Structure and Replication of DNA

Structure and Replication of DNA John Kyrk Animations • http://www.johnkyrk.com/DNAanatomy.html Are Genes Composed of DNA or Protein? • DNA – Only...
Author: Gloria Collins
0 downloads 2 Views 6MB Size
Structure and Replication of DNA

John Kyrk Animations • http://www.johnkyrk.com/DNAanatomy.html

Are Genes Composed of DNA or Protein? • DNA – Only four nucleotides • thought to have monotonous structure

• Protein – 20 different amino acids – greater potential variation – More protein in chromosomes than DNA

Bacterial Transformation Experiments Fredrick Griffith (1928) –demonstrate the existence of “Transforming Principle,” a substance able to transfer a heritable phenotype (trait) from one strain of bacteria to another. Avery MacLeod and McCarty – determine the transforming principle was DNA.

Streptococcus Pneumoniae

Griffith Experiment

Avery Experiment

Viruses Injecting DNA into a Bacterium Phage head

Tail sheath

Tail fiber

Bacterial cell

100 nm

DNA

Hershey Chase Experiment – Viruses can be used to transfer traits and therefore DNA

Traits can be transferred if DNA is transferred.

(a) Tobacco plant expressing a firefly gene

(b) Pig expressing a jellyfish gene

Additional Evidence • Chargaff Ratios • % A = %T and %G = %C (Complexity in DNA Structure) A T G C Arabidopsis 29% 29% 20% 20% Humans 31% 31% 18% 18% Staphlococcus 13% 13% 37% 37%

• DNA Content of Diploid and Haploid cells – Haploid cells contain half of the amount of DNA Gametes

Humans Chicken

3.25pg 1.267pg

Somatic Cells

7.30 pg 2.49pg

DNA Friedrich Meischer (1869) extracted a phosphorous rich material from nuclei of which he named nuclein DNA – deoxyribonucleic acid - Monomer – Nucleotide Deoxyribose Phosphate Nitrogenous Base (4 types – 2 purines G & A; 2 pyrimidines T & C) - Phosphodiester Bond linkage - DNA has direction - 5’ and 3’ ends - Chromosomes are composed of DNA

Fig. 16-UN1

Purines have two rings. Pyrimidines have one ring.

Purine + purine: too wide Pyrimidine + pyrimidine: too narrow Purine + pyrimidine: width consistent with X-ray data

Watson and Crick Model • Franklins X-Ray Data – DNA is Double Helix • • • •

2 nm diameter Phosphates on outside 3.4 nm periodicity Bases 0.34nm apart

• Watson and Crick – Base Pairing- Purine with Pyrimidine (A/T & C/G)

DNA Structure – Chromatin = unwound DNA Nucleosome (10 nm in diameter) DNA helix in diameter)

double (2 nm

H1 Histones

DNA, the double helix

video

Histones

Histone tail

Nucleosomes, or “beads on a string” (10-nm fiber)

Chromatin coils around proteins to form Chromosomes Chromatid (700 nm)

30-nm fiber

Loops

Scaffold 300-nm fiber

Replicated chromosome (1,400 nm)

30-nm fiber

Looped domains (300-nm fiber)

Metaphase chromosome

30 nm chromatin fiber

1. Held together by histone tails interacting with neighboring nucleosomes 2. Inhibits transcription 3. Allows DNA replication

DNA Replication:

Semiconservative Replication- DNA unzips and a new strand builds on the inside. The new strands each have a piece of the “old” DNA

Other Models of Replication Conservative Replication

Semi-Conservative Replication

Dispersive Replication

Culture Bacteria in 15N isotope (DNA fully 15N)

15N

DNA

One Cell Division in 14N

15N/14N

DNA

2nd Cell Division in 14N

14N

DNA

15N/14N

DNA

Less Dense

More Dense

Density Centrifugation

DNA Replication: A Closer Look • The copying of DNA is remarkable in its speed and accuracy • More than a dozen enzymes and other proteins participate in DNA replication

