Dépôt Institutionnel de l’Université libre de Bruxelles / Université libre de Bruxelles Institutional Repository Thèse de doctorat/ PhD Thesis Citation APA: Delespaux, V. F. (2005). Improved diagnosis of trypanosome infections and drug resistant T.congolense in livestock (Unpublished doctoral dissertation). Université libre de Bruxelles, Faculté des Sciences – Sciences biologiques, Bruxelles.

Disponible à / Available at permalink : https://dipot.ulb.ac.be/dspace/bitstream/2013/211060/4/bece51ff-9da7-429a-9d06-8f1047352153.txt

(English version below) Cette thèse de doctorat a été numérisée par l’Université libre de Bruxelles. L’auteur qui s’opposerait à sa mise en ligne dans DI-fusion est invité à prendre contact avec l’Université ([email protected]). Dans le cas où une version électronique native de la thèse existe, l’Université ne peut garantir que la présente version numérisée soit identique à la version électronique native, ni qu’elle soit la version officielle définitive de la thèse. DI-fusion, le Dépôt Institutionnel de l’Université libre de Bruxelles, recueille la production scientifique de l’Université, mise à disposition en libre accès autant que possible. Les œuvres accessibles dans DI-fusion sont protégées par la législation belge relative aux droits d'auteur et aux droits voisins. Toute personne peut, sans avoir à demander l’autorisation de l’auteur ou de l’ayant-droit, à des fins d’usage privé ou à des fins d’illustration de l’enseignement ou de recherche scientifique, dans la mesure justifiée par le but non lucratif poursuivi, lire, télécharger ou reproduire sur papier ou sur tout autre support, les articles ou des fragments d’autres œuvres, disponibles dans DI-fusion, pour autant que : - Le nom des auteurs, le titre et la référence bibliographique complète soient cités; - L’identifiant unique attribué aux métadonnées dans DI-fusion (permalink) soit indiqué; - Le contenu ne soit pas modifié. L’œuvre ne peut être stockée dans une autre base de données dans le but d’y donner accès ; l’identifiant unique (permalink) indiqué ci-dessus doit toujours être utilisé pour donner accès à l’œuvre. Toute autre utilisation non mentionnée ci-dessus nécessite l’autorisation de l’auteur de l’œuvre ou de l’ayant droit. ------------------------------------------------------ English Version ------------------------------------------------------------------This Ph.D. thesis has been digitized by Université libre de Bruxelles. The author who would disagree on its online availability in DI-fusion is invited to contact the University ([email protected]). If a native electronic version of the thesis exists, the University can guarantee neither that the present digitized version is identical to the native electronic version, nor that it is the definitive official version of the thesis. DI-fusion is the Institutional Repository of Université libre de Bruxelles; it collects the research output of the University, available on open access as much as possible. The works included in DI-fusion are protected by the Belgian legislation relating to authors’ rights and neighbouring rights. Any user may, without prior permission from the authors or copyright owners, for private usage or for educational or scientific research purposes, to the extent justified by the non-profit activity, read, download or reproduce on paper or on any other media, the articles or fragments of other works, available in DI-fusion, provided: - The authors, title and full bibliographic details are credited in any copy; - The unique identifier (permalink) for the original metadata page in DI-fusion is indicated; - The content is not changed in any way. It is not permitted to store the work in another database in order to provide access to it; the unique identifier (permalink) indicated above must always be used to provide access to the work. Any other use not mentioned above requires the authors’ or copyright owners’ permission.

DBM 00G44

Improved diagnosis of trypanosome infections and drug résistant T. congolense in livestock

Vincent Delespoux ÜLB - IBMM BIBLTOTHEQTJF

"J do not agréé wifh a Word you say, but I wiH defend to the deafh your right to say if. " (Voltaire)

Acknowledgments

Acknowledgments

This PhD thesis would not hâve been successfully conducted without: •

My promoter, Dr Dirk Geysen (Institute of Tropical Medicine of Antwerp /Instituut voor Tropische Geneeskunde) and co-promoters Dr Phelix A.O. Majiwa (International Livestock Research Institute - African Agricultural Technology Foundation / ILRI - AATF) and Dr Luc Vanhamme (Université Libre de Bruxelles).

•

The Institute of Tropical Medicine of Antwerp / Instituut voor Tropische Geneeskunde Antwerpen (ITM/ITG) with a spécial thought to Pr. Stanny Geerts for initiating this work and allowing my collaboration, to Dr Dirk Geysen for his advise and continuons support, to Dr Jef Brandt for his support especially during the operations in Zambia, to Jacobus De Witte, Marc Jochems, Frank Ceulemans, Bjom Victor, Louis Van Tiggel for their kind technical assistance.

