MOLECULAR, CELLULAR, AND DEVELOPMENTAL BIOLOGY Decorin-induced proliferation of avian myoblasts involves the myostatin/Smad signaling pathway Q. J. Zeng,*1 L. N. Wang,*1 G. Shu,* S. B. Wang,* X. T. Zhu,* P. Gao,* Q. Y. Xi,* Y. L. Zhang,* Z. Q. Zhang,† and Q. Y. Jiang*2 *College of Animal Science, ALLTECH-SCAU Animal Nutrition Control Research Alliance, South China Agricultural University, Guangzhou, Guangdong, 510642, P. R. China; and †Key Laboratory of Carcinogenesis and Translational Research (Ministry of Education), Department of Cell Biology, Peking University Cancer Hospital & Institute, Beijing 100142, P. R. China ABSTRACT Decorin, a small leucine-rich proteoglycan as a component of the extracellular matrix, plays an important role in the skeletal muscle development. It has been reported that decorin promoted proliferation and differentiation of muscle cells by restraining myostatin activity in rodents. However, the effects and mechanisms of decorin on avian myoblast proliferation are not understood clearly. Thus, in our research, decorin overexpressing and knocking-down quail myoblast-7 (QM7) myoblasts were established to explore the effects of decorin on avian myoblast proliferation by flow cytometry. The results showed that overexpres-

sion of decorin enhanced the proliferation of QM7 myoblasts, which was accompanied by the upregulation of follistatin and primary muscle regulatory factors (i.e., myogenic factor 5, myogenic factor 1, myogenin), and downregulation of myostatin expression, as well as the decreased phosphorylation level of SMAD family member 3 (Smad3). In line with expectations, decorin RNAi displayed an opposite effect on the proliferation and gene expression pattern of QM7 cells. In conclusion, our in vitro studies suggested the decorin-mediated myostatin/Smad signaling pathway might be involved in the regulation of avian myoblast proliferation.

Key words: QM7 myoblast, decorin, myostatin, cell proliferation, Smad3 2014 Poultry Science 93:138–146 http://dx.doi.org/10.3382/ps.2013-03300

INTRODUCTION

pressed in skeletal muscle during embryonic (chicken), fetal (chicken), and postnatal stages (turkey; Nishimura et al., 1997; Velleman et al., 1999; Velleman and McFarland, 1999; Zagris et al., 2011). Previous studies revealed that gene transfer of decorin in vivo promotes mice skeletal muscle regeneration and accelerates muscle healing after injury (Li et al., 2007). Furthermore, decorin could promote the proliferation of C2C12 myoblasts (Kishioka and Thomas, 2008) due to the interaction between decorin and the TGF-β superfamily (Hildebrand et al., 1994; Csordás et al., 2000; Schonherr et al., 2005), and similar results were also found in chicken satellite cell (Li et al., 2008b). However, the effects and mechanisms of decorin on avian myoblast proliferation have not been understood clearly. Myostatin is a member of the TGF-β superfamily and a negative regulator of skeletal muscle mass (McPherron et al., 1997). A lack of myostatin in mice caused a dramatic and widespread increase in skeletal muscle mass (Szabó et al., 1998; Lin et al., 2002). Similar to TGF-β1 signaling pathway, myostatin signaling requires the phosphorylation of Smad2/3 and any inhibition at this step would interrupt myostatin signaling (Massagué et al., 2005; Forbes et al., 2006; Li et al., 2008a). Research on mammalian myoblasts proved

The growth and development of skeletal muscle is a major concern for animal performance. Generally, muscle mass is positively correlated with the number of muscle fibers, which was mainly determined by the proliferation of myoblasts in the embryo (Miller et al., 1993). Previous research has demonstrated that the extracellular matrix (ECM) could interact with growth factors such as connective tissue growth factor (Vial et al., 2011), fibroblast growth factor (Rapraeger et al., 1991), hepatocyte growth factor (Allen et al., 1995), and transforming growth factor-β (TGF-β; Yamaguchi et al., 1990), which were involved in the regulation of skeletal muscle cell proliferation. Decorin, which is an important component of ECM, contains a central core protein and a chondroitin/dermatan sulfate chain and belongs to the small leucinerich proteoglycan gene family (Krusius and Ruoslahti, 1986). It has been reported that decorin is highly ex©2014 Poultry Science Association Inc. Received May 9, 2013. Accepted october 12, 2013. 1 These authors contributed equally to this work. 2 Corresponding author: [email protected]

