Leukemia (2004) 18, 2026–2031 & 2004 Nature Publishing Group All rights reserved 0887-6924/04 $30.00 www.nature.com/leu

BIOTECHNICAL METHODS SECTION (BTS)

Rapid amplification of immunoglobulin heavy chain switch (IGHS) translocation breakpoints using long-distance inverse PCR T Sonoki1,4, TG Willis1, DG Oscier2, EL Karran1,5, R Siebert3 and MJS Dyer1,5 1

Academic Haematology and Cytogenetics, Institute of Cancer Research, UK; 2Department of Haematology, Royal Bournemouth Hospital, UK; 3Institute of Human Genetics, University Hospital Schleswig-Holstein, Campus Kiel, Kiel, Germany; 4Internal Medicine II, Kumamoto University School of Medicine, Japan; and 5MRC Toxicology Unit, University of Leicester, UK Molecular cloning of immunoglobulin heavy chain (IGH) translocation breakpoints identifies genes of biological importance in the development of normal and malignant B cells. Long-distance inverse PCR (LDI-PCR) was first applied to amplification of IGH gene translocations targeted to the joining (IGHJ) regions. We report here successful amplification of the breakpoint of IGH translocations targeted to switch (IGHS) regions by LDI-PCR. To detect IGHS translocations, Southern blot assays using 50 and 30 switch probes were performed. Illegitimate Sl rearrangements were amplified from the 50 end (50 Sl LDI-PCR) from the alternative derivative chromosome, and those of Sc or Sa were amplified from the 30 end (30 Sc or 30 a LDIPCR) from the derivative chromosome 14. Using a combination of these methods, we have succeeded in amplifying IGHS translocation breakpoints involving FGFR3/MMSET on 4p16, BCL6 on 3q27, MYC on 8q24, IRTA1 on 1q21 and PAX5 on 9p13 as well as BCL11A on 2p13 and CCND3 on 6p21. The combination of LDI-PCR for IGHJ and IGHS allows rapid molecular cloning of almost all IGH gene translocation breakpoints. Leukemia (2004) 18, 2026–2031. doi:10.1038/sj.leu.2403500 Published online 21 October 2004 Keywords: IGH switch region; translocation; LDI-PCR

Introduction Chromosome translocations involving the immunoglobulin heavy chain (IGH) locus on chromosome 14q32.3 are seen in 40–50% of B-lymphoid malignancies, and in particular B-cell non-Hodgkin’s lymphoma (B-NHL)1 and myeloma.2 IGH translocations are usually reciprocal and bring genes on other chromosomes into close apposition with the IGH locus, where their expression is deregulated due to the presence of potent Bcell-specific transcriptional enhancers within the IGH locus. Genes involved in IGH translocations play a pivotal role in cell growth, differentiation, apoptosis and signal transduction of both normal and malignant B lymphocytes.3 Many IGH translocation breakpoints have been molecularly cloned; however, several recurrent breakpoints remain to be identified.4 Molecular cloning of IGH translocation breakpoints reveals involvement either of genes of unknown biological functions5,6 or an unsuspected oncogenic potential of known genes.7–9 Correspondence: Professor MJS Dyer, MRC Toxicology Unit/Leicester University, Hodgkin Building, PO Box 138, Lancaster Road, Leicester LE1 9HN, UK; Fax: þ 44 116 252 5616; E-mail: [email protected] Received 28 May 2004; accepted 29 July 2004; Published online 21 October 2004

The IGH locus comprises 51 functional variable (V) segments, 27 diverse (D) segments, six joining (J) segments and nine constant (C) segments starting from the telomeric end of 14q32.3 and spans 1.4 megabases (Mb).10 Each C segment, except d, is preceded by a switch (S) segment that plays a role in isotype class switching. To generate a diversity of the immunoglobulin repertoire, somatic rearrangement of the IGH locus takes place during B-cell differentiation. This process includes VDJ recombination, somatic hypermutation and class switch recombination, all of which involve DNA double-strand cleavage and religation; errors in each process may result in chromosome translocation targeted in IGH locus.11 The IGH translocations commonly take place in either the joining (IGHJ) or the switch (IGHS) segments. We devised a simple and robust method for the rapid molecular cloning of chromosomal translocations targeted to the IGHJ segments: this detects virtually all translocations to the IGHJ segments.12 Since the IGHS regions are another main target of IGH translocation, we have established long-distance inverse PCR (LDI-PCR) for rapid molecular cloning of Sm, Sg and Sa translocation breakpoints.

