of osteoclast precursors in multilineage hemopoietic colonies. Endocrinology 1991;128: 259 –262. 22 Malaval L, Modrowski D, Gupta AK et al. Cellular expression of bone-related proteins during in vitro osteogenesis in rat bone marrow stromal cell cultures. J Cell Physiol 1994;158:555–572. 23 Kodama Y, Takeuchi Y, Suzawa M et al. Reduced expression of interleukin-11 in bone marrow stromal cells of senescence-accelerated mice (SAMP6): Relationship to osteopenia with enhanced adipogenesis. J Bone Miner Res 1998;13:1370 –1377. 24 Katagiri T, Takahashi N. Regulatory mechanisms of osteoblast and osteoclast differentiation. Oral Dis 2002;8:147–159. 25 Glantschnig H, Fisher JE, Wesolowski G et al. M-CSF, TNFalpha and RANK ligand promote osteoclast survival by signaling through mTOR/S6 kinase. Cell Death Differ 2003;10:1165–1177.