Copyright © 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings

• Replication bubbles are the “unzipped” sections where replication occurs all along the molecule • At the end of each replication bubble is a replication fork: a Y-shaped region where new DNA strands are elongating • Helicase: enzyme that unzips the double helix at the replication forks • Single-strand binding protein binds to and stabilizes single-stranded DNA until it can be used as a template • Topoisomerase corrects “overwinding” ahead of replication forks by breaking, swiveling, and rejoining DNA strands Copyright © 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings

Video

Origins of Replication

Fig. 16-13

Primase

Single-strand binding proteins

3

Topoisomerase

5 3

5

Helicase

5

RNA primer

3

DNA Polymerase – enzyme that builds the new strand

5’ 3’

3’

Pol 5’

Leading and Lagging Strands – Polymerase only works on the 3’ to 5’ DNA side. Must do the 5’ to 3’ side in segments called Okazaki fragments. 3’ to 5’ = Leading (easy) strand; 5’ to 3’ = lagging (segmented) strand 3’

5’

Pol

Leading Strand Lagging Strand

Pol

3’

RNA Primer

5’ Video

5’ 3’

Other Proteins at Replication Fork 3’ 5’

DNA Pol III Single Stranded Binding Proteins

Pol

Leading Strand

DNA Pol I Ligase

Lagging Strand

Pol Helicase

3’ 5’

Primase

5’ 3’

Lagging strand assembly and Okazaki fragments

Overview Origin of replication Lagging strand Leading strand Lagging strand 2

1

Leading strand Overall directions of replication

3

5 5

Template strand

3

RNA primer

3

5

3

1

5

3 5

Okazaki fragment

3

1 5

3

5

2

3

5

2

3

3 5

1

3 5

1

5

2

1

3 5

Overall direction of replication

Damaged DNA Nuclease Excision Repair – cut and replace

Nuclease

DNA Polymerase

Ligase

Replicating the Ends of DNA Molecules

• Limitations of DNA polymerase create problems for the linear DNA of eukaryotic chromosomes • The usual replication machinery provides no way to complete the 5 ends, so repeated rounds of replication produce shorter DNA molecules

Copyright © 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings

Replicating Ends of Linear Chromosomes

Fig. 16-19

5 Ends of parental DNA strands

Leading strand Lagging strand 3

Last fragment

Previous fragment

RNA primer

Lagging strand 5 3 Parental strand

Removal of primers and replacement with DNA where a 3 end is available

5 3

Second round of replication 5

New leading strand 3 New lagging strand 5 3 Further rounds of replication

Shorter and shorter daughter molecules

• If chromosomes of germ (sex) cells became shorter in every cell cycle, essential genes would eventually be missing from the gametes they produce • An enzyme called telomerase catalyzes the lengthening of telomeres in germ cells; it adds temporary DNA so the strand can be completed

Copyright © 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings

Telomerase

Telomeres

1 µm

END STRUCTURE/REPLICATION • Crash Course Video • DNA Activities

Chapter 10

From Gene to Protein

Protein Synthesis: overview  One gene-one enzyme

hypothesis (Beadle and Tatum)  One gene-one polypeptide (protein) hypothesis  Transcription: synthesis of RNA under the direction of DNA (mRNA)  Translation: actual synthesis of a polypeptide under the direction of mRNA

The “Central Dogma”  Flow of genetic information in a cell  How do we move information from DNA to proteins?

DNA

replication

RNA

protein DNA gets all the glory, but proteins do all the work!

trait

a a

From gene to protein nucleus

DNA

cytoplasm

transcription

mRNA

a a

translation

ribosome

a a

a a a a a a

a a a a

protein

a a

a a

a a

trait

Genetic Code

5’

Identifying Polypeptide Sequence

GACGACGGAUGCGCAAUGCGUCUCUAUGAGACGUAGCUCAC

• Locate start codon (1st AUG from 5’ end)

• Identify Codons

(non overlapping units of three codons including and following start codon) • Stop at stop codon

(remember stop codon doesn’t encode amino acid) • Nucleotides before start codon – 5’UTR – untranslated region • Nucleotides after stop codon 3’UTR • [MetArgAsnAlaSerLeu]

The Genetic Code •Use the code by reading from the center to the outside •Example: AUG codes for Methionine

Name the Amino Acids • • • • •

GGG? UCA? CAU? GCA? AAA?