138

DECORIN ENHANCES AVIAN MYOBLAST GROWTH

that the effects of decorin on the growth of C2C12 cells were mainly mediated by suppressing myostatin activity, along with the decreased Smad2 phosphate level (Kishioka and Thomas, 2008). However, it remains unknown whether decorin could regulate the myostatin/ Smad signaling pathway in avian myoblasts. Therefore, a myogenic cell line quail myoblast 7 (QM7), derived from quail fibrosarcoma cell line QT6 (Antin and Ordahl, 1991), was used in this study to generate the decorin overexpressing and knocking-down QM7 myoblasts. The cell proliferation and the expressing level of follistatin, myogenic regulatory factors (myogenic factor 5, Myf-5; myogenic factor 1, MyoD; myogenin), and myostatin, as well as the downstream SMAD family member 3 (Smad3) signaling pathway, were detected to reveal the effects and the underlined mechanisms of decorin on avian myoblast proliferation.

MATERIALS AND METHODS Plasmid Construct The decorin open reading frame corresponding to 136 to 1,209 bp of the chicken entry (NM_001030747.1) was amplified by reverse-transcription PCR with normal chicken gastrocnemius muscle total RNA as a template. Polymerase chain reaction was performed as follows: 94°C for 4 min; 35 cycles of 94°C for 20 s, 58°C for 40 s, and 72°C for 1 min; and 72°C for 10 min. The sequence of the forward primer was 5′-GGATTAAAAGGTTCTGCCTGGAGTT-3′, and that of the reverse primer was 5′-TGAAATACAACCAAACCC-3′. The PCR product was cloned into the PCR2.1 vector (Invitrogen, Carlsbad, CA) according to the manufacturer’s protocol. Decorin construct was then ligated into pcDNA3.1(-) vector (Invitrogen) to enable cell transfection and selection of stable integrants. The pcDNA3.1(-) empty vector was used as a control. Chemically synthesized pGPU6/GFP/Neo vectors containing short hairpin RNAi (sh-Decorin: 5′-GcagacaccaacattactatTCAAGAGatagtaatgttggtgtctgcTT-3′) against decorin mRNA (5′-GCAGACACCAACATTACTA-3′) sequence and pGPU6/GFP/Neo vectors containing negative control shRNA (sh-NC: 5′-GttctccgaacgtgtcacgtCAAGAGATTa cgtgacacgttcggagaaTT-3′) were purchased from Shanghai Genepharma Co. Ltd. (Shanghai, China).

Cell Culture The myogenic cell line QM7 was cultured with M199 medium supplemented with 10% fetal bovine serum (Gibco, Invitrogen, Carlsbad, CA), 0.5% chick embryo extract, which was prepared according to the procedure of Weinstein and Jones (1956), 10% tryptose phosphate (Sigma-Aldrich, St. Louis, MO), and 100 U/mL of penicillin-streptomycin at 37°C and 5% CO2 in a standard cell culture incubator (Shellab, Cornelius, OR). The QM7 cells were a gift from Z. Q. Zhang [Key Laboratory of Carcinogenesis and Translational Research

139

(Ministry of Education), Department of Cell Biology, Peking University Cancer Hospital and Institute].

Stable Transfection For pcDNA3.1(-)-Decorin and shRNA transfection, 1 × 104 cells per cm2 were plated in four 6-well plates and transfected respectively with 2 µg of the pcDNA3.1(-) -Decorin plasmid construct, 2 µg of the pcDNA3.1(-) empty vectors, 4 µg of pGPU6/GFP/Neo-sh-Decorin vectors, and 4 µg of pGPU6/GFP/Neo-sh-NC vectors by GenEscort TMII (Wisegen, Nanjing, China) according to the manufacturer’s instructions. After 48 h of incubation, cells underwent 2 wk of selection with 800 µg/mL G418 (Sigma-Aldrich). After maintenance for 2 wk in selection media, 4 types of single colonies were expanded and maintained respectively in growth medium with 400 µg/mL of G418.

Flow Cytometry The cells were cultured in a 6-well plate with density of 1 × 104 cells per cm2 and collected after 48 and 72 h, respectively, as previously described (Cheung et al., 2013) with minor changes. Briefly, cells were detached with a trypsin-EDTA (0.25% trypsin and 0.02% EDTA) solution in PBS at 37°C for 3 min and collected by centrifugation for 5 min at 200 × g, washed in icecold PBS and centrifuged. Cells were then resuspended in 300 µL of PBS + 0.1% FBS, and fixed in 0.7 mL of ice-cold 70% ethanol, then incubated for 1 h at 4°C. After that, the fixed cells were carefully centrifuged at 200 × g and 4°C for 10 min, washed twice with 1 mL of PBS, incubated with 50 µL of 5 g/mL DNase-free, RNaseA at 37°C for 30 min, and stained with 5 mg/mL of propidium iodide (keyGEN bioteck, Nanjing, China) for 30 min in the dark. Samples were analyzed for DNA content by flow cytometer (FACS Calibur, BD Biosciences, Franklin Lakes, NJ). The ModFit LT software (Verity Software House, Topsham, ME) was used to model the cell cycle data (n = 3).

Total RNA Extraction and Reverse Transcription Total RNA was extracted from the cultured cells after 24 h using Trizol reagent (Invitrogen, Carlsbad, CA) in accordance with the manufacturer’s protocol. The RNA quality was assessed by agarose gel electrophoresis (1%). The RNA was quantified by a biophotometer (Eppendorf, Hamburg, Germany). The isolated RNA has an optical density 260/optical density 280 (OD260/ OD280) ratio of 1.8 to 2.0 when diluted into RNase-free water. Reverse transcription was performed using 1 µg of total RNA and Moloney leukemia virus reverse transcriptase (MMLV, Promega, Madison, WI) according to the manufacturer’s instructions. The reverse transcription conditions for the cDNA amplification were

140

Zeng et al.

65°C for 5 min, 37°C for 30 min, and 70°C for 15 min. Synthesis of the cDNA first strand was performed with oligo-dT primer.

Quantitative Real-Time PCR A real-time PCR assay was performed using the SYBR Green Real-time PCR Kit (Toyobo Co. Ltd., Osaka, Japan) with Stratagene Mx3005P multiplex quantitative PCR system (Agilent Technologies, Santa Clara, CA) as described by the manufacturer. The PCR reaction volume was 20 μL containing 1 μL of diluted cDNA, 10 μM of each primer, and 10 μL of SYBR Green Real-time PCR Master Mix (Toyobo Co. Ltd., Osaka, Japan). Primers were designed specifically for each gene using Primer 5.0 software (Table 1). The 2−ΔΔCt method was used to analyze the quantitative real-time (qRT) PCR data (Livak and Schmittgen, 2001). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was selected as a reference gene. No marked difference of GAPDH mRNA abundance was detected between groups. Moreover, for generating gene-specific standard curves, each gene’s cDNA product was serially diluted from 10−1 to 10−8 and was used as the PCR template for amplification efficiency detection. The primers were designed and optimized to achieve a similar efficiency for the target and reference gene, the amplification efficiency of both target genes and reference gene is close to 1 (95–99%). The amplification efficiency of all primers is in line with the requirements of 2−ΔΔCt method.

Western Blot Analysis After cultured for 24 h, the transfected cells were homogenized using radio-immunoprecipitation assay lysis buffer (100 mM Na4P2O4, 50 mM Tris-HCl, pH7.5, 150 mM NaCl, 1 mM EDTA, 1 mM phenylmethanesulfonyl fluoride, 0.5% Triton X-100) containing protease and phosphatase inhibitors (Invitrogen, Carlsbad, CA). Ho-

mogenates were centrifuged at 14,000 × g and 4°C for 15 min, and the protein concentration in the supernatants was determined using a BCA Protein Assay Reagent Kit (Pierce, Rockford, IL). Prestained molecular weight markers (Invitrogen, Carlsbad, CA) were used to determine the molecular weight of proteins. The 100 µg of protein per sample was mixed with an equal volume of gel loading buffer. The samples were separated by electrophoresis at 80 V for 20 min and 120 V for 100 min using Tris-glycine running buffer (0.025 mol/L Tris base, 0.192 mol/L glycine, and 0.1% SDS, pH 8.3). The separated proteins were then transferred to PVDF membrane. Membranes were blocked with Tris-buffered saline (20 mM Tris-HCl and 500 mM NaCl, pH 7.5; TBS) containing 5% nonfat milk and 0.1% Tween-20 at room temperature for 2 h. After being washed 6 times with TBS containing 0.05% Tween-20 (TBST), the membrane was incubated with primary antibodies overnight at 4°C with gentle agitation, then washed 3 times in TBST for 5 min each. The membrane was then incubated in the secondary anti-mouse horseradish peroxidase or anti-rabbit horseradish peroxidase (Bioss, Beijing, China) at a concentration of 1:1,000 for 1 h at room temperature. The primary antibodies were the chicken anti-decorin (CB-1, Developmental Studies Hybridoma Bank at the University of Iowa, Iowa City; 1:500 in TBST), anti-MyoD (BD Pharmingen, San Diego, CA; 1:1,000 in TBST), anti-myogenin (Santa Cruz Bio, Santa Cruz, CA; 1:500 in TBST), anti-Smad3 (Millipore, Billerica, MA; 1:1,000 in TBST), anti-phospho-Smad3 (Cell Signaling Technologies, Danvers, MA; 1:1,000 in TBST), and mouse anti-β-actin (Bioss, Beijing, China; 1:1,000 in TBST). All of the primary antibodies were diluted according to the manufacturer’s instructions. Peroxidase activity was determined by Super Signal West Pico Chemiluminescence Western blotting detection reagents (Thermo Scientific Pierce Protein Research Products, Rockford, IL), and the positive bands were detected by Fluorchem System