•

The Université Libre de Bruxelles with a grateful thought to Dr Luc Vanhamme who accepted the supervision of this thesis.

•

The International Livestock Research Institute for providing the isogenic clones of T. congolense and particularly Dr Phelix A.O. Majiwa for helpfiil advice, Mrs Mary Maina for technical assistance and Paul Spooner for logistical assistance.

•

The Europeean Union and INCO-DC (International Coopération with Developing countries, Contract Number ERBIC18CT95-006) and the University of Glasgow (Department of Veterinary Physiology) with particular acknowledgment to Dr Marc Charles Eisler.

•

The CIRDES and Dr I. Sidibe for providing T. congolense strains characterized for isometamidium résistance.

Instituut voor Tropische Geneeskunde Antwerpen - Université Libre de Bruxelles - International Livestock Research Institute Financed by Het Fonds voor Wetenchappelijk Onderzoek Vlaanderen - Research Foundation Flanders

3

Acknowledgments •

The Frei Universitât Berlin, Dr. Peter-Henning Clausen and Dr. Yohannes Afewerk for providing T.congolense strains characterized for isometamidium résistance.

•

The Government of the Republic of Zambia for its long term commitment in Animal Health and Production and Agricultural enhancement.

•

The Belgian Coopération, the Assistance to the Veterinary Services of Zambia, the Veterinary Services of Zambia and ail the staff with a grateful thought to Kalinga Chilongo, Anton Chupa, Romanos Besa, George Chaka, L. Mataa, Koen Geeraerts, John Kwenda may he rest in peace, Gabriel Mitti, Reuben Zulu, Michel Billiouw, Rik Elyn, Fridah Mukuka, Casiano Hapoma, Prosper Van Kerkhoven, Dryson Daka, Jennifer Phiri, Nelson Banda and E. Chanda.

•

Het Fonds voor Wetenschappelijk Onderzoek - Vlaanderen (FWO) for fmancing the work performed in molecular biology.

•

I hâve been honoured to gain the collaboration of Senior Chief Kalindawalo, Chief Kawasa, Chieftainess Nyanje, Chief Sandwe Chief Mba’Gombe and their people.

It is impossible to mention individually ail the persons who helped in some way but I would like to express my gratitude for ail the assistance, both professional and Personal, I received ffom the varions people I forgot to mention.

Instituut voor Tropische Geneeskunde Antwerpen - Université Libre de Bruxelles - International Livestock Research Institute Financed by Het Fonds voor Wetenchappelijk Onderzoek Vlaanderen - Research Foundation Flanders

4

Table of contents

Table of contents Acknowledgments...........................................................................................................3 Table of contents.............................................................................................................5 Published data..................................................................................................................10 Summary........................................................................................................................ 11 List of abbreviations....................................................................................................... 12 1. Introduction...............................................................................................................13 1.1. Animal trypanosomosis........................................................................................13 1.1.1.

Life cycle.................................................................................................... 13

1.1.2. Phylogenetic tree............................................................................................15 1.2. Trypanosomosis diagnosis...................................................................................17 1.2.1. A gold standard?............................................................................................17 1.2.2. Clinical diagnosis...........................................................................................17 1.2.3. Parasitological diagnosis by direct examination......................................... 18 1.2.3.1. Wet blood film........................................................................................ 18 1.2.3.2. Thick blood film..................................................................................... 19 1.2.3.3. Thin blood smear technique...................................................................19 1.2.3.4. Parasite concentration techniques...........................................................20 1.2.4. Parasitological diagnosis by indirect diagnosis...........................................21 1.2.4.1. The indirect fluorescent antibody test (IFAT).......................................21 1.2.4.2. The indirect enzyme-linked immunosorbent assay.............................. 22 1.2.4.3. Gard agglutination test............................................................................ 23 1.2.4.4. Antigen-detecting tests...........................................................................23 1.2.4.5. Polymerase Chain Reaction and Restriction Fragment Length Polymorphism.......................................................................................................24 1.2.4.6. Proteomic signature analysis..................................................................24 1.3. Strategies for trypanocidal drug usage............................................................... 27 1.3.1. Routine block treatments..............................................................................27 1.3.2. Strategie block treatments.............................................................................27

Instituut voor Tropische Geneesktmde Antwerpen - Université Libre de Bruxelles - International Livestock Research Institute Financed by Het Fonds voor Wetenchappelijk Onderzoek Vlaanderen - Research Foundation Flanders