Central Dogma of Molecular Biology

Transcription from DNA nucleic acid language to RNA nucleic acid language

RNA  ribose sugar

 N-bases  uracil instead of thymine U:A C:G

 single stranded

 lots of RNAs  mRNA, tRNA, rRNA, siRNA…

DNA

transcription

RNA

Transcription  Making mRNA  transcribed DNA strand = template strand  untranscribed DNA strand = coding strand  same sequence as RNA

 synthesis of complementary RNA strand  transcription bubble

 enzyme  RNA polymerase 5 DNA

C G

3

build RNA 53

A G T A T C T A

rewinding

mRNA 5

coding strand G C

A G C

A

T

C G T

T

A

3 G C A U C G U C G T A G C A

T A

T

RNA polymerase

C

A G C T G

A T

A T

3 5

unwinding

template strand

Animation of Transcription • http://vcell.ndsu.nodak.edu/animations/trans cription/movie-flash.htm

RNA polymerases  3 RNA polymerase enzymes  RNA polymerase 1  only transcribes rRNA genes  makes ribosomes  RNA polymerase 2  transcribes genes into mRNA  RNA polymerase 3  Makes tRNA  each has a specific promoter sequence it recognizes

Which gene is read?  Promoter region  binding site before beginning of gene  TATA box binding site  binding site for RNA polymerase

& transcription factors (helpers)  Enhancer region  binding site far

upstream of gene  turns transcription

on HIGH  Gives RNA Polymerase a chance to “warm up”

Transcription Factors  Initiation complex  transcription factors bind to promoter region  suite of proteins which bind to DNA  hormones?  turn on or off transcription  trigger the binding of RNA polymerase to DNA

Matching bases of DNA & RNA  Match RNA bases to DNA bases on one of

G

the DNA strands

G

U C

A

A G

C

A U G

U

A

C

G

A

U

A

C

5'

RNA A C C polymerase G

A

U

3'

T G G T A C A G C T A G T C A T C G T A C C G T

U C

Transcription: the process  1.Initiation~ transcription

factors mediate the binding of RNA polymerase to an initiation sequence (TATA box)  2.Elongation~ RNA polymerase continues unwinding DNA and adding nucleotides to the 3’ end (makes the mRNA strand)  3.Termination~ RNA polymerase reaches terminator sequence

Eukaryotic genes have junk!  Eukaryotic genes are not continuous  exons = the real gene  expressed / coding DNA  introns = the junk  inbetween sequence

introns come out!

intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence

mRNA splicing  Post-transcriptional processing  eukaryotic mRNA needs work after transcription  primary transcript = pre-mRNA  mRNA splicing  edit out introns  make mature mRNA transcript

intron = noncoding (inbetween) sequence ~10,000 base eukaryotic DNA exon = coding (expressed) sequence primary mRNA transcript

mature mRNA transcript

pre-mRNA

~1,000 base spliced mRNA

RNA Processing in Eukaryotes Pre-mRNA (hnRNA)

5’

3’

Modification of 5’ and 3’ ends 5’CAP Exon1

Intron1 Exon2

Intron2

Exon3

Intron3 Exon4

Spicing of exons

Poly A tail

1977 | 1993

Discovery of exons/introns

Richard Roberts CSHL

Philip Sharp MIT

beta-thalassemia

adenovirus common cold

Splicing must be accurate  No room for mistakes!  a single base added or lost throws off the reading frame (mutation)

AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG|CGG|UCC|GAU|AAG|GGC|CAU Met|Arg|Ser|Asp|Lys|Gly|His

AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU AUG|CGG|GUC|CGA|UAA|GGG|CCA|U Met|Arg|Val|Arg|STOP|

RNA splicing enzymes  snRNPs  small nuclear RNA  proteins

exon

 Spliceosome

5'

snRNPs

snRNA intron

exon 3'

 several snRNPs  recognize splice site

sequence  cut & paste gene

No, not smurfs!

“snurps”

spliceosome 5'

3' lariat

5'

exon mature mRNA 5'

3'

exon 3'

excised intron

Alternative splicing  Alternative mRNAs produced from same gene  Introns for one gene may be exons for another  different segments treated as exons

Starting to get hard to define a gene!

More post-transcriptional processing  Need to protect mRNA on its trip from nucleus to cytoplasm  enzymes in cytoplasm attack mRNA  protect the ends of the mRNA  add 5 GTP cap  add poly-A tail  longer tail, mRNA lasts longer: produces more protein

Translation from mRNA language to amino acid language

Players in Translation

mRNA – Code Ribosome – synthesizes protein tRNA – adaptor molecule, brings AA to ribosomes Amino acids Aminoacyl tRNA synthetases - attach amino acids to tRNAs

tRNA

Transfer RNA structure  “Clover leaf” structure  anticodon on “clover leaf” end  amino acid attached on 3 end

Loading tRNA  Aminoacyl tRNA synthetase  enzyme which bonds amino acid to tRNA  bond requires energy  ATP  AMP  bond is unstable  so it can release amino acid at ribosome easily

Trp

activating enzyme

C=O OH OH

Trp

C=O O

Trp

H 2O

tRNATrp anticodon tryptophan attached to tRNATrp

O

AC C UGG

mRNA tRNATrp binds to UGG

Ribosomes  Facilitate coupling of

tRNA anticodon to mRNA codon  organelle or enzyme?

 Structure  ribosomal RNA (rRNA) & proteins  2 subunits  large  small E P A

Ribosomes  A site (aminoacyl-tRNA site)  holds tRNA carrying next amino acid to be added to chain

 P site (peptidyl-tRNA site)  holds tRNA carrying growing polypeptide chain

 E site (exit site)  empty tRNA

leaves ribosome from exit site

Met

U A C A U G

5'

E

P

A

3'

Ribosomes

How does mRNA code for proteins? DNA

TACGCACATTTACGTACGCGG

4 ATCG

mRNA 4 AUCG

AUGCGUGUAAAUGCAUGCGCC

protein

? Met Arg Val Asn Ala Cys Ala

20

How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)?

mRNA codes for proteins in triplets

DNA

TACGCACATTTACGTACGCGG codon

mRNA

AUGCGUGUAAAUGCAUGCGC

? protein

Met Arg Val Asn Ala Cys Ala

Cracking the code

1960 | 1968

Nirenberg & Khorana

 Crick  determined 3-letter (triplet) codon system

WHYDIDTHEREDBATEATTHEFATRAT WHYDIDTHEREDBATEATTHEFATRA 

Nirenberg (47) & Khorana (17) determined mRNA–amino acid match  added fabricated mRNA to test tube of ribosomes, tRNA & amino acids 

 

created artificial UUUUU… mRNA found that UUU coded for phenylalanine

Marshall Nirenberg

1960 | 1968

Har Khorana

The code  Code for ALL life!  strongest support for a common origin for all life

 Code is redundant  several codons for each amino acid  3rd base “wobble” Why is the wobble good? 

Start codon  



AUG methionine

Stop codons 

UGA, UAA, UAG

How are the codons matched to amino acids? DNA mRNA

3

5

5

3

TACGCACATTTACGTACGCGG

AUGCGUGUAAAUGCAUGCGC

3

tRNA

amino acid

codon

5

UAC

GCA anti-codon CAU Met Arg

Val

Building a polypeptide  Initiation  brings together mRNA, ribosome subunits,

initiator tRNA

 Elongation  adding amino acids based on codon sequence  Translocation – Ribosome ratchets over on codon. The tRNA that was in the A site is moved to the P site. The uncharged tRNA in the P site exits the ribosome through the E site.