Table 1. Primer sequences for quantitative real-time PCR Gene1

Primer sequence

Decorin

5′ 5′ 5′ 5′ 5′ 5′ 5′ 5′ 5′ 5′ 5′ 5′ 5′ 5′ 5′ 5′

Myf-5 MyoD Myogenin Follistatin Myostatin Smad3 GAPDH 1Myf-5: 2Tm:

AGTACCTAGTGGGTTGGGTGAAC 3′ (forward) GCCAAGAGGGCAAAAGTCGT 3′ (reverse) GAGGAGGAGGCTGAAGAAAGTGAA 3′ (forward) TGTCCCGGCAGGTGATAGTAGTT 3′ (reverse) ACAGTGGAGCCCAGATTC 3′ (forward) GCACTTGGTAGATTGGATTG 3′ (reverse) GGAGAAGCGGAGGCTGAAGA 3′ (forward) CAGGCGCTCGATGTACTGGAT 3′ (reverse) AAGAACAGCCCGAACTTGAA 3′ (forward) TTCCCTCGTAGGCTAATCCA 3′ (reverse) TTGGATGGGACTGGATTA 3′ (forward) TGGGATTTGCTTGGTGTA 3′ (reverse) AGAACATCATCCC AGCGTCC 3′ (forward) CGGCAGGTCAGGTCA ACA AC 3′ (reverse) AGAACATCATCCC AGCGTCC 3′ (forward) CGGCAGGTCAGGTCA ACA AC 3′ (reverse)

GenBank accession number

Tm2 (°C)

Product size (bp)

NM_001030747.1

58

100

NM_001030363.1

59

177

NM_204214

59

93

NM_204184

60

130

NM_205200

58

90

NM_00100146.1

60

120

NM_204475.1

56

197

NM_204305

60

133

myogenic factor 5; MyoD: myogenic factor 1; GAPDH: glyceraldehyde-3-phosphate dehydrogenase. annealing temperature.

DECORIN ENHANCES AVIAN MYOBLAST GROWTH

141

Figure 1. Overexpression and knocking-down of decorin in QM7 myoblasts. Decorin mRNA expression in decorin overexpressing cells and decorin knocking-down cells (A) was detected by quantitative real-time PCR (n = 6); protein level of decorin in decorin overexpressing cells and knocking-down cells (B and C) were measured by Western blot (n = 3). All results are representative of 3 separate experiments. The values are means ± SEM. The bars represent the SEM. Differences were significant at *P < 0.05 and **P < 0.01.

(ProteinSimple, Santa Clara, CA). The density of each band (n = 3) was measured using Image J software (Bethesda, MD).

Statistical Analysis All cell culture experiments were independently repeated at least 3 times. The data are represented as means ± SEM. A Student’s t-test was used to determine any significant differences between 2 groups by the SPSS 17.0 statistical software (*P < 0.05; **P < 0.01; SPSS Inc., Chicago, IL).

RESULTS Generation of QM7 Myoblasts with Decorin Overexpressing and Knocking Down The pcDNA3.1(-)-decorin transfected QM7 cells had an approximately 10-fold increase (P < 0.01) in the decorin mRNA expression compared with the control

(Figure 1A). Conversely, the pGPU6-shDecorin transfected QM7 cells had a significantly lower (P < 0.05) expression level of decorin mRNA than the negative control (Figure 1A). The protein level of decorin, which was measured by Western blot analysis, showed the expression pattern was in concordance with that of decorin mRNA (Figure 1B and C).

Effects of Decorin Overexpressing and Knocking Down on the Proliferation of QM7 Myoblasts The FACS analysis confirmed that decorin overexpressing caused a dramatic increase (P < 0.05) in the percentage of cells in the S phase, accompanied by a significant decrease (P < 0.05) in the percentage of cells in G0/G1-phase (Figure 2A). In contrast, knockdown of decorin led to a significant decrease (P < 0.05) in the percentage of cells in the S phase (Figure 2D), accompanied by an increase (P < 0.05) in the percentage of cells in G2/M-phase (Figure 2F).

142

Zeng et al.

Figure 2. The effects of decorin on the cell cycle of QM7 myoblasts. Statistical analysis of the percentage of cell number in G0/G1, S, and G2/M phase at the 2 time points: (A, C, E), decorin overexpressing cells compared with control cells; (B, D, F), decorin knocking-down compared with control cells. All results are representative of 3 separate experiments. The values are means ± SEM (n = 3). Differences were significant at *P < 0.05.

Effect of Decorin on Expression of Myogenic Regulatory Factors The mRNA expression of Myf-5 and myogenin were significantly upregulated (P < 0.05) in decorin overex-

pressing cells (Figure 3A); western blot analysis demonstrated the protein expression of MyoD and myogenin in decorin overexpressing cells was significantly higher (P < 0.05) than that in the control (Figure 3B and C). On the contrary, there was a decrease (P < 0.05) in the

DECORIN ENHANCES AVIAN MYOBLAST GROWTH

143

mRNA expression of myogenin (Figure 3A) and protein expression of Myod and myogenin (Figure 3B and C) when decorin was knocked down, whereas no effect was observed on the Myf-5 mRNA level (Figure 3A).

Effect of Decorin on Myostatin Expression and Smad3 Signaling Pathway Decorin overexpressing cells exhibited an increased (P < 0.05) mRNA expression of follistatin that is known to antagonize the function of myostatin (Figure 4A). On the contrary, there was a decrease (P < 0.05) in the mRNA expression of follistatin accompanied by an increased (P < 0.05) mRNA expression of myostatin when decorin was knocked down (Figure 4B). Although there was no change in the mRNA and protein expression of Smad3, the phosphorylation level of Smad3 was decreased (P < 0.05) in decorin overexpressing cells (Figure 4C and E), but increased (P < 0.05) in decorin knocking-down cells (Figure 4C and D).

DISCUSSION Decorin, as a component of ECM, was shown to be required to maintain committed skeletal muscle cell population in vivo (Olguin and Brandan, 2002). Meanwhile, the expression of decorin was markedly increased at the regenerative stage of X chromosome-linked muscular dystrophy mice compared with early stages (Abe et al., 2009). Moreover, in vitro study also demonstrated that stable transfection and overexpression of decorin enhanced the proliferation of C2C12 cells, as well as chicken satellite cells (Kishioka and Thomas, 2008). The results of Cell Counting Kit-8 assay (data not shown) and FACS analysis (Figure 2) in our study were consistent with most previous reports, which confirmed that decorin was an important positive regulatory factor in the regulation of avian skeletal muscle (QM7) myoblast proliferation. Myostatin is one of the most important inhibitor of myoblast proliferation (Thomas et al., 2000). It has been reported that decorin could directly bind to myostatin molecules to block myostatin-mediated inhibition of proliferation of C2C12 myoblasts (Miura et al., 2006). Some reports also indicated that follistatin could antagonize myostatin by direct protein interaction, which prevents myostatin from executing its inhibitory effect on muscle development (Lee and McPherron, 2001; Amthor et al., 2004). Our study showed that decorin could downregulate the mRNA expression of myostatin and upregulate the mRNA expression of follistatin. These results suggested that, in addition to direct binding to myostatin, decorin-regulated transcription of follistatin might also participate in decorin-induced avian myoblast proliferation. The effects of myostatin require both phosphorylation of Smad2 and Smad3, which block muscle differentiation during muscle atrophy (Trendelenburg et al.,

Figure 3. Effects of decorin on the expression of myogenic genes in QM7 myoblasts. Relative levels of Myf-5, MyoD, and myogenin in decorin overexpressing cells and decorin knocking-down cells (A) were measured by quantitative real-time PCR (n = 6). The overexpression and knocking-down of decorin (C) influenced the protein level of myogenic factors (MyoD, myogenin), as shown by Western blot results (n = 3).The band quantitative data were provided (B). All results are representative of 3 separate experiments. Bars are the means ± SEM. Differences were significant at *P < 0.05 and **P < 0.01.

2009). It has been shown that Smad3 is the key mediator of myostatin inhibition of myogenesis (Zhu et al., 2004) and the phosphorylation level of Smad3 was effective to reflect the bioactivity of myostatin in skeletal muscle cells (Li et al., 2008c). Kishioka and Thomas (2008) found that myostatin induced the Smad2 phosphorylation in C2C12 cells was less in the overexpression of decorin. To better understand the effects of decorin on myostatin activity, we further detected the phosphorylation of Smad3 by Western blot. The results showed that phosphor-Smad3 was significantly reduced in decorin overexpressing cells; the reverse is true in decorin knocking-down cells. Therefore, it is reasonable to propose that the Smad signaling pathway may be involved in decorin-induced regulation of avian myoblasts proliferation.

144

Zeng et al.

Figure 4. Effects of decorin on the myostatin signaling pathway. Relative levels of myostatin, follistatin, Smad3 in decorin overexpressing cells (A), and decorin knocking-down cells (B) were measured by quantitative real-time PCR (n = 6). The overexpression and knocking-down of decorin influenced myostatin signal transduction pathway, as shown (C) by Western blot results (n = 3). (D, E): Relative p-Smad3 levels were determined by scanning densitometry of the blots and normalized to total Smad3 levels. All results are representative of 3 separate experiments. Bars are the means ± SEM. Differences were significant at *P < 0.05 and **P < 0.01.

DECORIN ENHANCES AVIAN MYOBLAST GROWTH

The muscle regulatory factors (MRF) are essential transcriptional regulatory proteins in regulating myoblast proliferation. Joulia et al. (2003) reported that myostatin overexpression reduced MyoD and myogenin protein levels during proliferation and differentiation in C2C12 myoblasts. In our study, decorin enhanced the proliferation of QM7 myoblasts accompanied by upregulated expression of MRF (i.e., Myf-5, MyoD, myogenin), which might be attributed to the decrease of phospho-Smad3. It has been demonstrated that the MRF were the targets of Smad signaling (Martin et al., 1992). Myostatin activates Smad2 and Smad3 through carboxy-terminal phosphorylation, and then they will bind with Smad4 to form hetero-oligomers. This Smad complex subsequently interacts with the basic helixloop-helix region of all MRF to decrease their DNA transcriptional activity (Martin et al., 1992; Liu et al., 2001). Interestingly, decorin may also regulate the growth of avian myoblasts by several mechanisms. Li et al. (2008b) reported that decorin regulated the effect of TGF-β1 on cell proliferation and differentiation of chicken satellites cell by regulating cellular responsiveness to TGF-β1. Thus, TGF-β1 can be considered as another candidate target for decorin in QM7 cells. Furthermore, Cabello-Verrugio and Brandan (2007) reported that an endocytosis receptor protein, low-density lipoprotein receptor-related protein-1, participates in the regulation of TGF-β1 response through PI3K pathway, which was dependent on the presence of decorin. Additionally, decorin was reported to promote myoblast proliferation mediated by an endoplasmic reticulum stress-related pathway in duck myoblasts (Sun et al., 2013). The lowdensity lipoprotein receptor-related protein-1-mediated PI3K pathway and endoplasmic reticulum stress-related pathway may be involved in decorin-dependent inhibition of Smad3 phosphorylation. Therefore, further investigation is needed to interpret the precise mechanisms involved in decorin-mediated signaling pathways in the proliferation of avian myoblasts. In summary, the overexpression of decorin in QM7 myoblasts significantly increased cell proliferation, simultaneously increased the expressing level of follistatin and myogenic regulatory factors (Myf-5, MyoD, myogenin), but downregulated the mRNA expressing level of myostatin, as well as the decreased phosphorylation level of Smad3, compared with the control cells. Consistent with this result, knocking-down decorin expression decreased cell proliferation, which suggests the decorin-mediated myostatin/Smad signaling pathway might be involved in the regulation of avian myoblast proliferation.

ACKNOWLEDGMENTS This work was supported by the National Natural Science Foundation for the Young Scholars of China (no. 31101780; Beijing), the National Basic Research Pro-

145

gram of China–the 973 Program (no. 2009CB941601; Beijing), and the Research Fund for the Doctoral Program of Higher Education (no. 20114404120001; Beijing). We specially thank Z. Q. Zhang [Key Laboratory of Carcinogenesis and Translational Research (Ministry of Education), Department of Cell Biology, Peking University Cancer Hospital and Institute] for kindly providing the QM-7 cell line and W. Zhao [Key Laboratory of Carcinogenesis and Translational Research (Ministry of Education), Department of Cell Biology, Peking University Cancer Hospital and Institute] for his help in cell culture.

REFERENCES Abe, S., D. Hirose, S. Kado, O. Iwanuma, H. Saka, N. Yanagisawa, and Y. Ide. 2009. Increased expression of decorin during the regeneration stage of mdx mouse. Anat. Sci. Int. 84:305–311. Allen, R. E., S. M. Sheehan, R. G. Taylor, T. L. Kendall, and G. M. Rice. 1995. Hepatocyte growth factor activates quiescent skeletal muscle satellite cells in vitro. J. Cell. Physiol. 165:307–312. Amthor, H., G. Nicholas, I. McKinnell, C. F. Kemp, M. Sharma, R. Kambadur, and K. Patel. 2004. Follistatin complexes myostatin and antagonises myostatin-mediated inhibition of myogenesis. Dev. Biol. 270:19–30. Antin, P. B., and C. P. Ordahl. 1991. Isolation and characterization of an avian myogenic cell line. Dev. Biol. 143:111–121. Cabello-Verrugio, C., and E. Brandan. 2007. A novel modulatory mechanism of transforming growth factor-beta signaling through decorin and LRP-1. J. Biol. Chem. 282:18842–18850. Cheung, V., S. Bouralexis, and M. T. Gillespie. 2013. PTHrP overexpression increases sensitivity of breast cancer cells to Apo2L/ TRAIL. PLoS ONE 8:e66343. Csordás, G., M. Santra, C. C. Reed, I. Eichstetter, D. J. McQuillan, D. Gross, M. A. Nugent, G. Hajnóczky, and R. V. Iozzo. 2000. Sustained down-regulation of the epidermal growth factor receptor by decorin a mechanism for controlling tumor growth in vivo. J. Biol. Chem. 275:32879–32887. Forbes, D., M. Jackman, A. Bishop, M. Thomas, R. Kambadur, and M. Sharma. 2006. Myostatin auto-regulates its expression by feedback loop through Smad7 dependent mechanism. J. Cell. Physiol. 206:264–272. Hildebrand, A., M. Romaris, L. Rasmussen, D. Heinegård, D. Twardzik, W. Border, and E. Ruoslahti. 1994. Interaction of the small interstitial proteoglycans biglycan, decorin and fibromodulin with transforming growth factor beta. Biochem. J. 302:527– 534. Joulia, D., H. Bernardi, V. Garandel, F. Rabenoelina, B. Vernus, and G. Cabello. 2003. Mechanisms involved in the inhibition of myoblast proliferation and differentiation by myostatin. Exp. Cell Res. 286:263–275. Kishioka, Y., and M. Thomas. 2008. Decorin enhances the proliferation and differentiation of myogenic cells through suppressing myostatin activity. J. Cell. Physiol. 215:856–867. Krusius, T., and E. Ruoslahti. 1986. Primary structure of an extracellular matrix proteoglycan core protein deduced from cloned cDNA. Proc. Natl. Acad. Sci. USA 83:7683–7687. Lee, S. J., and A. C. McPherron. 2001. Regulation of myostatin activity and muscle growth. Proc. Natl. Acad. Sci. USA 98:9306– 9311. Li, X., D. C. McFarland, and S. G. Velleman. 2008a. Effect of Smad3-mediated transforming growth factor-beta1 signaling on satellite cell proliferation and differentiation in chickens. Poult. Sci. 87:1823–1833. Li, X., D. C. McFarland, and S. G. Velleman. 2008b. Extracellular matrix proteoglycan decorin-mediated myogenic satellite cell responsiveness to transforming growth factor-beta1 during cell proliferation and differentiation Decorin and transforming

146

Zeng et al.

growth factor-beta1 in satellite cells. Domest. Anim. Endocrinol. 35:263–273. Li, Y., J. Li, J. Zhu, B. Sun, M. Branca, Y. Tang, W. Foster, X. Xiao, and J. Huard. 2007. Decorin gene transfer promotes muscle cell differentiation and muscle regeneration. Mol. Ther. 15:1616–1622. Li, Z. B., H. D. Kollias, and K. R. Wagner. 2008c. Myostatin directly regulates skeletal muscle fibrosis. J. Biol. Chem. 283:19371– 19378. Lin, J., H. B. Arnold, M. A. Della-Fera, M. J. Azain, D. L. Hartzell, and C. A. Baile. 2002. Myostatin knockout in mice increases myogenesis and decreases adipogenesis. Biochem. Biophys. Res. Commun. 291:701–706. Liu, D., B. L. Black, and R. Derynck. 2001. TGF-β inhibits muscle differentiation through functional repression of myogenic transcription factors by Smad3. Genes Dev. 15:2950–2966. Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2 (− Delta Delta C(T)) method. Methods 25:402–408. Martin, J. F., L. Li, and E. N. Olson. 1992. Repression of myogenin function by TGF-beta 1 is targeted at the basic helix-loop-helix motif and is independent of E2A products. J. Biol. Chem. 267:10956–10960. Massagué, J., J. Seoane, and D. Wotton. 2005. Smad transcription factors. Genes Dev. 19:2783–2810. McPherron, A. C., A. M. Lawler, and S. J. Lee. 1997. Regulation of skeletal muscle mass in mice by a new TGF-beta superfamily member. Nature 387:83–90. Miller, J. B., E. A. Everitt, T. H. Smith, N. E. Block, and J. A. Dominov. 1993. Cellular and molecular diversity in skeletal muscle development: News from in vitro and in vivo. Bioessays 15:191–196. Miura, T., Y. Kishioka, J. Wakamatsu, A. Hattori, A. Hennebry, C. J. Berry, M. Sharma, R. Kambadur, and T. Nishimura. 2006. Decorin binds myostatin and modulates its activity to muscle cells. Biochem. Biophys. Res. Commun. 340:675–680. Nishimura, T., K. Ojima, A. Hattori, and K. Takahashi. 1997. Developmental expression of extracellular matrix components in intramuscular connective tissue of bovine semitendinosus muscle. Histochem. Cell Biol. 107:215–221. Olguin, H., and E. Brandan. 2002. Decorin is required to maintain committed skeletal muscle cell population grouped allowing normal differentiation in vivo. Mol. Biol. Cell 13:341a. Rapraeger, A. C., A. Krufka, and B. B. Olwin. 1991. Requirement of heparan sulfate for bFGF-mediated fibroblast growth and myoblast differentiation. Science 252:1705–1708.

Schonherr, E., C. Sunderkotter, R. V. Iozzo, and L. Schaefer. 2005. Decorin, a novel player in the insulin-like growth factor system. J. Biol. Chem. 280:15767–15772. Sun, L., K. Lu, H. Liu, H. Wang, X. Li, C. Yang, L. Li, and J. Wang. 2013. The effects of endoplasmic reticulum stress response on duck decorin stimulate myotube hypertrophy in myoblasts. Mol. Cell. Biochem. 377:151–161. Szabó, G., G. Dallmann, G. Muller, L. Patthy, M. Soller, and L. Varga. 1998. A deletion in the myostatin gene causes the compact (Cmpt) hypermuscular mutation in mice. Mamm. Genome 9:671–672. Thomas, M., B. Langley, C. Berry, M. Sharma, S. Kirk, J. Bass, and R. Kambadur. 2000. Myostatin, a negative regulator of muscle growth, functions by inhibiting myoblast proliferation. J. Biol. Chem. 275:40235–40243. Trendelenburg, A. U., A. Meyer, D. Rohner, J. Boyle, S. Hatakeyama, and D. J. Glass. 2009. Myostatin reduces Akt/TORC1/ p70S6K signaling, inhibiting myoblast differentiation and myotube size. Am. J. Physiol. Cell Physiol. 296:C1258–C1270. Velleman, S. G., X. Liu, K. H. Eggen, and K. E. Nestor. 1999. Developmental regulation of proteoglycan synthesis and decorin expression during turkey embryonic skeletal muscle formation. Poult. Sci. 78:1619–1626. Velleman, S. G., and D. C. McFarland. 1999. Myotube morphology, and expression and distribution of collagen type I during normal and low score normal avian satellite cell myogenesis. Dev. Growth Differ. 41:153–161. Vial, C., J. Gutiérrez, C. Santander, D. Cabrera, and E. Brandan. 2011. Decorin interacts with connective tissue growth factor (CTGF)/CCN2 by LRR12 inhibiting its biological activity. J. Biol. Chem. 286:24242–24252. Weinstein, P. P., and M. F. Jones. 1956. The in vitro cultivation of Nippostrongylus muris to the adult stage. J. Parasitol. 42:215– 236. Yamaguchi, Y., D. M. Mann, and E. Ruoslahti. 1990. Negative regulation of transforming growth factor-β by the proteoglycan decorin. Nature 346:281–284. Zagris, N., K. Gilipathi, N. Soulintzi, and K. Konstantopoulos. 2011. Decorin developmental expression and function in the early avian embryo. Int. J. Dev. Biol. 55:633–639. Zhu, X., S. Topouzis, L. Liang, and R. L. Stotish. 2004. Myostatin signaling through Smad2, Smad3 and Smad4 is regulated by the inhibitory Smad7 by a negative feedback mechanism. Cytokine 26:262–272.