1042

Relationships among changes of serum leptin concentration, leptin mRNA expression in white adipose tissue (WAT), and WAT fat-cell size in female Japanese black bears (Ursus thibetanus japonicus) S. Nakamura, T. Okano, H. Shibata, M. Saito, T. Komatsu, M. Asano, M. Sugiyama, T. Tsubota, and M. Suzuki

Abstract: As a first step to study the relationship between fat accumulation and reproductive success in Japanese black bears (Ursus thibetanus japonicus Schlegel, 1857) with the focus on leptin, we determined leptin cDNA sequences in the bears. Next, we studied the possibility of white adipose tissue (WAT) as a leptin secretion source by observing the changes of leptin mRNA expression in WAT by semiquantitative real-time reverse transcript – polymerase chain reaction, the index of WAT fat-cell size, and serum leptin concentration in pregnant bears. Then, based on our results, we discussed roles of leptin in those bears. The amino acid sequences of leptin from the bears were highly identical to that of other carnivores. The expression of leptin mRNA in WAT was detected from September to January, with a tendency to increase in late November and January; the relationship between changes in the index of WAT fat-cell size and those in serum leptin concentration was high (r = 0.55, P < 0.01), with an increase in both in mid-November. These results suggested that leptin was mainly secreted from WAT in bears and that serum leptin concentrations might reflect their nutritional condition. Moreover, leptin might serve as an indicator of their fat mass, which would affect their survival during hibernation and their reproductive success. Re´sume´ : Comme premie`re e´tape dans l’e´tude de la relation entre l’accumulation de graisses, et en particulier de la leptine, et le succe`s reproductif chez les ours a` collier japonais (Ursus thibetanus japonicus Schlegel, 1857), nous avons de´termine´ les se´quences de l’ADNc de la leptine chez les ours. Ensuite, nous avons e´tudie´ la possibilite´ que le tissu adipeux blanc (WAT) soit une source de se´cre´tion de la leptine en observant les changements de l’expression de l’ARNm de la leptine dans le WAT par l’analyse de l’amplification en chaıˆne par polyme´rase avec transcription inverse semi-quantitative en temps re´el, l’indice de taille des cellules adipeuses et les concentrations de leptine chez des ourses enceintes. Puis, nous discutons des roˆles de la leptine chez ces ourses d’apre`s nos re´sultats. Les se´quences d’acides amine´s de la leptine des ourses sont tre`s semblables a` celles des autres carnivores. L’expression de l’ARNm de la leptine dans le WAT est de´celable de septembre a` janvier avec une tendance a` la hausse en fin novembre et en janvier; la relation entre les changements de l’indice de taille des cellules adipeuses du WAT et ceux de la concentration se´rique de leptine est forte (r = 0,55, P < 0,01) avec une amplification des deux changements a` la mi-novembre. Ces re´sultats indiquent que la leptine est se´cre´te´e principalement par le WAT chez les ourses et que les concentrations se´riques de leptine peuvent peut-eˆtre refle´ter leurs conditions alimentaires. De plus, la leptine peut servir d’indicateur de leur masse adipeuse, qui pourrait affecter leur survie durant l’hibernation et leur succe`s reproductif. [Traduit par la Re´daction]

Introduction To date, the full or partial length of the cDNA cloning of leptin has been reported in various species, including experimental, domestic, and wild animals. Moreover, since the

molecular structure of leptin was identified, abundant knowledge of leptin roles has been obtained. Leptin is a protein hormone encoded by the obese (ob) gene (Zhang et al. 1994) and produced primarily by adipose tissue. It is known that leptin provides a signal that informs the central nervous

Received 31 January 2008. Accepted 28 May 2008. Published on the NRC Research Press Web site at cjz.nrc.ca on 29 August 2008. S. Nakamura and T. Okano. United Graduate School of Veterinary Sciences, Gifu University, Gifu 501-1193, Japan. H. Shibata. Morinaga Institute of Biological Science, Inc. Kanazawa-ku, Yokohama 236-0003, Japan. M. Saito. Department of Nutrition, School of Nursing and Nutrition, Tenshi College, Sapporo 065-0013, Japan. T. Komatsu. The Institute of Japanese Black Bear in Ani, Kita-Akita 018-3392, Japan. M. Asano and M. Suzuki.1 Laboratory of Zoo and Wildlife Medicine, Faculty of Applied Biological Sciences, Gifu University, Gifu 501-1193, Japan. M. Sugiyama. Laboratory of Zoonotic Diseases, Faculty of Applied Biological Sciences, Gifu University, Gifu 501-1193, Japan. T. Tsubota. Laboratory of Wildlife Biology, Graduate School of Veterinary Medicine, Hokkaido University, Sapporo 060-0818, Japan. 1Corresponding

author (e-mail: [email protected]).