5

Table of contents 1.3.4. Monitoring and treatment of individual infected animais............................ 27 1.3.5. Monitoring and treatment of clinical cases.................................................... 27 1.4. Résistance against trypanocidal drugs.................................................................. 28 1.4.1. Possible strategies for drug résistance........................................................... 28 1.4.2. Chemotherapy of animal trypanosomosis...................................................... 29 1.4.3. Isometamidium résistance...............................................................................31 1.4.4. Diminazene résistance.................................................................................... 35 1.5. Diagnosis of trypanocidal résistance.....................................................................38 1.5.1. Tests in ruminants........................................................................................... 38 1.5.2. Tests in mice....................................................................................................39 1.5.3. In vitro assays..................................................................................................40 1.5.4. Trypanocidal drug ELISAs.............................................................................40 1.5.5. Longitudinal parasitological data................................................................... 42 1.5.6. Early diagnosis of treatment failure............................................................... 42 1.5.7. New tests for détection of résistance to isometamidium..............................42 2. Results........................................................................................................................ 46 2.1. Disease prevalence and drug résistance............................................................... 47 2.1.1. Spécifie objective of this chapter....................................................................47 2.1.2. Introduction......................................................................................................47 2.1.3. Prevalence of bovine trypanosomosis............................................................ 48 2.1.4. Investigation of trypanocidal drug résistance in mice.................................. 49 2.1.5. Investigation of trypanocidal drug résistance in calves................................ 50 2.1.6. Investigations using isometamidium-ELISA................................................. 51 2.1.7. Summarized data per district.......................................................................... 52 2.2. Drug use..................................................................................................................54 2.2.1. Spécifie objective of this chapter....................................................................54 2.2.2. Introduction...................................................................................................... 54 2.2.3. Questionnaire................................................................................................... 54 2.2.4. Cattle bodyweight estimation......................................................................... 57 2.2.5. Sérum isometamidium concentration.............................................................58 2.3. Diagnosis of trypanosome infections in cattle by PCR-RFLP...........................60 2.3.1. Spécifie objective of this chapter....................................................................60 2.3.2. Introduction...................................................................................................... 60 Instituut voor Tropische Geneeskuncte Antwerpen - Université Libre de Bruxelles - International Livestock Research Institute Financed by Het Fonds voor Wetenchappelijk Onderzoek Vlaanderen - Research Foundation Flanders

6

Table of contents 2.3.3. Results......................................................................................................... 61 2.4. Use of PCR-RPLP for the diagnosis of mixed trypanosome infections in cattle

68 2.4.1. Spécifie objective of this chapter..................................................................68 2.4.2. Introduction....................................................................................................68 2.4.3. Results............................................................................................................ 68 2.5. AFLP analysis of sensitive and résistant T.congolense clones.........................75 2.5.1. Spécifie objective of this chapter.................................................................. 75 2.5.2. Introduction.................................................................................................... 75 2.5.1. Similarity of AFLP profiles of the isogenic clones..................................... 75 2.5.2. Sequencing and analysis of the fragments....................................................78 2.5.3. Résistant phenotype and RFLP results.........................................................82 3. Discussion....................................................................................................................84 3.1. Epidemiological background and drug use.........................................................85 3.2. Improvement of the diagnosis of trypanosome infections................................. 90 3.3. AFLP analysis of sensitive and résistant T.congolense clones.........................94 3.4. Final recommendations........................................................................................96 3.4.1. Single Drug Résistance..................................................................................96 3.4.2. Multiple drug résistance Résistance to both isometamidium and diminazene is présent at the level of individual trypanosomes may be demonstrated by testing cloned populations in mice or in ruminants (1). If résistance to both isometamidium and diminazene is présent at the level of individual trypanosomes, the followâng guidelines should be followed:......................................................... 97 3.4.3. Recommendations on the use of isometamidium prophylaxis:...................97 4. Materials and methods................................................................................................ 98 4.1. Epidemiological survey...................................................................................... 98 4.1.1. Cross-sectional study..................................................................................... 98 4.1.2. Longitudinal study......................................................................................... 99 4.1.3. Staining and examinations of blood smears.................................................. 99 4.1.4. Trypanocidal drug sensitivity tests in mice................................................ 100 4.1.5. Trypanocidal drug sensitivity tests in calves.............................................. 100 4.1.6. Antibody-ELISA...........................................................................................101

Instituut voor Tropische Geneeskunde Antwerpen - Université Libre de Bruxelles - International Livestock Research Institute Financed by Het Fonds voor Wetenchappelijk Onderzoek Vlaanderen - Research Foundation Flanders

7

Table of contents 4.1.7. Isometamidium-ELISA............................................................................... 101 4.2. Drug use survey....................................................................................................102 4.2.1. Analysis of the use of trypanocides by farmers in Eastem Province....... 102 4.2.2. Information on drug use................................................................................ 103 4.2.3. Monitoring of cattle bodyweight................................................................. 103 4.2.4. Isometamidium administration.....................................................................103 4.2.5. Isometamidium-ELISA................................................................................. 103 4.3. Diagnosis of trypanosome infections in cattle by PCR-RFLP.......................... 104 4.3.1. DNA référencé samples................................................................................ 104 4.3.2. Filter paper samples...................................................................................... 105 4.3.3. DNA amplification........................................................................................ 106 4.3.4. Primers used...................................................................................................106 4.3.5. Restriction Fragment Length Polymorphism............................................... 107 4.4. Use of PCR-RFLP for the diagnosis of mixed trypanosome infections in cattle 107 4.4.1. DNA référencé samples................................................................................ 107 4.4.2. Field samples.................................................................................................110 4.4.3. DNA amplification.........................................................................................110 4.4.4. Primers used................................................................................................... 110 4.4.5. Restriction Fragment Length Polymorphism............................................... 111 4.5. AFLP analysis of sensitive and résistant Tcongolense clones........................111 4.5.1. Trypanosomes and DNA samples.................................................................111 4.5.2. AFLP.............................................................................................................. 113 4.5.3. Polyacrylamide Gel Electrophoresis (PAGE).............................................. 113 4.5.4. DNA extraction from the polyacrylamide gel............................................. 114 4.5.5. PCR amplification of the purified fragments of DNA.................................114 4.5.6. Cloning and sequencing................................................................................ 114 4.5.7. DNA amplification of field strains...............................................................114 4.5.8. Primers........................................................................................................... 115 4.5.9. Restriction Fragment Length Polymorphism............................................... 115 4.5.10. Single dose mouse test.................................................................................115 5. Référencés...................................................................................................................116 6. Figures......................................................................................................................... 137 InstHuut voor Tropische Geneeskunde Antwerpen - Université Libre de Bruxelles — International Livestock Research Institute Financed by Het Fonds voor Wetenchappelijk Onderzoek Vlaanderen - Research Foundation Flanders

8

Table of contents 7. Tables....................................................................................................................... 139 8. Index......................................................................................................................... 140

Instituut voor Tropische Geneeskunde Antwerpen - Université Libre de Bruxelles - International Livestock Research Institute Financed by Met Fonds voor Wetenchappelijk Onderzoek Vlaanderen - Research Foundation Flanders

9

Publications

Published data

Delespaux V, Geerts S, Brandt J, Elyn R and Eisler MC. Monitoring the correct use of isometamidium by farmers and veterinary assistants in Eastem Province of Zambia using the isometamidium-ELISA. Veterinary Parasitology 110: 117-122, 2002.

Delespaux V, Ayral F, Geysen D and Geerts S. PCR-RFLP using Ssu-rDNA amplification: applicability for the diagnosis of mixed infections with different trypanosome species in cattle. Veterinary Parasitology 117: 185-193,2003.

Geysen D, Delespaux V and Geerts S. PCR-RFLP using Ssu-rDNA amplification as an easy method for species-specific diagnosis of Trypanosoma species in cattle. Veterinary Parasitology WQ: 171-180, 2003.

Sinyangwe L, Delespaux V, Brandt J, Geerts S, Mubanga J, Maehila N, Holmes PH and Eisler MC. Trypanocidal drug résistance in eastem province of Zambia. Veterinary Parasitology \\9: 125-135,2004.

Delespaux V, Geysen D, Majiwa PAO and Geerts S. (2004). Identification of a genetic marker for isometamidium chloride résistance in Trypanosoma congolense. International Journal for Parasitology (in press).

Instituut voor Tropische Geneeskunde Antwerpen - Université Libre de Bruxelles - International Livestock Research Institute Financed by Het Fonds voor Wetenchappelijk Onderzœk Vlaanderen - Research Foundation Flanders

10

Summary

Summary

The aim of this thesis was to provide a picture of the trypanosomosis and drug résistance prevalence in Eastem Province of Zambia, to understand the underlying factors of drug résistance (drug use habits), to improve the diagnosis of trypanosomosis in livestock and finally, to improve the diagnosis of isometamidium résistance in T.congolense. After an introductory part where available trypanosomosis and trypanocide résistance diagnostic methods are described and discussed, the body of the thesis is divided in two main sections. In the first section are presented the results of a cross-sectional and a longitudinal epidemiological survey describing the geographical distribution of trypanosomosis cases, of résistant isolâtes and of cattle treated with isometamidium chloride. The results of the monitoring of unsupervised treatments of cattle with isometamidium by farmers and veterinary assistants with the Isometamidium-ELISA technique are also presented. The second section describes the development of two new diagnostic methods, the first one allowing the diagnosis of trypanosome infections with high sensitivity and specificity through semi-nested polymerase chain reaction and restriction fragment length polymorphism. This is the first report of a pan-trypanosome PCR test (a single PCR test for the diagnosis of ail important pathogenic trypanosomes of cattle). The second new method that was developed allows the diagnosis of isometamidium résistant T.congolense strains by PCR-RFLP. This is the first report of a PCR based diagnostic test of trypanocide résistance in T. congolense.

înstituut voor Tropische Geneeskunde Antwerpen - Université Libre de Bruxelles - International Livestock Research Institute Financed by Het Fonds voor Wetenchappelijk Onderzoek Vlaanderen - Research Foundation Flanders

11

List of abbreviations

List of abbreviations ABC

ATP binding cassette

AFLP

Amplified Fragment Length Polymorphism

Ag

Antigen

ATP

Adenosine triphosphate

GATT

Gard Agglutination Test for Trypanosomiasis

CD

Curative dose

ED

Effective dose

ELISA

Enzyme Linked Immunosorbent Assay

IFAT

Indirect Fluorescent Antibody Test

KIVI

Kit for In Vitro Isolation

PCR

Polymerase Chain Reaction

PCV

Packed Cell Volume

RBC

Red Blood Cell

rDNA

ribosomal Deoxyribo Nucleic Acid

Instituut voor Tropische Geneeskunde Antwerpen - Université Libre de Bruxelles - International Livestock Research Institute Financed by Het Fonds voor Wetenchappelijk Onderzoek Vlaanderen - Research Foundation Flanders

12

Introduction

1. Introduction 1.1. Animal trypanosomosis In Africa, Trypanosoma brucei, T. vivax and T. congolense occur wherever the tsetse fly vector is found. The clinical signs of the disease caused by these organisms vary according to the trypanosome species, the virulence of the particular isolate and the species of host infected. Acute disease is characterized by anaemia weight loss, abortion and, if not treated, possibly death. Animais that survive are often infertile (Al Qarawi et al, 2004; Sekoni et al, 2004) and of low productivity. In some instances, infected animais show no évident signs of disease but can perish if stressed, for example, by work, pregnancy, milking or adverse environmental conditions (Luckins, 1988). In Southern Africa the disease is widely known as Nagana, which is derived ffom a Zulu term meaning ’to be in low or depressed spirits which is a very pertinent description of the disease. The impact of the tsetse-associated disease extends in subSaharan Afnca over some 10 million km^ (a third of the continent). Of these 10 million km^ some 3 million are covered by équatorial rain forest; the remaining area contains some very good grazing areas, which perhaps fortunately hâve been protected so far by the tsetse fly against overgrazing (Uilenberg, 1998).

1.1.1. Life cycle Transmission and Epidemiology: Most tsetse-transmission is cyclical, and begins when blood from a trypanosomeinfected animal is ingested by the tsetse fly (Figure 1). The trypanosome loses its surface coat, multiplies in the fly, then reacquires a surface coat and becomes infective. Trypanosoma brucei species migrate from the gut to the proventriculus to the pharynx and eventually to the salivary glands; the cycle for T. congolense stops at the hypopharynx, and the salivary glands are not invaded; the entire cycle for T.vivax occurs in the proboscis. The animal-infective form in the tsetse salivary gland is referred to as the metacyclic form. The life cycle in the tsetse may be as short as 1 week with T. vivax or extend to a few weeks for T. brucei species. The tsetse fly is restricted to Africa from about latitude 15°N to 29°S. Tsetse Aies are in the genus Glossina . The three main species inhabit relatively distinctive

Institxtut voor Tropische Geneeskunde Antwerpen - Université Libre de Bruxelles - International Livestock Research Institute Financed by Het Fonds voor Wetenchappelijk Ondenoek Vlaanderen - Research Foundation Flanders

13

Introduction environments; G. morsitans usually is found in savanna country, G. palpalis prefers areas around rivers and lakes, and G. fusca lives in high forest areas. Ail three species transmit trypanosomes, and ail feed on varions mammals.

Copyright; TDR/Wellcome Trust

Figure 1 Life cycle of Trypanosoma brucei

Mechanical transmission can occur through tsetses or other biting Aies. In the case of T. vivax, Tabanus spp. and other biting Aies seem to be the primary mechanical vectors outside the tsetse areas, as in Central and South America. Mechanical transmission requires only that blood containing infections trypanosomes be transferred from one animal to another. Cattle, sheep, and goats are infected, in order of importance, by T.congolense, Tvivax and T. brucei brucei . In pigs, T simiae is the most important. In dogs and cats, T. brucei is probably the most important. It is difAcult to assign an order of importance for horses and camels (see Table 1). The trypanosomes that cause tsetse-transmitted trypanosomiasis (sleeping sickness) in man, T. brucei rhodesiense and T. brucei gambiense , closely resemble T. brucei brucei from animais; the animal isolâtes of T brucei are lysed by human sérum. There are indications that changes in résistance to human sérum occur in some isolâtes of T. brucei species; therefore, reasonable précautions should be taken when working vyith such isolâtes. Domestic animais may act as réservoirs of human infections. Instituut voor Tropische Geneeskmde Antwerpen - Université Libre de Bruxelles - International Livestock Research Jnstitute Financed by Het Fonds voor Wetenchappelijk Onderzoek Vlaanderen - Research Foundation Flanders

14

Introduction Domestic hosts

Réservoir

Laboratory animais

T.vivax

Cattle, buffaloes,

Wildlife, antelopes,

small raminants,

girafs

none

horses, camels. Refractory: pig, dog, cat T.congoleme

Cattle, small

Wildlife (wide

ruminants, horses,

range)

Rodents®^, rabbits

camels, pigs, dogs T. brucei brucei

Horses, camels.

Wildlife (wide

dogs: very sensitive

range

Rodents, rabbits

Cattle and small ruminants Some strains do not grow in rodents Table 1 Host range of the principal animal trypanosomes

1.1.2. Phylogenetic tree Species of trypanosome infecting mammals fall into two distinct groups and, accordingly, hâve been divided in two sections (Hoare, 1972); (A) the Stercoraria (subgenera Schizotrypanum, Megatrypanum and Herpetosoma) in which trypanosomes are typically produced in the hindgut and are then passed on by contaminative transmission from the posterior; and (B) the Salivaria (subgenera Duttonella, Nannomonas and Trypanozoon), in which transmission occurs by the anterior station and is inoculative. A detailed phylogenetic tree based on the analysis of the 18S SSU ribosomal ma gene sequences is presented in Figure 2.

Instituut voor Tropische Geneeskunde Antwerpen - Université Libre de Bruxelles - International Liveslock Research Institute Financed by Het Fonds voor Wetenchappelijk Onderzoek Vlaanderen - Research Foundation Flanders

15

Introduction

r-r^‘ T.C3,'3SS£ ICO

85

'--------- T. (leeoh) —T.txxssoni T. tr^se Trctatorsim

"Aquatic' dade

Twt3lenkjm jTca Tcongc^ense{^ P-TTeo* T.cot^ 0.4 ng/ml suggests résistance; the higher the drug level detected the greater the degree of résistance that could he inferred (Eisler et al, 1997a). Further research is necessary, however, in order to confirm these results in a larger number of animais. Similar drug ELlSAs hâve been developed for the détection of subnanogramme amounts of homidium bromide (Murilla, 1999) and a similar test for diminazene is now available. In this assay, diminazene in the test samples and that in a diminazene-horseradish peroxidase conjugate compete for antibodies to diminazene raised in rabbits and immobilized on a microtitre plate. Tetramethylbenzidine-hydrogen peroxide (TMB/H2O2) is used as chromogen-substrate System. The assay has a détection limit of 0.8 ng/ml of sérum with a high specificity for diminazene. Cross-reactivity with either homidium bromide and quinapyramine sulphate/chloride of 0.0004% is negligible while that with isometamidium chloride is 0.71%. The assay was able to detect diminazene levels in normal Boran steers for at least two weeks after intramuscular injection with the drug at a dose of 3.5 mg/kg bw (Karanja et al, 2002). The advantage of the ISMM-ELISA is that large numbers of sera can be tested within a relatively short time. The ELISA may also provide information on drug usage in an area of investigation (Delespaux, 2002, Mugrmieri, 2003). The disadvantage is that further studies are required to confirm the corrélation between protection against tsetse challenge with varions trypanosome populations and the isometamidium chloride concentration in the sérum. It is not yet possible to draw firm conclusions on the sensitivity or résistance of a trypanosome population at the level of the individual animal. The ELISA should, however, give some indication of the résistance situation at the level of the herd. A further disadvantage is that, while the ELISA may indicate the level of drug withstood by a trypanosome population, it does not provide information about the level required for protection.

Instituut voor Tropische Geneeshmde Antwerpen - Université Libre de Bruxelles - International Livestock Research Institute Financed by Het Fonds voor Wetenchappelijk Onderzoek Vlaanderen - Research Foundation Flanders

41

Introduction 1.5.5. Longitudinal parasitological data Longitudinal parasitological data can be used to detect therapeutic failures, although their use is not suitable as a routine test. Rowlands et al. (1993) showed that the application of a computer model to parasitological data collected over a long period on a monthly basis allowed the incidence of new infections to be distinguished ffom récurrent infections. This analysis showed that the prevalence of diminazenetherapeutic failures in the Ghibe valley, Ethiopia, increased from 6 percent in 1986 to 14 percent in 1989. The advantage of these kinds of data is of course that they are directly applicable to the field. The disadvantages, however, are that: 1) The true prevalence of drug-resistant infections seems to be underestimated. 2) It is rétrospective by at least six months. 3) The technique is quite expensive, if a longitudinal study is not carried out for other purposes (Maniman, 1996). More recently, Eisler et al. (2000), designed a protocol for a rapid assessment of trypanocidal drug therapeutic failure in the field by block treating a sentinel and a treatment group (30 to 80 cattle) and comparing the svuwivor function of the two groups. This method provides information on the tsetse challenge and thus the opportunity of chemoprophylaxis and on the therapeutic failure situation within a period of 8 weeks of observation. 1.5.6. Early diagnosis of treatment failure Polymerase chain reaction was recently used as a method to detect treatment failures after two weeks only (Gall et al., 2004). PCR was three-four times more sensitive and better at species identification, than standard microscopie examination. 1.5.7. New tests for détection of résistance to isometamidium The diagnosis of trypanocidal résistance has been simplified and standardised (Eisler et al, 2001) but the test must still be performed either in mice or in cattle. The tests Instituut voor Tropische Geneeskunde Antwerpen - Université Libre de Bruxelles - International Livestock Research Institute Financed by Met Fonds voor Wetenchappelijk Onderzoek Vlaanderen - Research Foundation Flanders

42

Introduction can be conducted also after growing the trypanosomes in vitro. Since both in vivo and in vitro tests for the détection of trypanocidal drug résistance are laborious and time consuming, new diagnostic methods for the détection of drug résistance are urgently needed. A polymerase chain reaction (PCR)-based test could provide a rapid and convenient tool, suitable for large-scale herds’ surveys of livestock. The development of such a test requires the identification of genetic mutations associated with isometamidium résistance in livestock-infective trypanosomes. The trypanosomes infective only to livestock in Africa hâve not been as well studied at the molecular level as those that are infective to humans. Consequently, little is known about the genome of T.congolense, the trypanosome in which trypanocide résistance has been well documented. To detect genetic alterations that may be associated with résistance to isometamidium chloride, the method to be used should require no prior knowledge of the sequences of any spécifie genes that may be involved. Amplified fragment-length polymorphism (AFLP) (Lienert et ai, 1993; Vos et al, 1995) is a fingerprinting technology that is based on the sélective amplification of a subset of genomic restriction fragments using PCR (Figure 11).

Instituut voor Tropische Geneeskunde Antwerpen - Université Libre de Bruxelles - International Livestock Research Institute Financed by Het Fonds voor Wetenchappelijk Onderzoek Vlaanderen - Research Foundation Flanders

43

Introduction Figure 11 Example of the standard ÂFLP® procedure (Invitrogen life technologies copyright)

6AATTC CTTAAQ

5’

TTAA---------- ^ ■AATT---------- 5*

'' AATTC----------------

Q------------

•T AAT

*Ecoft I adaptor Mse I adaptor

TTAAf I adai^er

nA|l23 Afetft adapter

S!—--------^

NTTAI----- 1

■MAA-rl

^ÉI^AAQ^

>

C----------- g

preselective ampification wkh FcoRI priner Mso I primer -tC

" g—-----------AA AATTC— TTAAQ—

—QTTAI

I

—CAATI

I

AAC---------g sélective ampliTication \vhh £coR\ prtmer4-2 Ms» I primer

AATTCAA------------------------^TTQTTAtHZl TTAAQTT------------------------ AACAAT^3

denaturing poiyacrylamide gel electrophoresis dZi Ms» I adapter sequences 1 i £ooRIadc^ter sec^nces

Deoxyribonucleic acid (DNA) is first digested with restriction enzymes selected on the basis of the expected genomic complexity of the organism to be analysed. The restriction enzymes used in the analysis will influence the number of bands détectable in the fmgerprint, depending on the occurrence of their respective récognition sequences. AFLP technology requires no sequence information or probe collections

Insiituut voor Tropische Geneeskimde Antwerpen - Université Libre de Bruxelles - International Livestock Research Institute Financed by Het Fonds voor Wetenchappelijk Onderzoek Flaanderen - Research Foundation Flanders

44

Introduction prior to the génération of the fmgerprints. This is of particular benefit when studying organisms where little DNA sequence information is available in the existing databases as is the case for T. congolense. AFLP is widely used in plant genetics but has only recently been applied for genetic analysis of trypanosome populations (Tait et al, 2002; Agbo et al., 2002) or for phylogenetic studies (Claes et al., 2003). AFLP was here used to compare the genome of two isogenic clones of T. congolense, in order to search for mutation(s) that might be responsible for résistance to isometamidium chloride. Results are presented in the next chapter.

Instituut voor Tropische Geneeskunde Antwerpen - Université Libre de Bruxelles - International Livestock Research Institute Financed by Het Fonds voor Wetenchappelijk Onderzoek VJaanderen - Research Foundation Flanders

45

Results

2. Results

Diseuse prevalence and drug résistance

Instituut voor Tropische Geneeskunde Antwerpen - Université Libre de Bruxelles - International Livestock Research Jnstitute Financed by Met Fonds voor Wetenchappelijk Onderzoek Vlaanderen - Research Foundation Flanders

46

Results

2.1. Disease prevalence and drug résistance Sinyangwe L‘, Delespaux V‘, Brandt J, Geerts S, Mubanga J, Machila N, Holmes PH, Eisler MC. 2004. Trypanocidal drug résistance in eastem province of Zambia. Veterinary Parasitology 119: 125-135. ' L. Sinyangwe and V. Delespaux contributed equally to this study as co-first authors

2.1.1. Spécifie objective of this chapter The aim of this chapter is to provide a picture of the trypanosomosis and drug résistance prevalence in Eastem Province of Zambia and to understand the underlying factors of dmg résistance (drug use habits).

2.1.2. Introduction A survey to investigate résistance to dmgs used in the treatment of bovine trypanosomosis was conducted in the Eastem Province of Zambia between 1996 and 1998. A cross-sectional study was conducted in three districts (Petauke, Katete, Lundazi) at 34 village sampling sites selected at random ffom villages that had shown greater than 6% prevalence of bovine trypanosomosis during an earlier survey. A longitudinal study was conducted in same three districts over a one-year period. The study sites were chosen from the cross-sectional study and included eight sites showing high trypanosomosis prevalence and where no control activities were recorded. Use was made of parasitological methods, tests of dmg résistance in cattle and mice and isometamidium-ELISA. Overall mean prevalence of trypanosomosis was 14.4%, with 96% of infections caused by T. congolense. The remainder was caused by T. vivax (2%) and T. brucei (2%). Tests in mice showed that of the stabilates collected, 24 (34%) were résistant to only isometamidium chloride, 8 (11.3%) were résistant to only diminazene aceturate, 1 (1.4%) was résistant to both drugs, and 38 (53.5%) were sensitive to both dmgs. At least two out of 27 stabilates tested in cattle appeared to be résistant to trypanocidal dmgs, one to isometamidium and one to diminazene. Isometamidium could be detected in only sixty-three (4.1 %) of 1526 sérum samples from cattle in the study. Only 6 (2.8%) of 212 semm samples from trypanosome-infected cattle had sérum levels of the dmg above 0.4 ng isometamidium per ml sérum which is indicative for dmg résistance in the infecting parasite population. Although some dmg résistance is apparent, diminazene aceturate and isometamidium chloride can still be expected to be effective as a sanative pair in Instiluut voor Tropische Geneeskunde Antwerpen - Université Libre de Bruxelles - International Livestock Research Institute Financedby Het Fonds voor Wetenchappelijk Onderzoek Vlaanderen - Research Foundation Flanders

47

Results this area in most cases, since no more than one stabilate of 71 investigated showed evidence of résistance to both drugs

2.1.3. Prevalence of bovine trypanosomosis During the cross-sectional study, 1597 cattle over six months of âge were sampled at 34 randomly selected sampling sites. Trypanosome infections were found in cattle in 25 (74%) sampling sites (Figure 12).

Figure 12 Trypanosome prevalence in cattle in Petauke, Katete and Lundazi Districts, Eastern Province, Zambia.

Prevalence in individual villages varied between 0 and 64%. Overall mean prevalence was 14.4%, with 96% of infections caused by T. congolense. The remainder was caused by T. vivax (2%) and T. brucei (2%). There were highly significant différences among the three districts in terms of trypanosome infection prevalence in the study villages (x^ = 142, d.f = 2; P < 0.001). