RFLP Electrophoresis (DNA Fingerprinting)

INTRODUCTION You are about to perform a procedure known as RFLP Electrophoresis (DNA Fingerprinting). The data obtained should allow you to determine if a crime scene sample of DNA that you will be provided with matches any one of five suspects. For this experiment it is necessary to review the structure of DNA molecules. DNA consists of a series of nitrogenous base molecules held together by weak hydrogen bonds. These base pairs are in turn bonded to a sugar-phosphate backbone. The four nitrogenous bases are adenine, thymine, guanine, and cytosine (A, T, G, and C). Remember the base-pairing rule is A - T and G - C. This illustration represents a very small section of DNA from three different individuals. In this representation of DNA the symbol system is as follows: (Backbone: S = five carbon deoxyribose sugar, P = phosphate group) (DNA Nucleotide Bases: A = adenine, C = cytosine, G = guanine, T = thymine). Analysis of the three DNA samples shown here might help us detect similarities and differences in the samples.

DNA Sample #1

DNA Sample #2

DNA Sample #3

Gel electrophoresis is advancement in biotechnology that allows biologists to separate and visualize DNA, RNA, proteins, and other polypeptides and nucleic acid sequences. It is required for DNA fingerprinting, DNA sequencing, DNA cloning, and gene mapping. It involves ‘pulling’ components of a mixed sample through a mesh network of gel. An electrical field generates the pull. The mesh network provides an obstacle course or series of pores through which the molecules in the sample must travel. Small molecules move quickly – large molecules move slowly. Most every molecular biology research laboratory routinely uses gel electrophoresis for the preparation and analysis of DNA. 1

Scientists and clinicians regularly use scanning instruments to glean vital information from samples separated by electrophoresis. This information is critical in a range of applications: pinpointing cancer types, identifying diseased tissue, characterizing genetic disorders, assessing coronary risk, and even reading and compiling nucleotide sequences to map the genomes of many life-forms including our own. There are two basic types of materials used to make gels: agarose and polyacrylamide. Polyacrylamide is a material similar to that found in soft contact lenses and is primarily used to separate proteins. Agarose is a natural polysaccharide derived from seaweed. It serves to help the alga resist desiccation when exposed to air for extended periods of time. Agarose gels have a very large pore size and are used primarily to separate very large molecules such as DNA. When agarose is heated to about 90°C it melts, but solidifies again when cooled below 45°C. During the solidification process, agarose forms a matrix of microscopic pores. The size of these pores depends on the concentration of agarose used. The lower the concentration, the larger the pore size of the gel and the larger the nucleic acid fragments that can be separated. During electrophoresis, DNA molecules wind through the pores in the gel, similar to trying to pass a thread through a stack of gauze pads. As the pore size decreases, by increasing agarose concentration, it is harder for longer DNA fragments to orient properly. Smaller DNA fragments can thread their way through the pores allowing them to migrate faster. An agarose gel is created by suspending dry agarose in a buffer solution, boiling until the solution becomes clear, and then pouring it into a casting tray and allowing it to cool. The result is a flexible gelatin-like slab. During electrophoresis, the gel is submersed in a chamber containing a buffer solution and a positive and negative electrode. The DNA to be analyzed is forced through the pores of the gel by the electrical current. Under an electrical field, DNA will move to the positive electrode (red) and away from the negative electrode (black). Several factors influence how fast the DNA moves, including; the strength of the electrical field, the concentration of agarose in the gel and, most importantly, the size of the DNA molecules. DNA itself is not visible within an agarose gel. The DNA will be visualized by the use of a dye that binds to DNA and fluoresces under ultraviolet light. Band patterns of separated DNA on a gel resemble a bar code. Each band is a unique signature representing a recorded and identifiable DNA fragment. Pre-Lab Exercises (Understanding the Theory) If you are to use electrophoresis to determine if the linear base pair sequence in the DNA samples is identical, you must first fragment or cut the DNA into pieces that can be separated. However the pieces must be cut in very specific ways based on their sequence of bases such that they produce unique and reproducible banding patterns. RFLP (Restriction Fragment Length Polymorphism) was one of the first techniques used for DNA analysis in forensic science and several other fields. RFLP uses variation in a sequence of DNA that is detectable through gel electrophoresis. In RFLP, the different lengths of DNA fragments are analyzed. These fragments are from the digestion of a sample of DNA with a restriction endonuclease enzyme. The enzyme chops DNA in a certain way at restriction endonuclease recognition sites. Whether or not particular 2