 Termination  end codon  When ribosome reaches the stop codon a release

factor binds to the A site and triggers the release of the polypeptide. The ribosome releases the tRNA and the mRNA.

3 2 1 Val

Leu Met

Met

Met Leu

Met Leu

Ala

Leu

release factor

Ser Trp

tRNA

UAC 5' C UG A A U mRNA A U G 3' E P A

5'

UA C G A C A U G C U GA A U

5' 3'

U A C GA C A U G C UG AA U

3'

5'

U AC G A C AA U A U G C UG

3'

A CC U GG UA A

3'

Fig. 17-18-4

Amino end of polypeptide

E

3

mRNA Ribosome ready for next aminoacyl tRNA

P A site site

5

GTP

GDP

E

E P A

P A

GDP GTP

E P A

The Functional and Evolutionary Importance of Introns • Some genes can encode more than one kind of polypeptide, depending on which segments are treated as exons during RNA splicing • Such variations are called alternative RNA splicing • Because of alternative splicing, the number of different proteins an organism can produce is much greater than its number of genes

Copyright © 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings

Fig. 17-12

Gene

DNA Exon 1

Intron

Exon 2

Intron

Exon 3

Transcription

RNA processing Translation

Domain 3

Domain 2 Domain 1 Polypeptide

Polysomes – teamed ribosomes translating together

• Polypeptide synthesis always begins in the cytosol (cytoplasm) • Synthesis finishes in the cytosol unless the polypeptide signals the ribosome to attach to the ER • Polypeptides destined for the ER or for secretion are marked by a signal peptide • A signal-recognition particle (SRP) binds to the signal peptide • The SRP brings the signal peptide and its ribosome to the ER

Copyright © 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings

Proteins targeted to ER

RNA polymerase DNA

Can you tell the story?

amino acids exon

pre-mRNA

intron 5' GTP cap

mature mRNA large ribosomal subunit

5' small ribosomal subunit

tRNA

poly-A tail

aminoacyl tRNA synthetase 3' polypeptide

tRNA E P A

ribosome

END Protein Synthesis

Prokaryote vs. Eukaryote genes  Prokaryotes

 Eukaryotes

 DNA in cytoplasm

 DNA in nucleus

 circular chromosome

 linear chromosomes

 naked DNA

 DNA wound on histone

 no introns

proteins  introns vs. exons

introns come out! intron = noncoding (inbetween) sequence

eukaryotic DNA exon = coding (expressed) sequence

Translation in Prokaryotes  Transcription & translation are simultaneous in bacteria  DNA is in

cytoplasm  no mRNA editing  ribosomes read mRNA as it is being transcribed

Translation: prokaryotes vs. eukaryotes  Differences between prokaryotes & eukaryotes  time & physical separation between processes  takes eukaryote ~1 hour from DNA to protein  no RNA processing

Mutations  Point mutations  single base change  base-pair substitution  silent mutation  no amino acid change  redundancy in code  missense  change amino acid  nonsense  change to stop codon

When do mutations affect the next generation?

Point mutation leads to Sickle cell anemia

What kind of mutation?

Missense!

Sickle cell anemia  Primarily in African races/descendants  recessive inheritance pattern  strikes 1 out of 400 African Americans

hydrophilic amino acid

hydrophobic amino acid

Mutations  Frameshift  shift in the reading frame  changes everything “downstream”  insertions  adding base(s)  deletions  losing base(s)

Where would this mutation cause the most change: beginning or end of gene?

Cystic fibrosis  Primarily European races/descendants  strikes 1 in 2500 births  1 in 25 whites is a carrier (Aa)

 normal allele codes for a membrane protein

that transports Cl- across cell membrane  defective or absent channels limit transport of Cl- (& H2O) across cell

membrane  thicker & stickier mucus coats around cells  mucus build-up in the pancreas, lungs, digestive tract & causes bacterial infections

 without treatment children die before 5;

with treatment can live past their late 20s

Deletion leads to Cystic fibrosis

delta F508

loss of one amino acid

What’s the value of mutations?

2007-2008