Can. J. Zool. 86: 1042–1049 (2008)

doi:10.1139/Z08-080

#

2008 NRC Canada

Nakamura et al.

system about the energy reserves of body adipocyte mass to regulate appetite and energy expenditure (Frederich et al. 1995; Friedman and Halaas 1998; Houseknecht et al. 1998). Thus, leptin is one of the key molecules for the regulation of food intake and whole body energy balance. In addition, by observing leptin concentrations of wildlife in a field study, their nutritional conditions could be readily assessed, because serum leptin concentrations generally correlate with the whole body fat mass or body mass index (Maffei et al. 1995; Considine et al. 1996; Sagawa et al. 2002; Shibata et al. 2003). Also, leptin has been implicated in the regulation of reproductive functions such as puberty (Cheung et al. 1997), oocyte maturation and early embryonic development (Kawamura et al. 2002; Craig et al. 2005; Cervero et al. 2004, 2006), and implantation (Malik et al. 2001; Ramos et al. 2005). The Japanese black bear (Ursus thibetanus japonicus Schlegel, 1857) inhabits the islands of Honshu and Shikoku in Japan. Their body mass and body fat mass vary seasonally (Hashimoto and Yasutaka 1999; Nakamura et al. 2008). It is known that the appetite of the American black bear (Ursus americanus Pallas, 1780) increases and that their body mass is at its highest in autumn in preparation for hibernation, since they eat nothing during the entire hibernation period (Young 1976). The energy that black bears need to survive during hibernation comes almost entirely from the body fat accumulated in autumn (Nelson et al. 1983). In addition, pregnant female bears produce cubs and start lactation during hibernation. The fat accumulation in autumn is important for the survival of female bears and their offspring. Thus, they must have a definite amount of fat accumulation in autumn as an energy source. Female Japanese black bears have another unique reproductive characteristic, i.e., their implantation occurs between late November and early December (Sato et al. 2000), even though their mating season is in early summer. This is called delayed implantation. Although it has been reported that one or more luteal factors or hormones are necessary to induce implantation (Foresman and Mead 1978; Murphy et al. 1983; Mead et al. 1988; Huang et al. 1993; Mead 1993), the actual mechanism remains unknown. It was suggested that hard-nut production and (or) fat store in autumn affects the breeding success of female bears (Rogers 1976; Eiler et al. 1989; Elowe and Dodge 1989; Samson and Huot 1995). In a recent study, Tsubota et al. (2004) observed the peak of serum leptin concentrations in late November in pseudopregnant Japanese black bears and suggested that this leptin peak might be associated with reproductive function in Japanese black bears. This study was undertaken to obtain basic and contributory knowledge for elucidating physiologically the relationship between fat store and reproductive success in Japanese black bears. As a first step in our study, we determined the cDNA sequence of leptin in Japanese black bears. Next, we studied the possibility of WAT as a leptin secretion source in the bears by observing the changes in leptin mRNA expression in WAT, the index of WAT fat-cell size, and the serum leptin concentration in pregnant bears. Then, based on our results, we discussed the possible roles that leptin might play during prehibernation.

1043

Materials and methods Bears Eight Japanese black bears were used in this study. Two wild male bears had to be killed as a nuisance control measure in Gifu Prefecture, Japan, in 2005. The other 6 bears (1 male and 5 females) were kept in Ani Mataginosato Bear Park, Akita Prefecture, Japan, from 2005 to 2006. During the active season, the captive bears were mainly provided daily with dried corn (approximately 1.5 kg/head) and water. The one male and five females were kept together with other males in an outdoor run from late May to late August (including the mating season). In late August, the female bears were isolated in an indoor run until December, when they began hibernation that lasted for about 4.5 months without food until the following April. When collecting samples, the bears were immobilized by the method previously reported (Asano et al. 2007; Nakamura et al. 2008), using a mixture of zolazepam HCL and tiletamine HCL (Zoletil1; Virbac, Carros, France) and medetomidine HCL (Domitor1; Meiji Seika Ltd., Tokyo, Japan). The five females were examined under anesthesia on 11 or 12 January 2006, using ultrasound sonography to determine pregnancy. WAT and serum collection To sequence the leptin cDNA of the Japanese black bears, WAT were collected from June to August 2005. Omental and lumbar subcutaneous WAT were collected from two wild bears when the bears were autopsied. Lumbar subcutaneous WAT were collected from one captive bear by biopsy. The biopsy was performed appropriately under anesthesia by a skillful veterinarian doctor. Collected WAT were immediately plunged into liquid nitrogen and stored at –80 8C until examination. Samples of serum and WAT were taken from the five captive females about once a month from early September 2005 until January 2006. Under anesthesia, blood samples were collected from the jugular vein in vacuum tubes, centrifuged at 3000g for 15–20 min, and the separated serum was stored at –30 8C until they were assayed. Lumbar subcutaneous WAT was collected and stored by the method just described above. The biopsy did not cause any health problems for all six captive bears. Cloning of leptin cDNA Total RNA was extracted from WAT using ISOGEN and Ethachinmate (Nippon Gene, Tokyo, Japan). The yield of RNA was assessed by measuring absorbance at a wavelength of 260 nm (OD260). We first obtained a short cDNA fragment (413 bp) by reverse transcription (RT) – polymerase chain reaction (PCR). After confirming the nucleotide amplification of that fragment, we employed rapid amplification of cDNA end (RACE) to determine the sequence of the full-length leptin mRNA. Primers used in this study are indicated in Table 1. To obtain a short cDNA fragment, 5.0 mg of total RNA extracted from WAT was reverse-transcribed with an oligo(dT)20 primer by the SuperScriptIII First-Strand Synthesis System for RT–PCR (Invitrogen, Milan, Italy). PCR amplification was performed for 40 cycles at 94 8C for 30 s, 58 8C for 30 s, and 72 8C for 1 min with AmpliTaq Gold #

2008 NRC Canada

1044

Can. J. Zool. Vol. 86, 2008 Table 1. Oligonucleotide sequences used as primers for reverse transcript (RT) – polymerase chain reaction (PCR) and rapid amplification of cDNA (RACE) methods in the study of Japanese black bears (Ursus thibetanus japonicus). Primer name BOF BOR

Primer type Forward Reverse

Sequence (5’-3’) TTCCTGTGGCTTTGGCCCTAT GCCACCACCTCTGTGGAGTA

3ART 3MA 3G1F 3G2F

RT Reverse Forward Forward

CCATCCTAATACGACTCACTATAGGGC-T18 CCATCCTAATACGACTCACTATAGGGC CCTGGAGAGCTTCGAGAGCCT GCGGTGTTCTAGAAGCCTCGC

5G3RT 5MAFF 5MABF 5G4R 5G5R

RT Forward Forward Reverse Reverse

GCCACCACCTCCGTGGAGTA GCCCTATAGTGAGTCGTATT AGTGAGTCGTATTAGGATGG GCGAGGCTTCTAGAACACCGC GAGGTTCTCCAGGTCATTAGA

polymerase (Applied Biosystems, Foster City, California, USA) using primers (BOF and BOR) that were designed based on the reported sequence of the coding regions of canine leptin cDNA (GeneBank accession no. AB020986; Iwase et al. 2000). To generate a 3’-partial cDNA end, 1.6 mg of total RNA was reverse-transcribed using an oligo(dT)18-adaptor primer (3ART). First amplification was performed with TaKaRa Ex-Taq (TaKaRa Bio Inc., Shiga, Japan) using 3G1F and 3MA primers. The PCR conditions were 94 8C for 30 s, 70 8C for 30 s, and 72 8C for 2.5 min (35 cycles). Heminested PCR was then carried out using 3G2F and 3MA primers under conditions of 94 8C for 30 s, 63 8C for 30 s, and 72 8C for 2.5 min (35 cycles). To generate a 5’-partial cDNA end, 5.0 mg of total RNA was reverse-transcribed using 5G3RT primer. Then, an adaptor (5’-GCCCTATAGTGAGTCGTATTAGGATGG-3’) was added to the 3’ end of this synthesized cDNA using T4 RNA Ligase (TaKaRa Bio Inc.). PCR was performed at 94 8C for 30 s, 69 8C for 30 s, and 72 8C for 1 min (35 cycles) with TaKaRa Ex-Taq using 5MAFF and 5G4R primers. Nested PCR was then carried out using 5MAFB and 5G5R primers under conditions of 94 8C for 30 s, 60 8C for 30 s, and 72 8C for 1 min (35 cycles). Sequencing was carried out with a BigDye Terminator version 3.1 kit and an ABI Prism 3100 genetic analyzer (Applied Biosystems Inc., Foster City, California, USA). Semiquantification of leptin mRNA expression by realtime RT–PCR Total RNA from WAT was extracted using the same method described above. Prior to the RT reaction, any contaminating residual genomic DNA was eliminated by digestion with deoxynuclease (DNase) I amplification grade (Invitrogen). Real-time RT–PCR was used to semiquantify the leptin transcripts and was carried out in duplicates for each sample with a QuantiTect Probe RT–PCR kit (Qiagen, Valencia, California, USA), QuantiTect Custom Assay (Qiagen), and ABI PRISM 7100 (Applied Biosystems). The primers and

probes were designed for leptin and 18S ribosomal RNA (18S-RNA) of Japanese black bears based on the sequence GenBank accession nos. AB255164 and AB370873, respectively. The leptin mRNA expression was normalized to the 18S-RNA housekeeping gene product. Index of WAT fat-cell size WAT was cut into 15 mm sections using a cryostat at –20 8C. These sections were brought to room temperature, and fixed with 95% alcohol or cold acetone for 10 min, and then stained with hematoxylin and eosin (HE). The fat-cell size is considered to reflect the density of cell numbers in a given amount of WAT. Thus, we used the value as the index of WAT fat-cell sizes that were calculated by the following method. The cell numbers in a certain given area were counted by ImageJ version 1.38x (Rasband 1997–2005). The index of WAT fat-cell size was divided by the number of cells in a given area (namely, 0.03 mm2 / cell number  100). Enzyme-linked immunosorbent assay of leptin Serum leptin concentrations were measured by a sandwich enzyme-linked immunosorbent assay (ELISA) developed for canine leptin measurements (canine-leptin-specific ELISA kit; Morinaga, Tokyo, Japan) according to the manufacturer’s instruction. The validation of this assay for sera of Japanese black bears was demonstrated by Tsubota et al. (2002). The detection limit of the assay was 0.35 ng/mL. The intra- and inter-assay coefficient variations were 7.7% and 8.2%, respectively. Statistical analysis Data are presented as means ± standard deviations (SD). Differences among time periods were evaluated by the method of randomized complete block design (Sokal and Rohlf 1995) using JMP (SAS Institute Inc. Japan, Tokyo, Japan) with repeated measures over time. The individuals (a factor) were random, while the time period (other factor) was a fixed effect. Individual differences were further analyzed using Tukey’s HSD test. Differences of P < 0.05 #

2008 NRC Canada

Nakamura et al.

1045

Fig. 1. Comparing amino acid sequences of leptins from Japanese black bears (Ursus thibetanus japonicus) with leptins from other species. Amino acids are described by their single-letter abbreviation. The numbers 1, 61, and 121 indicate the number of amino acids. Asterisks indicate identical amino acids in all species. The signal peptides of 21 amino acids are shaded.

were regarded as statistically significant. Imputation replaces a missing value on the index of WAT fat-cell size (Little and Rubin 2002). The correlation between the index of WAT fat-cell size and serum leptin concentration was calculated by Pearson’s correlation coefficient test.

Results cDNA cloning and sequence analysis The complete nucleotide sequence of the cloned leptin cDNA of Japanese black bears consisted of 2863 bp including a 501 bp open reading frame (ORF), and the sequence was submitted to the DDBJ, EMBL, and GenBank nucleotide sequence databases with accession no. AB255164. The deduced amino acid sequences are shown in Fig. 1. The ORF region of leptin cDNA of Japanese black bears encoded a predicted 167 amino acid polypeptide with a putative signal peptide of 21 amino acids. At 95.2%, the 167 amino acid sequences of the leptin of Japanese black bears was closest to being identical to a dog, with those of other species ranging between 71.9% and 92.5% (Table 2). The homological identity of the Japanese black bear to other wild animals ranged between 80.0% and 100.0%, from a comparison of part of the sequences in the ORF region. Changes of leptin mRNA in WAT, index of WAT fat-cell size, and serum leptin concentration of captive bears Fetal positive images (not shown) were found by ultra-

sound sonography in the five female bears. Consequently, these bears are hereinafter called pregnant bears. Expression of leptin mRNA in WAT by semiquantitative real-time RT– PCR was indicated in Fig. 2. That expression held steady at a certain level from early September to mid-November. Although the expression levels tended to increase in late November and January, there was no significant difference among individual months. The index of WAT fat-cell size (Fig. 3) increased gradually from October, and mean values increased markedly in mid-November (P < 0.05), but subsequently decreased. Serum leptin concentrations (Fig. 4) increased moderately from early September to October, with mean values being significantly different among early September and middle (239 ± 87 ng/mL) and late (212 ± 41 ng/mL) November (P < 0.05), after which the concentration decreased. The correlation between the index of WAT fat-cell size and the serum leptin concentration was 0.55 (P < 0.01).

Discussion The cDNA cloned from the WAT of Japanese black bears contained a 501 bp ORF encoding protein of 21 amino acids of N-terminal signal peptide and a mature peptide of 146 amino acids. The amino acid sequence of leptin from Japanese black bears was highly identical to that of other species (Table 2) (Iwase et al. 2000; Doyon et al. 2001; Sasaki et al. 2001). In particular, the comparison of Japanese black bears to carnivores reached over 92.5% homology. The leptin #

2008 NRC Canada

1046

Can. J. Zool. Vol. 86, 2008 Table 2. Nucleotide and deduced amino acid sequence identities of mature leptin from Japanese black bears (Ursus thibetanus japonicus) compared with those from other species. Identity (%) Species Japanese black bear Dog Cat Pig Cow Human Rat Mouse Chicken

Nucleotide 100.0 94.0 92.4 91.4 88.8 86.6 82.4 82.2 77.6

Amino acids 100.0 95.2 92.5 89.7 89.7 79.5 78.1 77.4 71.9

Accession nos. in DDBJ, EMBL, or GenBank AB255164 AB020986 AB041360 U50365 U63540 U18915 D45862 U18812 AF012727

Partial mRNA (268–359 bp) of open reading flame (ORF) American black bear 100.0 100.0 AY142109 Striped skunk 96.6 100.0 AF296668 Raccoon 96.6 98.9 AF296669 Raccoon dog 94.7 97.5 AY098741 Little brown bat 87.1 80.0 AF296670 Fig. 2. Changes leptin mRNA expression in white adipose tissue (WAT) in five captive pregnant Japanese black bears (Ursus thibetanus japonicus) from 2005 to 2006. Vertical bars represent standard deviations (SD).

cDNA sequences of the Japanese black bear were determined in our study, so this could be applied as a more sensitive technique for assay of in vitro and in vivo experiments. In general, leptin is mainly secreted by adipose tissue. It is also known that leptin mRNA expression and protein secretion were positively associated with adipocyte size (Hamilton et al. 1995; Guo et al. 2004; Skurk et al. 2007) or WAT fat-cell diameter (Florant et al. 2004). The secretion of leptin was significantly elevated in very large adipocytes or fat-cell diameters compared with those that were small or medium-sized. In this study, expression of leptin mRNA in WAT was detected through the sampling term from September to January (Fig. 2) by semiquantitative real-time RT– PCR. This means that leptin is secreted at least in WAT of Japanese black bears. Leptin mRNA expression had a tendency to increase in late November when serum leptin con-

Fig. 3. Changes of the index of white adipose tissue (WAT) fat-cell size in five captive pregnant Japanese black bears (Ursus thibetanus japonicus) from 2005 to 2006. Vertical bars represent standard deviations (SD). Sample numbers were 4 from September to November and 5 in December. Different letters indicate significant differences (P < 0.05).

centrations rose significantly. The index of WAT fat-cell size notably increased in mid-November, and these changes correlated (r = 0.55, P < 0.01) with serum leptin concentration changes (Figs. 3, 4). Considering that their fat mass also peaked in November (Nakamura et al. 2008), these results indicated that WAT is one of the major tissues that secretes leptin protein and that the secreted leptin protein from WAT reflects the changes in the serum leptin concentrations of the bears. Since fattening for hibernation occurs in autumn, serum leptin levels or the sensitivity of target organs to leptin should decrease during this period because the initial increase in leptin secretion might lead to decrease in feeding. #

2008 NRC Canada

Nakamura et al. Fig. 4. Changes of serum leptin concentration in five captive pregnant Japanese black bears (Ursus thibetanus japonicus) from 2005 to 2006. Vertical bars represent standard deviations (SD). Different letters indicate significant differences (P < 0.05).

There are some reports about the relationship between changes in serum leptin concentration and body mass or body fat mass of some animals that accumulate fat mass in autumn for hibernation or torpor in winter (Ormseth et al. 1996; Hissa et al. 1998; Kronfeld-Schor et al. 2000; Concannon et al. 2001; Nieminen et al. 2001). The usual correlation between the increase in WAT mass and that in leptin concentration does not appear to hold during prehibernation of the little brown bat (Myotis lucifugus (LeConte, 1831)) (Kronfeld-Schor et al. 2000) and the raccoon dog (Nyctereutes procyonoides (Gray, 1834) ) (Nieminen et al. 2001). In the little brown bat, plasma leptin and leptin secretion from adipose tissue decreased, while body fat increased. It was suggested that leptin levels was inhibited to accumulate fat mass in little brown bat. In the raccoon dog, when the energy reserves were full, leptin levels fell to preserve body mass and to adapt to fasting following hibernation. In this study, there was a clear seasonal pattern in the serum leptin concentration of the pregnant bears that gradually increased from September and peaked in November (Fig. 4). The changes in their serum leptin concentration closely conformed to changes in their body fat mass (fat mass significantly increased in October and exhibited the highest levels in mid-November; Nakamura et al. 2008). This means food intake and fat accumulation lasted to the beginning of hibernation while maintaining a high level of serum leptin concentration, i.e., leptin secretion did not decrease during prehibernation and the high leptin level does not inhibit a bear’s appetite or accumulation of fat mass. Almost those same changes were observed in the European brown bear (Ursus arctos arctos L., 1758) (Hissa et al. 1998). It was anticipated that sustaining serum leptin levels during fat storage might play a significant role for bears as a hibernator, or that leptin in autumn might have a specific function for bears. Leptin is known to have provided a system that signals the amount of adipose energy stores to the brain (Considine et al. 1996), as well as a sensor that monitors the level of those stores (the size of the adipose tissue mass) (Jequier 2002). Since sufficient fat accumulation is important for bears to survive hibernation, which lasts for 5– 6 months with fasting, it is thought that leptin levels in

1047

Japanese black bears might serve as an indicator of the fat mass developed in the prehibernation period without inhibition of leptin secretion. It is anticipated that the appetite and body mass would be maintained during prehibernation (high level of leptin) by regulating the leptin receptor instead of leptin secretion in bears because leptin exerts its effects such as the regulation of appetite and energy expenditure via leptin receptor in the hypothalamus (Friedman and Halaas 1998) (Tartaglia et al. 1995; Friedman and Halaas 1998; Houseknecht et al. 1998). Considering these results, it was assumed that the monitoring of serum leptin concentrations could be a useful index for assessing the nutritional condition of the bears at least in autumn. In addition, accumulating fat mass in autumn is especially important for female bears because it influences the rates of implantation, fertility, and natality, thereby assuring reproductive success (Eiler et al. 1989; Elowe and Dodge 1989; Stringham 1990a, 1990b). Given that female bears can accumulate enough fat mass while monitoring their serum leptin level by the beginning of hibernation, a specific leptin peak, as Tsubota et al. (2004) showed previously, or some threshold level of leptin might act as a first selection signal for their reproductive success. The increase of leptin mRNA expression in January indicated that leptin was also secreted from WAT during hibernation. The leptin might act on the lipolytic effect of the autocrine or paracrine (Fruhbeck et al. 1997, 2001), causing the bears to consume their body fat as energy during hibernation (Nelson et al. 1983). Future studies on the relationship between serum leptin levels and reproductive success in bears are warranted. In summary, we determined the full length of leptin cDNA sequences of the Japanese black bear for the first time, and demonstrated that leptin is secreted mainly by WAT and that the secreted leptin protein reflects the changes in the serum leptin concentrations of the bears. It is suggested that leptin may well serve as an indicator of the fat mass of the bears, which affects their survival during hibernation and their reproductive success during the prehibernation period.

Acknowledgements The authors thank the staff at the Ani Mataginosato Bear Park, especially Akihiro Izumi, Manabu Suzuki, and Shigeki Kikuchi. This study was supported in part by a Grant-in-Aid for Scientific Research (The 21st Century Center-of-Excellence Program) from the Ministry of Education, Sports, Science, and Technology of Japan (E-1) and by The Inui Memorial Trust for Research on Animal Science. It was also partly included in ‘‘The study project on the Japanese black bears’ mass intrusion into human settlements’’ supported by the ‘‘Pollution Control Research Fund’’ from the Ministry of the Environment, Japan.

References Asano, M., Tsubota, T., Komatsu, T., Katayama, A., Okano, T., and Nakamura, S. 2007. Immobilization of Japanese black bears (Ursus thibetanus japonicus) with tiletamine hydrochloride and zolazepam hydrochloride. J. Vet. Med. Sci. 69: 433–435. doi:10.1292/jvms.69.433. PMID:17485936. Cervero, A., Horcajadas, J.A., Martı´n, J., Pellicer, A., and Simon, #

2008 NRC Canada

1048 C. 2004. The leptin system during human endometrial receptivity and preimplantation development. J. Clin. Endocrinol. Metab. 89: 2442–2451. doi:10.1210/jc.2003-032127. PMID: 15126576. Cervero, A., Dominguez, F., Horcajadas, J.A., Quinonero, A., Pellicer, A., and Simon, C. 2006. The role of the leptin in reproduction. Curr. Opin. Obstet. Gynecol. 18: 297–303. doi:10.1097/01. gco.0000193004.35287.89. PMID:16735830. Cheung, C., Thornton, J., Kuijper, J., Weigle, D., Clifton, D., and Steiner, R. 1997. Leptin is a metabolic gate for the onset of puberty in the female rat. Endocrinology, 138: 855–858. doi:10. 1210/en.138.2.855. Concannon, P., Levac, K., Rawson, R., Tennant, B., and Bensadoun, A. 2001. Seasonal changes in serum leptin, food intake, and body weight in photoentrained woodchucks. Am. J. Physiol. 281: R951–R959. Considine, R.V., Sinha, M.K., Heiman, M.L., Kriauciunas, A., Stephens, T.W., Nyce, M.R., Ohannesian, J.P., Marco, C.C., McKee, L.J., Bauer, T.L., and Caro, J.F. 1996. Serum immunoreactive-leptin concentrations in normal-weight and obese humans. N. Engl. J. Med. 334: 292–295. doi:10.1056/ NEJM199602013340503. PMID:8532024. Craig, J.A., Zhu, H., Dyce, P.W., Wen, L., and Li, J. 2005. Leptin enhances porcine preimplantation embryo development in vitro. Mol. Cell. Endocrinol. 229: 141–147. doi:10.1016/j.mce.2004. 08.008. PMID:15607538. Doyon, C., Drouin, G., Trudeau, V.L., and Moon, T.W. 2001. Molecular evolution of leptin. Gen. Comp. Endocrinol. 124: 188– 198. doi:10.1006/gcen.2001.7701. PMID:11703084. Eiler, J.H., Wathen, W.G., and Pelton, M.R. 1989. Reproduction in black bears in the southern Appalachian mountains. J. Wildl. Manage. 53: 353–360. doi:10.2307/3801137. Elowe, K.D., and Dodge, W.E. 1989. Factors affecting black bear reproductive success and cub survival. J. Wildl. Manage. 53: 962–968. doi:10.2307/3809596. Florant, G.L., Porst, H., Peiffer, A., Hudachek, S.F., Pittman, C., Summers, S.A., Rajala, M.W., and Scherer, P.E. 2004. Fat-cell mass, serum leptin and adiponectin changes during weight gain and loss in yellow-bellied marmots (Marmota flaviventris). J. Comp. Physiol. B, 174: 633–639. PMID:15517283. Foresman, K.R., and Mead, R.A. 1978. Luteal control of nidation in the ferret (Mustela putorius). Biol. Reprod. 18: 490–496. doi:10.1095/biolreprod18.3.490. PMID:667254. Frederich, R.C., Hamann, A., Anderson, S., Lollmann, B., Lowell, B.B., and Flier, J.S. 1995. Leptin levels reflect body lipid content in mice: evidence for diet-induced resistance to leptin action. Nat. Med. 1: 1311–1314. doi:10.1038/nm1295-1311. PMID:7489415. Friedman, J.M., and Halaas, J.L. 1998. Leptin and the regulation of body weight in mammals. Nature (London), 395: 763–770. doi:10.1038/27376. PMID:9796811. Fruhbeck, G., Aguado, M., and Martinez, J.A. 1997. In vitro lipolytic effect of leptin on mouse adipocytes: evidence for a possible autocrine/paracrine role of leptin. Biochem. Biophys. Res. Commun. 240: 590–594. doi:10.1006/bbrc.1997.7716. PMID:9398609. Fruhbeck, G., Gomez-Ambrosi, J., and Salvador, J. 2001. Leptininduced lipolysis opposes the tonic inhibition of endogenous adenosine in white adipocytes. FASEB J. 15: 333–340. doi:10. 1096/fj.00-0249com. PMID:11156949. Guo, K.Y., Halo, P., Leibel, R.L., and Zhang, Y. 2004. Effects of obesity on the relationship of leptin mRNA expression and adipocyte size in anatomically distinct fat depots in mice. Am. J. Physiol. 287: R112–R119.

Can. J. Zool. Vol. 86, 2008 Hamilton, B.S., Paglia, D., Kwan, A.Y., and Deitel, M. 1995. Increased obese mRNA expression in omental fat cells from massively obese humans. Nat. Med. 1: 953–956. doi:10.1038/ nm0995-953. PMID:7585224. Hashimoto, Y., and Yasutaka, A. 1999. Seasonal changes in body weight of female Asiatic black bears under captivity. Mam. Study, 24: 1–6. doi:10.3106/mammalstudy.24.1. Hissa, R., Hohtola, E., Saramaki, T.T., Laine, T., and Kallio, H. 1998. Seasonal changes in fatty acids and leptin contents in the plasma of the European brown bear (Ursus arctos arctos). Ann. Zool. Fenn. 35: 215–224. Houseknecht, K.L., Baile, C.A., Matteri, R.L., and Spurlock, M.E. 1998. The biology of leptin: a review. J. Anim. Sci. 76: 1405– 1420. PMID:9621947. Huang, J.L., Powell, M., and Mead, R.A. 1993. Luteal protein secretion during preimplantation in the ferret. Biol. Reprod. 48: 647–654. doi:10.1095/biolreprod48.3.647. PMID:8384008. Iwase, M., Kimura, K., Komagome, R., Sasaki, N., Ishioka, K., Honjoh, T., and Saito, M. 2000. Sandwich enzyme-linked immunosorbent assay of canine leptin. J. Vet. Med. Sci. 62: 207–209. doi:10.1292/jvms.62.207. PMID:10720194. Jequier, E. 2002. Leptin signaling, adiposity, and energy balance. Ann. N.Y. Acad. Sci. 967: 379–388. PMID:12079865. Kawamura, K., Sato, N., Fukuda, J., Kodama, H., Kumagai, J., Tanikawa, H., Nakamura, A., and Tanaka, T. 2002. Leptin promotes the development of mouse preimplantation embryos in vitro. Endocrinology, 143: 1922–1931. doi:10.1210/en.143.5. 1922. PMID:11956175. Kronfeld-Schor, N., Richardson, C., Silvia, B.A., Kunz, T.H., and Widmaier, E.P. 2000. Dissociation of leptin secretion and adiposity during prehibernatory fattening in little brown bats. Am. J. Physiol. 279: R1277–R1281. Little, R.J.A., and Rubin, D.B. 2002. Statistical analysis with missing data. 2nd. ed. Wiley & Sons, Inc., Hoboken, N.J. Maffei, M., Halaas, J., Ravussin, E., Pratley, R.E., Lee, G.H., Zhang, Y., Fei, H., Kim, S., Lallone, R., Ranganathan, S., Kern, P.A., and Friedman, J.M. 1995. Leptin levels in human and rodent: measurement of plasma leptin and ob RNA in obese and weight-reduced subjects. Nat. Med. 1: 1155–1161. doi:10.1038/ nm1195-1155. PMID:7584987. Malik, N.M., Carter, N.D., Murray, J.F., Scaramuzzi, R.J., Wilson, C.A., and Stock, M.J. 2001. Leptin requirement for conception, implantation, and gestation in the mouse. Endocrinology, 142: 5198–5202. doi:10.1210/en.142.12.5198. PMID:11713215. Mead, R.A. 1993. Embryonic diapause in vertebrates. J. Exp. Zool. 266: 629–641. doi:10.1002/jez.1402660611. PMID:8371102. Mead, R.A., Joseph, M.M., Neirinckx, S., and Berria, M. 1988. Partial characterization of a luteal factor that induces implantation in the ferret. Biol. Reprod. 38: 798–803. doi:10.1095/ biolreprod38.4.798. PMID:3401538. Murphy, B.D., Mead, R.A., and McKibbin, P.E. 1983. Luteal contribution to the termination of preimplantation delay in mink. Biol. Reprod. 28: 497–503. doi:10.1095/biolreprod28.2.497. PMID:6838952. Nakamura, S., Okano, T., Yoshida, Y., Matsumoto, A., Murase, Y., Kato, H., Komatsu, T., Asano, M., Suzuki, M., Sugiyama, M., and Tsubota, T. 2008. Use of bioelectrical impedance analysis to measure the fat mass of the Japanese black bear (Ursus thibetanus japonicus). Jpn. J. Zoo. Wildl. Med. 13: 15–20. Nelson, R.A., Folk, J.G.E., Pfeiffer, E.W., Craighead, J.J., and Steiger, D.L. 1983. Behavior, biochemistry, and hibernation in black, grizzly, and polar bears. In Bears — Their Biology and Management: Proceedings of the Fifth International Conference #

2008 NRC Canada

Nakamura et al. on Bear Research and Management, Madison, Wis., 10–13 February 1980. Edited by E.C. Meslow. International Association for Bear Research and Management, Washington, D.C. pp. 284–290. [Available from Terry D. White, Southern Appalachian Research Branch, The University of Tennessee, 274 Ellington Hall, Knoxville, TN 379996, USA; also refer to http:// bearbiology.com.] Nieminen, P., Asikainen, J., and Hyvarinen, H. 2001. Effects of seasonality and fasting on the plasma leptin and thyroxin levels of the raccoon dog (Nyctereutes procyonoides) and the blue fox (Alopex lagopus). J. Exp. Zool. 289: 109–118. doi:10. 1002 / 1097-010X(20010201)289:2 3.0.CO;2-I. PMID:11169498. Ormseth, O.A., Nicolson, M., Pelleymounter, M.A., and Boyer, B.B. 1996. Leptin inhibits prehibernation hyperphagia and reduces body weight in arctic ground squirrels. Am. J. Physiol. 271: R1775–R1779. PMID:8997382. Ramos, M.P., Rueda, B.R., Leavis, P.C., and Gonzalez, R.R. 2005. Leptin serves as an upstream activator of an obligatory signaling cascade in the embryo-implantation process. Endocrinology, 146: 694–701. doi:10.1210/en.2004-1186. PMID:15539553. Rasband, W.S. 1997–2005. ImageJ. Version 1.38x [computer program]. US National Institutes of Health, Bethesda, Md. Available from http://rsb.info.nih.gov/ij/ [accessed 29 June 2007]. Rogers, L. 1976. Effects of mast and berry crop failures on survival, growth, and reproductive success of black bears. Trans. N. Am. Wildl. Nat. Resour. Conf. 41: 431–438. Sagawa, M.M., Nakadomo, F., Honjoh, T., Ishioka, K., and Saito, M. 2002. Correlation between plasma leptin concentration and body fat content in dogs. Am. J. Vet. Res. 63: 7–10. doi:10. 2460/AJVR.2002.63.7. PMID:16206772. Samson, C., and Huot, J. 1995. Reproductive biology of female black bears in relation to body mass in early winter. J. Mammal. 76: 68–77. doi:10.2307/1382315. Sasaki, N., Shibata, H., Honjoh, T., Kimura, K., Saito, M., and Ohishi, I. 2001. cDNA cloning of feline leptin and its mRNA expression in adipose tissue. J. Vet. Med. Sci. 63: 1115–1120. doi:10.1292/jvms.63.1115. PMID:11714028. Sato, M., Tsubota, T., Yamamoto, K., Komatsu, T., Hashimoto, Y., Katayama, A., Hazumi, T., Kita, I., and Kudo, T. 2000. Serum progesterone and estradiol-17b concentrations in captive and free-ranging adult female Japanese black bears (Ursus thibetanus japonicus). J. Vet. Med. Sci. 62: 415–420. doi:10.1292/ jvms.62.415. PMID:10823729. Shibata, H., Sasaki, N., Honjoh, T., Ohishi, I., Takiguchi, M., Ishioka, K., Ahmed, M., Soliman, M., Kimura, K., and Saito, M. 2003. Feline leptin: immunogenic and biological activities of the recombinant protein, and its measurement by ELISA. J. Vet. Med. Sci. 65: 1207–1211. doi:10.1292/jvms.65.1207. PMID:14665750. Skurk, T., Alberti-Huber, C., Herder, C., and Hauner, H. 2007. Relationship between adipocyte size and adipokine expression and secretion. J. Clin. Endocrinol. Metab. 92: 1023–1033. doi:10. 1210/jc.2006-1055. PMID:17164304.

1049 Sokal, R.R., and Rohlf, F.J. 1995. Biometry. 3rd ed. W.H. Freeman and Company, New York. Stringham, S.F. 1990a. Black bear reproductive rate relative to body weight in hunted populations. In Bears — Their Biology and Management: Proceedings of the Eighth International Conference on Bear Research and Management, Victoria, B.C., 20– 25 February 1989. Edited by L.M. Darling and W.R. Archibald. International Association for Bear Research and Management, Washington, D.C. pp. 425–432. [Available from Terry D. White, Southern Appalachian Research Branch, The University of Tennessee, 274 Ellington Hall, Knoxville, TN 379996, USA; also refer to http://bearbiology.com.] Stringham, S.F. 1990b. Grizzly bear reproductive rate relative to body size. In Bears — Their Biology and Management: Proceedings of the Eighth International Conference on Bear Research and Management, Victoria, B.C., 20–25 February 1989. Edited by L.M. Darling and W.R. Archibald. International Association for Bear Research and Management, Washington, D.C. pp. 433–443. [Available from Terry D. White, Southern Appalachian Research Branch, The University of Tennessee, 274 Ellington Hall, Knoxville, TN 379996, USA; also refer to http:// bearbiology.com.] Tartaglia, L.A., Dembski, M., Weng, X., Deng, N., Culpepper, J., Devos, R., Richards, G.J., Campfield, L.A., Clark, F.T., Deeds, J., Muir, C., Sanker, S., Moriarty, A., Moore, K.J., Smutko, J.S., Mays, G.G., Wool, E.A., Monroe, C.A., and Tepper, R.I. 1995. Identification and expression cloning of a leptin receptor, OB-R. Cell, 83: 1263–1271. doi:10.1016/0092-8674(95)90151-5. PMID:8548812. Tsubota, T., Sato, M., Okano, T., Murase, T., Komatsu, T., Honjoh, T., and Saito, M. 2002. Annual changes in serum leptin concentrations of the mature female Japanese black bear (Ursus thibetanus japonicus). In Abstracts of 134th Annual Meeting of the Japanese Society of Veterinary Science, Gifu, Japan, 19–21 September 2002. Gifu University, Gifu, Japan. Abstr. No. 160. [In Japanese.] Tsubota, T., Sato, M., Okano, T., Murase, T., Komatsu, T., Honjoh, T., and Saito, M. 2004. Annual changes in serum leptin, estradiol-17b and progesterone concentrations in adult female Japanese black bears (Ursus thibetanus japonicus). In Bears — Their Biology and Management: Proceedings of the Fifteenth International Conference on Bear Research and Management, San Diego, Calif., 8–13 February 2004. Edited by L.M. Darling and W.R. Archibald. International Association for Bear Research and Management, Washington, D.C. p. 67. [Available from Terry D. White, Southern Appalachian Research Branch, The University of Tennessee, 274 Ellington Hall, Knoxville, TN 379996, USA; also refer to http://bearbiology.com.] Young, R.A. 1976. Fat, energy, and mammalian survival. Am. Zool. 16: 699–710. Zhang, Y., Proenca, R., Maffei, M., Barone, M., Leopold, L., and Friedman, J.M. 1994. Positional cloning of the mouse obese gene and its human homologue. Nature (London), 372: 425– 432. doi:10.1038/372425a0. PMID:7984236.

#

2008 NRC Canada