recognition sites are present will provide different lengths of DNA fragments which are then separated using electrophoresis. In 1968, Dr. Werner Arber at the University of Basel, Switzerland and Dr. Hamilton Smith at the Johns Hopkins University, Baltimore, discovered a group of enzymes in bacteria, which when added to any DNA will result in the breakage [hydrolysis] of the sugar-phosphate bond between certain specific nucleotide bases [recognition sites]. This causes the double strand of DNA to break along the recognition site and the DNA molecule becomes fractured into two pieces. You can think of these cutting enzymes or restriction endonucleases as molecular scissors. Two common restriction enzymes are EcoRI and PstI which will be provided to you in this lab procedure. To better understand how EcoRI and PstI may help you in performing your DNA fingerprinting experiment, first you must understand and visualize the nature of the cutting effect of a restriction endonuclease on DNA: The line through the base pairs in this diagram represents the sites where bonds will break if the restriction endonuclease EcoRI recognizes the site GAATTC. The following analysis questions refer to how a piece of DNA would be affected if a restriction endonuclease were to cut the DNA molecule in the manner shown below:

1. How many pieces of DNA would result from this cut? ___________

2. Write the base sequence of the DNA fragments on both the left and right side of the “cut”. Left:

Right:

3

3. DNA fragment size can be expressed as the number of base pairs in the fragment. Indicate the size of the fragments. a) The smaller fragment is ___________ base pairs (bp). b) What is the length of the longer fragment? ______________

4. Consider the two samples of DNA shown below - single strands are shown for simplicity: Sample #1 CAGTGATCTCGAATTCGCTAGTAACGTT

Sample #2 TCATGAATTCCTGGAATCAGCAAATGCA

If both samples are treated with the restriction enzyme EcoRI [recognition sequence GAATTC] then indicate the number of fragments and the size of each fragment from each sample of DNA. Sample # 1

Sample # 2

# of fragments:________

# of fragments:_________

List fragment size in order: largest ——> smallest Sample # 1

Sample # 2

4

(Simulating DNA Fingerprinting) 1) A certain restriction enzyme seeks out the base sequence AATT and cuts between the 2 A's. Whenever you have the four bases AATT in each sequence, use a pencil to lightly shade in the sequence. This is known as a restriction site. 2) Now, for each restriction site, draw a thick line between the 2 A's. This indicates where the restriction enzyme will cut the DNA. 3) Indicate the total number of restriction sites you have in each DNA sequence, the total number of fragments created by the restriction enzyme and determine the size of each fragment. Map each fragment on the simulated gel in the appropriate lane.

Crime Scene (CS) Sample CAGTGAATTCGGGAATTCTAGTAACGTT # OF RESTRICTION SITES _____

# OF FRAGMENTS _____

SIZE OF EACH FRAGMENT _____

_____

_____

Suspect # 1 (S1) CAGTGAACTCGAATTCGCTAGTAACGTT # OF RESTRICTION SITES _____

# OF FRAGMENTS _____

SIZE OF EACH FRAGMENT _____

_____

_____

Suspect # 2 (S2) CAGAATTTTCGAAGGCGCTAGTAATTTT # OF RESTRICTION SITES _____

# OF FRAGMENTS _____

SIZE OF EACH FRAGMENT _____

_____

_____

Suspect # 3 (S3) CAGTGAATTCGAGTTCAAATTTAACGTT # OF RESTRICTION SITES _____

# OF FRAGMENTS _____

SIZE OF EACH FRAGMENT _____ 5

_____

_____

Suspect # 4 (S4) CAGTGAATTCGGGAATTCTAGTAACGTT # OF RESTRICTION SITES _____

# OF FRAGMENTS _____

SIZE OF EACH FRAGMENT _____

_____

_____

Suspect # 5 (S5) CAGTGAGAATTAGTTCGCTAGTAACTTT # OF RESTRICTION SITES _____

# OF FRAGMENTS _____

SIZE OF EACH FRAGMENT _____

Simulated Gel

WELLS (lanes)

_____

_____

Negative (-) Electrode CS

S1

S2

S3

S4

S5

Positive (+) Electrode 6

§

Is the perpetrator of the crime scene present? How do you know?

§

Ignoring the crime scene lane, are there any two banding patterns that are exactly alike?

§

Why was the Simulated Gel numbered in descending order starting from the top?

§

What do the positive (+) and negative (-) signs represent and why was the positive placed at the bottom of the gel?

Upon careful observation, it is apparent that the only difference between the DNA of different individuals is the linear sequence of their base pairs. In the lab, your team will be given six DNA samples. Recall that your task is to determine if any of them came from the same individual or if they came from different individuals. Now that you have an understanding of the theory, you are ready to proceed to the first phase of the DNA fingerprinting procedure – performing a restriction digest of your DNA samples. Materials gel electrophoresis chamber power supply casting tray 8-well comb TAE buffer for chamber powder agarose 1X SYBR Safe Stain (prepared in 1X TAE) graduated cylinder weigh boat Erlenmeyer flask EcoRI/PstI enzyme mix pipette tips, 2–200 µl micropipette, 2–20 µl microwave laminated gel images metric ruler

colored micro test tubes permanent marker waste container foam micro test tube holder laboratory tape crime scene DNA (CS) suspect 1 DNA (S1) suspect 2 DNA (S2) suspect 3 DNA (S3) suspect 4 DNA (S4) suspect 5 DNA (S5) 37°C water bath or incubator microcentrifuge

7

Procedure (Measuring Volume with a Micropipette) You will measure volumes using a different type of tool – a micropipette that allows you to ‘suck up’ very small volumes with precision. To use the micropipette, you must first enter the desired volume. For this exercise enter 10 µl (10 millionths of a liter). Before picking up the micropipette, open the cap or lid of the tube from which you are taking fluid. Hold the micropipette in one hand, almost vertical; hold the tube in your other hand. Depress the plunger of the micropipette to the first stop, and hold it in this position, then dip the tip into the solution to be pipetted. Draw fluid into the tip by slowly releasing the plunger. Open the cap or lid of the tube into which you are ejecting the fluid. Hold the micropipette in one hand, almost vertical; hold the tube in your other hand. Touch the micropipette tip to the inside wall of the tube into which you want to expel the sample. This creates a tiny surface tension effect which helps coax fluid out of the tip. Slowly depress the plunger of the micropipette to the second stop to expel the last bit of fluid, and hold the plunger down in this position. Slowly remove the pipette out of the tube, keeping the plunger depressed to avoid sucking any liquid back into the tip. When the tip is free of the tube, release your thumb pressure. Always change tips for each new reagent you need to pipette or if you touch any other liquids in the reaction tube. To eject a tip, depress the large gray button on the top of the micropipette. You will be given some small tubes with colored water to practice micropipetting.

8

(Restriction Digest) 1. Obtain a foam block with micro test tubes containing your DNA samples and the restriction enzyme mix, labeled ENZ. Keep the reagents on ice. 2. Label your foam rack with your group’s name and section. The DNA samples are labeled as follows: green tube blue tube orange tube violet tube red tube yellow tube

CS (crime scene) S1 (suspect 1) S2 (suspect 2) S3 (suspect 3) S4 (suspect 4) S5 (suspect 5)

4. Pipette 10 µl of enzyme mix (ENZ) into the very bottom of each tube. Use a fresh tip to transfer the ENZ sample to each tube. Pipette up and down carefully to mix well.

5. Tightly cap the tubes and mix the components by gently flicking the tubes with your finger. If a microcentrifuge is available, pulse-spin in the centrifuge to collect all the liquid in the bottom of the tube. Otherwise, gently tap the tube on the table top.

6. Place the tubes in the foam micro tube holder and incubate for 45 min at 37°C. After the incubation period, your instructor will remove the tubes from the water bath and place them in the freezer until the next laboratory period.

9

(Gel Electrophoresis) The first step in running an agarose gel is to pour the gel. You will be pouring a 1% Agarose Gel with SYBR Safe Stain. This stain will bind to the DNA and be visible under UV light. 1. Place one casting gate in each slot inside electrophoresis chamber. 2. Obtain one thermometer, a 50 ml graduated cylinder, and a 250 ml Erlenmeyer flask. 3. Using a weigh boat, measure out 0.40 g of agarose powder and add it to a flask. 4. Using your graduated cylinder, measure out 40 ml of 1X SYBR Safe Stain (prepared in 1X TAE) – be sure to measure from bottom of meniscus. 5. Add the 1X SYBR Safe Stain to the flask and swirl to mix. 6. Heat the flask in a microwave for 20-30 seconds, watching constantly to make sure it is not boiling over. Remove the flask and swirl it to suspend any undissolved particles. BE CAREFUL – the flask gets very hot. 7. Return the flask to the microwave for another 20-30 seconds and repeat the previous step until all agarose powder is completely dissolved. (approximately 2-3 minutes) 8. Remove the flask from the microwave and allow it to cool to 55-60° C. 9. Once cooled, slowly pour agarose into gel tray in electrophoresis chamber and place the comb in the end slots. 10. Do not touch or move the gel until it has solidified – about 10-20 minutes. When cooled the gel will appear cloudy. 11. While you are waiting for your gel to harden, retrieve your digested DNA samples from last week. 12. If a centrifuge is available, pulse-spin the tubes in the centrifuge to bring all of the liquid into the bottom of the tube or gently tap on the table top. 13. Using a separate tip for each sample, add 5 µl of loading dye "LD" into each tube. Cap the tubes and mix by gently flicking the tube with your finger. Collect the sample at the bottom of the tube by tapping it gently on the table or by pulsespinning in a centrifuge.

10

14. Carefully remove casting gates and comb. 15. Fill the electrophoresis chamber with 1x TAE buffer to cover the gel, using approximately 275 ml of buffer for a BioRad Mini-Sub Cell, horizontal electrophoresis chamber. 16. Check that the wells of the agarose gels are near the black (–) electrode and the bottom edge of the gel is near the red (+) electrode. 17. Using a separate tip for each sample, load the indicated volume of each sample into 7 wells of the gel in the following order: Lane 1: Lane 2: Lane 3: Lane 4: Lane 5: Lane 6: Lane 7:

DNA size marker, 10 µl CS, green tube, 15 µl S1, blue tube, 15 µl S2, orange tube, 15 µl S3, violet tube, 15 µl S4, red tube, 15 µl S5, yellow tube, 15 µl

18. Carefully place the lid on the electrophoresis chamber. The lid will attach to the base in only one orientation. The red and black jacks on the lid of the horizontal electrophoresis chambers will match with the red and black jacks on the base. Plug the electrodes into the power supply, red to red and black to black. 19. Turn on the power and electrophorese your samples at 100 V for 30 minutes. 20. When the electrophoresis run is complete, turn off the power and remove the top of the chamber. Carefully remove the gel and tray from the gel box. Be careful — the gel is very slippery. Slide the gel into a weigh boat and take it to the UV transilluminator to view the DNA bands. 21. Dispose of your gel in the appropriate waste container. 11

Discussion Questions 1. Which suspect is guilty? How do you know?

2. Which sample has the smallest DNA fragment? Which has the largest?

3. What would your gel look like if the DNA were not fragmented?

4. What determines where a restriction endonuclease will “cut” a DNA molecule?

5. If you were called away during the electrophoresis procedure and were not able to monitor your electrophoresis run, what do you think would happen if the electricity were to remain running in your absence?

ADAPTED from:

Ward’s Introduction to Gel Electrophoresis Student Study Guide Bio-Rad Biotechnology Explorer Forensic DNA Fingerprinting Kit Instruction The American Biology Teacher, Volume 63, No. 6, August 2001

12