Materials and methods

Cell lines and patient materials KHM-11 is a multiple myeloma cell line.13 This cell line exhibits a t(4;14)(p16;q32) by FISH (data not shown). CTB-1 is a diffuse large B-cell lymphoma cell (DLBCL) line showing a t(14;22)(q32;q11) cytogenetically, and expresses IgG.14 Karpas 1718 is a cell line derived from the peripheral blood of a patient diagnosed with transformed splenic lymphoma with villous lymphocytes (SLVLs) (Dyer, in preparation). This cell line showed t(8;14)(q24;q32). Patient 1 was diagnosed as a primary gastric diffuse large B-cell lymphoma expressing IgA. This tumor showed t(1;14)(q21;q32), add(4q),8, þ 19. Patient 2 was an aggressive B-NHL transformed to leukemic phase with t(1;14)(p22;q32) and a t(9;14)(p13;q32). The JH alleles were cloned previously by LDI-PCR and shown to represent VDJ and DJ recombinations.12

Southern blot assays for IGHS translocation To detect IGHS translocations, Southern blot assays using series of 50 and 30 switch probes were performed.15 Rearranged bands

LDI-PCR for IGH switch translocation breakpoints T Sonoki et al

2027 Table 1

List of primers and application for amplification of respective switch segments

Target region

Primer

Nucleotide sequence (50 –30 )

Application

Sm

JXE JXI SAE SAI gF1 gF2 gF4 gF5 gR1 gR2 aF1 aF2 aR1 aR2

CACTGGCATCGCCCTTTGTCTAA CCCATGCCTTCCAAAGCGATT ACATAAATGAGTCTCCTGCTCTTCATCAAG GCAATTAAGACCAGTTCCCCTTCTAGTG TCCCTGAGGTGGCACCGATG CCAGAGCTGAGGCCAAGCTAGAG CACGCAGAAGAGCCTCTCCCTGT CCCAGCATGGAAATAAAGCACCC GACCAGTGGACACTGTTCTCAGATGG CCTCCAAGGCCCTTTTCTTCTGTG GCACACTGAGTGTCAGACCCAGTCTC CGGGACCCAGTCACTGAATACGT AGCACAGAGAGGCCTGGTGACAG TGGTTTCTGAACATGCTCCTTAGATAGG

External 50 Sm forward primer Internal 50 Sm forward primer External 50 Sm reverse primer for HindIII or Taq1 digests Internal 50 Sm reverse primer for HindIII or TaqI digests External 30 Sg forward primer for HindIII or TaqI digests Internal 30 Sg forward primer for HindIII or TaqI digests External 30 Sg forward primer for SphI digests Internal 30 Sg forward primer for SphI digests External 30 Sg reverse primer Internal 30 Sg reverse primer External 30 Sa forward primer for HindIII digests Internal 30 Sa forward primer for HindIII digests External 30 Sa reverse primer Internal 30 Sa reverse primer

Sg

Sa

on Southern blot lacking any comigrating band obtained with any other switch probes were designated ‘illegitimate’ rearrangements. The smallest illegitimate bands obtained with various enzyme digestions were amplified using LDI-PCR.

LDI-PCR for switch regions LDI-PCR and sequence analysis were performed as in a previous report.12 To amplify Sm, Sg and Sa rearranged fragments, we designed primer sets at the 50 flank region of Sm and the 30 flank region of Sg and Sa (Table 1). The Sg primers anneal to all Sg regions and the Sa primers to both Sa regions. Based on the position of the primers, we termed these methods as 50 Sm LDIPCR, 30 Sg LDI-PCR and 30 Sa LDI-PCR, respectively. 50 Sm LDIPCR amplifies breakpoint sequence on the derivative partner chromosome, whereas the 30 Sg and 30 Sa LDI-PCRs amplify the breakpoint sequence on the derivative chromosome 14. Figure 1 illustrates the germline configuration of the IGHS segments, a functional class switch recombination and the two types of IGHS translocation. The functional class switch recombination generating isotype switched IG molecules involves two switch regions and deletes the intervening DNA sequence (eg, fusion of Sm and Sg with deletion of Cm for IgG class switching as shown in Figure 1b). In contrast to the functional class switch process, IGHS translocation often involves only one switch region before such S recombination has occurred (Figure 1c).11 However, some IGHS translocations show similarity to functional class switching machinery (Figure 1d). In this case, the 50 Sm LDI-PCR can amplify breakpoints on the derivative partner chromosome even though the translocation break on the derivative chromosome 14 occurs in Sg or Sa. In addition, the 50 Sm LDI-PCR will amplify functional class switch recombination events.

Results and discussion

50 Sm LDI-PCR The KHM-11 cell showed one 50 Sm illegitimate rearranged band on Southern blot (Figure 2b). A 1.8 kb HindIII rearranged band was amplified as a 1.6 kb band by 50 Sm LDI-PCR product and sequenced (Figure 2b). Sequence analysis showed Sm fused to Sa1 region and the Sm/a hybrid juxtaposed to MMSET (Multiple Myeloma SET domain) gene locus on 4p16.3 (Figure 2d).16 Thus, the t(4;14)(p16;32) arose from two recombination events.

Firstly, an Sm and Sa fusion occurred as in functional class switching for IgA protein synthesis and then the hybrid S region underwent translocation to chromosome 4p16. The 4p16 breakpoint on der(4) of this cell line fell in the first intron of MMSET gene and 1152 bp centromeric to a previous cloned breakpoint from a plasma cell leukemia patient, PCL-1 (Figure 2d).17 A DLBCL cell line, CTB-1, showed three rearranged bands on Southern blot using the 50 Sm probe (Figure 2c). One of three rearranged bands comigrated with the 30 Sg probe (data not shown) indicating a functional IgG switch recombination. Other rearranged bands were illegitimate rearrangements. 50 Sm LDIPCR succeeded in amplifying a 1.2 kb TaqI illegitimate rearrangement as a 1.0 kb product. The sequence of the PCR product showed fusion of the Sm and the first intron of the BCL6 gene; the breakpoint sequence has been published elsewhere.18 Subsequent FISH analysis confirmed a complex three-way translocation involving 3q27, 14q32 and 8q24.18

30 Sg LDI-PCR A transformed SLVL cell line, Karpas 1718, showed one 30 Sg illegitimate rearranged band. A rearranged TaqI fragment detected with the 30 Sg probe was amplified using LDI-PCR (Figure 3b). Sequence analysis revealed Sg 4 juxtaposed with the first exon of MYC on 8q24 (Figure 3d). A gastric DLBCL (patient 1) with t(1;14)(q21;q32) showed a comigration band of Sm and Sa by the Southern blot assay (data not shown). In addition to the productive switch recombination, one illegitimate 30 Sg rearranged band was detected. A 2.0 kb SphI rearranged band was amplified by 30 Sg LDI-PCR and sequenced (Figure 3c). The sequence showed Sg3 region fused to novel immunoglobulin-like cell surface receptors (IRTAs: immune receptor translocation associated proteins;6,19 FcRHs: Fc receptor homologs20) cluster region on 1q21, which has been recently cloned from an IGH translocation breakpoint from a myeloma cell line, FR4 (Figure 3e).6 We confirmed that the PCR product was not an artifact by Southern blot (data not shown). This case demonstrates that the IRTAs/FcRHs locus is a recurrent target of IGH translocation. The 1q21 breakpoint of case 1 lies at 96 bp upstream of exon 2 of IRTA1 and 2964 bp telomeric to the breakpoint of the FR4 cell line (Figure 3e). The t(1;14)(q21;q32) in FR4 generated an IRTA1/Ca1 chimeric mRNA and produced a fusion protein comprising the signal peptide and first two amino acids of IRTA1, and transmembrane and intracellular domains of Leukemia

LDI-PCR for IGH switch translocation breakpoints T Sonoki et al

2028

a

5’

3’ SAE JXE

tel

cen

SAI JXI

Cµ

Sµ 5’Sµ

c

KHM11 Control

b

T

8 6

8 6 4

8 6

H

CTB-1 Control

TH

8 6 4

4

4

2

2 2

kb

kb

5’Sµ Hind III

2

1

kb

kb

5’Sµ Taq I

d der(4)t(4;14) ccagggcagcccagctcgtccaagcccagcccagcccagcccagcctagcccagcccagctca ggccagcccagctcagctcagctcagctcagctTTGTGTGGGCTGTTCTTGGGT GTGGACTACCTGCCACCTGTCCTTCCTCTTTGAGCATAATTC

4p16

PCL-1 KHM11 KMS11

H929

JIM3 OPM2

tel

cen

ex.1a

ex.1

ex.2a -e ex.3 ex.4 ex.5, 6 10 kb

Figure 1 Schema of the structure of the IGH locus on chromosome 14q32 and its rearrangements in normal class switching and in chromosomal translocations targeted to the S regions. (a) There is a switch region (S) upstream of each constant region (C), except Cd. Note that this figure illustrates only Em, Sm, Cm, Sg, Cg, Sa, Ca and 30 E. The three sets of triangles represent the localization and orientation of primers for 50 Sm (in yellow), 30 Sg (in green), and 30 Sa (in blue). (b) In functional class switch recombination, two switch regions (Sm and Sg for generating IgG in this figure) are fused resulting in a hybrid Sm/g and the intervening DNA fragment including Cm is deleted. (c) Most of IGHS translocations involve one switch region.11 For example, when the translocation takes place in Sg, the 50 flanking region of Sg (50 Sg) moves to a derivative partner chromosome (der(P) in this figure) and the 30 flanking region Sg (30 Sg) remains on the derivative chromosome 14 (der(14)). The breakpoint on der(14) can be amplified using 30 Sg primer pairs (indicated in green triangles). (d) Some IGHS translocations involve hybrid switch regions. In this case, IGHS translocation resembles functional class switching. In such translocations, the breakpoint on the derivative partner (der(P)) can be successfully amplified using 50 Sm primers (indicated in yellow triangles). tel: telomere; cen: centromere.

Leukemia

Figure 2 50 Sm LDI-PCR. (a) Schematic representation of the primers, restriction enzyme sites and probe used in the 50 Sm LDIPCR. H: HindIII; T: TaqI. Left: telomeric (50 ) side; right: centromeric (30 ) side. (b, c) Results of Southern blot and 50 Sm LDI-PCR of KHM-11 and CTB-1, respectively. DNA size marker: 1 kb ladder (Invitrogen, Carlsbad, CA, USA). CTB-1 shows three rearranged bands using the 50 Sm probe. One rearranged band (n) comigrated with the 30 Sg probe (data not shown). (d) Sequence alignments of the der(4)t(4;14)(p16;q32) junction of the KHM-11 cell line and comparison with other 4p16.3 breakpoints. The small letters represent IGH sequence and the capital letters 4p16 sequence. Although the nucleotide alignments were determined from Sm, the later part of IGH sequence was homologous with Sa; suggesting that Sm fused to Sa. The IGH sequence showed a five times repetition of (CAGCT) in front of the breakpoint on der(4). These repetitive sequences are underlined. Three der(14)t(4;14) breakpoint sequences cloned from KMS1 (accession number U73663), JIM3 (accession number U73660) and OPM2 (accession number AF006657) and two der(4)t(4;14) breakpoints cloned from PCL-1 (accession number U73661) and H929 (accession number U73662) have been published.17 The plain and dotted arrows indicate the 4p16 breakpoints on der(14) and der(4), respectively. The breakpoint of KHM-11 was 1152 bp centromeric to that of PCL-1. All 4p16 breakpoints fell within the MMSET gene. The boxes indicate exons of MMSET gene. ex.: exon. Two (ex. 1a and ex. 1) and five (ex. 2a–e) alternatively spliced exons were identified by a previous study.16

LDI-PCR for IGH switch translocation breakpoints T Sonoki et al

2029

a

5’

a

3’

tel

γR1 γF1

γF4

γR2 γF2

γF5

Sγ

5’

tel

cen

H

γR2

γF2

cen

Cα1

3’Sγ

H

T

H

S

H

8

b

8

6

10 8 6

10 8 6

6

4

Case 2 Control

Control

Case 1

Control

c K1718

b

γF1

Sα1

Cγ

3’Sγ T

S

γR1

3’

4

8 12 10 8

4

6 4

6

4 2

4

2

kb

kb

2

2 kb

kb

kb

3’Sγ TaqI

kb

3’Sγ SphI

3’Sγ Hind III

d der(14)t(8;14)

c der(14)t(9;14)

cccctctggcacccctctgctgcacacagccctgcaccacctccactcagcttcattgtgctgatg

ctcagcccaggtcagcctagcccagccgaacccagctcagcccaggtcaacccaattcagctcag

gtcctggctcctggcagcccatcttgctccttctAGACGCTGGATTTTTTCGGGT

ctcagcccaggtcaacccaaccaagctcagctTGGCGCCGGGAGGCGGCGGC AGTGGAAAACCAGGTAAGCACCGAAGTCCACTTGCCTTTT

GTGGGCCGGCCTGCAGTCTGGAGCGCCCCGATTGCATCCAT

8q24

Case 2 MLZ-1 #1052

K1718

#895 KIS-1

MAL

9p13 tel

H

E

H

E

B cen

tel ex.3

ex.2

ex.1

H

H

H

1 kb

e

ex.1B

der(14)t(1;14) 0

cactcccttcctggcaccaggaggctacactAGGAAGAGAAACACGTTCCAT TCCATCCATCCCAGGGAAGCGGGGAAACACAGTGGCCAGA

1q21 Case 1 H

ex.1

ex.1A 1 kb

gccctggaatgccttcccttctccatcccagctcacccttgccaactgctcagtgggatgggctca

tel

cen

E

S

FR 4 H

ex.2

cen

0.5 kb

Figure 3 30 Sg LDI-PCR. (a) Schematic representation of the primers, restriction enzyme sites and probe used in the 30 Sg LDIPCR. H: HindIII site; S: SphI; T: TaqI site. (b, c) Southern blot and 30 Sg LDI-PCR of Karpas 1718 and case 1, respectively. (d) Sequence alignment of the der(14)t(8;14)(q24;q32) of the Karpas 1718 cell. The small letters represent IGH sequence and the capital letters 8q24 sequence. The 8q24 fell within the noncoding exon 1 of MYC. The solid boxes represent coding exons and the empty boxes noncoding exons. B: BamHI; E: EcoRI; H: HindIII. (e) Sequence results of der(14)t(1;14)(q21;q32) junction of case 1 and comparison with der(14)t(1;14)(q21;q32) breakpoint cloned from myeloma cell line, FR4.6 The 1q21 breakpoint of case 1 lay 1433 bp telomeric from that of FR4. The solid and empty boxes represent coding and noncoding regions of IRTA1/FcRH4, respectively. H: HindIII; S: SphI.

Figure 4 3 Sa LDI-PCR. (a) Schematic representation of the primers, restriction enzyme sites and probe used in the 30 Sa LDIPCR. (b) Case 2 shows two rearranged bands of Sa1 using the 30 Sa probe. One rearranged band (n) comigrated with 50 Sa probe (data not shown) and another was an illegitimate rearrangement. A 7.2 kb HindIII rearranged band was amplified as a 4.0 kb PCR product. DNA marker: 1 kb ladder. (c) Sequence alignment of the der(9)t(9;14)(p13;q32) breakpoint of case 2 and comparison with other cloned 9p13 breakpoints (MLZ-1,21 #1052,22 #895,23 KIS-1,24 MAL25). The small letters represent IGH sequence and the capital letters 9p13 sequence. Three 9p13 breakpoints are within the noncoding exon 1B of PAX5 gene. E: EcoRI; H: HindIII.

Ca1. Based on this structure, it was suggested that the IRTA1/ Ca1 fusion protein inappropriately activated the B-cell receptor (BCR) signaling pathway in a ligand-independent fashion to promote either proliferation or survival.6 The t(1;14)(q21;q32) in case 1 created a fusion of Sg3 region and the first intron of IRTA1 so that the exon 1 of the IRTA1 gene on der(14) lay in the same transcription orientation of Cg3. Thus, as suggested in the FR4 cell line, expression of the regulatory elements within IRTA may activate the BCR pathways. Another possible role may be to

Leukemia

LDI-PCR for IGH switch translocation breakpoints T Sonoki et al

2030 Table 2

Summary of translocations cloned in this study

Material KHM11 CTB-1 Karpas 1718 Patient 1 Patient 2

Origin Myeloma DLBCL SLVL DLBCL Leukemic phase of NHL

Cytogenetics t(4;14)(p16;q32) t(14:22)(q32:q11) t(8;14)(q24;q32) t(1;14)(q21;q32) t(1;14)(p22;q32) t(9;14)(p13;q32)

disrupt the normal function of IRTA1, because both breakpoints separate coding regions of IRTA1. Recent immunohistochemical studies have suggested that IRTA1 is expressed in a subset of marginal zone B cells.20 However, the functions of IRTA1 are unknown.

30 Sa LDI-PCR DNA from a patient with B-NHL in leukemic phase (patient 2) with t(1;14)(p22;q32) and t(9;14)(p21;q32) showed a 30 Sa illegitimate switch rearrangement on the Southern blot assay (Figure 4b). A rearranged 30 Sa HindIII fragment was amplified and sequenced. The non-IGH sequence mapped to a BAC clone (RP11-297B17, accession number AL161781) derived from chromosome 9p13. The 9p13 breakpoint fell only 75 bp telomeric to a previously cloned breakpoint from MZL-1 (Figure 4c).21 Three 9p13 breakpoints (case 2, MZL-1 and #105222) were clustered within the noncoding region of exon 1B of PAX5 gene, indicating that these three cases expressed alternatively spliced PAX5 gene. The t(9;14)(p13;q32) is associated with indolent B-NHLs such as immunoplasmacytoid lymphomas. The two IGH translocations in this case may have contributed to the aggressive clinical course. However, we have failed to clone the other IGH breakpoint, indicating that some breakpoints may not be amenable to the PCR approaches developed here. All the results obtained in this study are summarized in Table 2. In conclusion, both LDI-PCR protocols for IGHJ and IGHS segments may allow molecular cloning of most IGH translocations from primary clinical material. Cloning of IGHJ translocations is straightforward and can be performed without recourse to Southern blot data; the method can be performed with only very small amounts (20 ng) of high-molecular-weight DNA. In contrast, IGHS translocations are more complex and it is therefore necessary to have large amounts of high-molecularweight DNA available to allow comprehensive analysis before embarking on LDI-PCR to maximize chances of success. Apart from the translocations described here, we have also used similar methods to clone both BCL11A5 and cyclin D3 (CCND3)7 translocation breakpoints. We have not systematically examined both derivative chromosomes in any of the cases reported here in order to investigate possible mechanisms underlying the genesis of the translocations. However, it should be noted that a combination of 50 Sm and 30 Sg or 30 Sa PCR methods may allow both derivative chromosomes to be amplified. Finally, some IGH breakpoints do not involve either JH or S region. For example, the t(11;14)(q13;q32) in the mantle cell lymphoma cell line NCEB1 falls within an apparently germline IGH locus.12 Breakpoints in cases of BCP-ALL with rare IGH translocations may fall within the Cd–Cg3 intron26 (data not shown). Such translocations are not amenable to the LDI-PCR approaches described here, but appear to be uncommon. Leukemia

Switch LDI-PCR 0

5 Sm 50 Sm 30 Sg 30 Sg 30 Sa

Involved gene/chromosome FGFR3/MMSET 4p16 BCL6/3q27 MYC/8q24 IRTA1/1q21 PAX5/9p13

Acknowledgements This work was supported by Lady Tata Foundation, The Daiwa Anglo-Japanese Foundation, Deutsche Krebshilfe and The Human Resources Support Foundation under Kumamoto City Municipal Centennial Commemorative Project. We thank Dr Abraham Karpas (University of Cambridge, UK) for kindly providing the Karpas 1718 cell line.

References 1 Tamura A, Miura I, Iida S, Yokota S, Horiike S, Nishida K et al. Interphase detection of immunoglobulin heavy chain gene translocations with specific oncogene loci in 173 patients with B-cell lymphoma. Cancer Genet Cytogenet 2001; 129: 1–9. 2 Bergsagel PL, Kuehl WM. Chromosome translocations in multiple myeloma. Oncogene 2001; 20: 5611–5622. 3 Willis TG, Dyer MJS. The role of immunoglobulin translocations in the pathogenesis of B-cell malignancies. Blood 2000; 96: 808–822. 4 Cigudosa JC, Parsa NZ, Louie DC, Filippa DA, Jhanwar SC, Johansson B et al. Cytogenetic analysis of 363 consecutively ascertained diffuse large B-cell lymphomas. Genes Chromosomes Cancer 1999; 25: 123–133. 5 Satterwhite E, Sonoki T, Willis TG, Harder L, Nowak R, Arriola EL et al. The BCL11 gene family: involvement of BCL11A in lymphoid malignancies. Blood 2001; 98: 3413–3420. 6 Hatzivassiliou G, Miller I, Takizawa J, Palanisamy N, Rao PH, Iida S et al. IRTA1 and IRTA2, novel immunoglobulin superfamily receptors expressed in B cells and involved in chromosome 1q21 abnormalities in B cell malignancy. Immunity 2001; 14: 277–289. 7 Sonoki T, Harder L, Horsman DE, Karran L, Taniguchi I, Willis TG et al. Cyclin D3 is a target gene of t(6;14)(p21.1;q32.3) of mature B-cell malignancies. Blood 2001; 98: 2837–2844. 8 Shaughnessy Jr J, Gabrea A, Qi Y, Brents L, Zhan F, Tian E et al. Cyclin D3 at 6p21 is dysregulated by recurrent chromosomal translocations to immunoglobulin loci in multiple myeloma. Blood 2001; 98: 217–223. 9 Kawamata N, Sakajiri S, Sugimoto KJ, Isobe Y, Kobayashi H, Oshimi K. A novel chromosomal translocation t(1;14)(q25;q32) in pre-B acute lymphoblastic leukemia involves the LIM homeodomain protein gene, Lhx4. Oncogene 2002; 21: 4983–4991. 10 Honjo T, Matsuta F. Immunoglobulin heavy chain loci of mouse and human. In: Honjo T, Alt FW (eds). Immunoglobulin Genes. London, UK: Academic Press, 1995, pp 145–171. 11 Kuppers R, Dalla-Favera R. Mechanisms of chromosomal translocations in B cell lymphomas. Oncogene 2001; 20: 5580–5594. 12 Willis TG, Jadayel DM, Coignet LJ, Abdul-Rauf M, Treleaven JG, Catovsky D et al. Rapid molecular cloning of rearrangements of the IGHJ locus using long-distance inverse polymerase chain reaction. Blood 1997; 90: 2456–2464. 13 Hata H, Matsuzaki H, Sonoki T, Takemoto S, Kuribayashi N, Nagasaki A et al. Establishment of a CD45-positive immature plasma cell line from an aggressive multiple myeloma with high serum lactate dehydrogenase. Leukemia 1994; 8: 1768–1773. 14 Uchida Y, Miyazawa K, Yaguchi M, Gotoh A, Iwase O, Ohyashiki K et al. Establishment of novel B-lymphoma cell line, CTB-1, with strong Fas antigen expression having chromosomal translocation t(14;22). Int J Oncol 1997; 10: 1103–1107.

LDI-PCR for IGH switch translocation breakpoints T Sonoki et al

2031 15 Bergsagel PL, Chesi M, Nardini E, Brents LA, Kirby SL, Kuehl WM. Promiscuous translocations into immunoglobulin heavy chain switch regions in multiple myeloma. Proc Natl Acad Sci USA 1996; 93: 13931–13936. 16 Chesi M, Nardini E, Lim RS, Smith KD, Kuehl WM, Bergsagel PL. The t(4;14) translocation in myeloma dysregulates both FGFR3 and a novel gene, MMSET, resulting in IgH/MMSET hybrid transcripts. Blood 1998; 92: 3025–3034. 17 Chesi M, Nardini E, Brents LA, Schrock E, Ried T, Kuehl WM et al. Frequent translocation t(4;14)(p16.3;q32.3) in multiple myeloma is associated with increased expression and activating mutations of fibroblast growth factor receptor 3. Nat Genet 1997; 16: 260–264. 18 Sanchez-Izquierdo D, Siebert R, Harder L, Marugan I, Gozzetti A, Price HP et al. Detection of translocations affecting the BCL6 locus in B cell non-Hodgkin’s lymphoma by interphase fluorescence in situ hybridization. Leukemia 2001; 15: 1475–1484. 19 Falini B, Tiacci E, Pucciarini A, Bigerna B, Kurth J, Hatzivassiliou G et al. Expression of the IRTA1 receptor identifies intraepithelial and subepithelial marginal zone B cells of the mucosa-associated lymphoid tissue (MALT). Blood 2003; 102: 3684–3692. 20 Davis RS, Wang YH, Kubagawa H, Cooper MD. Identification of a family of Fc receptor homologs with preferential B cell expression. Proc Natl Acad Sci USA 2001; 98: 9772–9777.

21 Morrison AM, Jager U, Chott A, Schebesta M, Haas OA, Busslinger M. Deregulated PAX-5 transcription from a translocated IgH promoter in marginal zone lymphoma. Blood 1998; 92: 3865–3878. 22 Iida S, Rao PH, Nallasivam P, Hibshoosh H, Butler M, Louie DC et al. The t(9;14)(p13;q32) chromosomal translocation associated with lymphoplasmacytoid lymphoma involves the PAX-5 gene. Blood 1996; 88: 4110–4117. 23 Hamada T, Yonetani N, Ueda C, Maesako Y, Akasaka H, Akasaka T et al. Expression of the PAX5/BSAP transcription factor in haematological tumour cells and further molecular characterization of the t(9;14)(p13;q32) translocation in B-cell non-Hodgkin’s lymphoma. Br J Haematol 1998; 102: 691–700. 24 Busslinger M, Klix N, Pfeffer P, Graninger PG, Kozmik Z. Deregulation of PAX-5 by translocation of the Emu enhancer of the IgH locus adjacent to two alternative PAX-5 promoters in a diffuse large-cell lymphoma. Proc Natl Acad Sci USA 1996; 93: 6129–6134. 25 Pellet P, Berger R, Bernheim A, Brouet JC, Tsapis A. Molecular analysis of a t(9;14)(p11;q32) translocation occurring in a case of human alpha heavy chain disease. Oncogene 1989; 4: 653–657. 26 Dyer MJS, Heward JM, Zani VJ, Buccheri V, Catovsky D. Unusual deletions within the immunoglobulin heavy-chain locus in acute leukemias. Blood 1993; 82: 865–871.

Leukemia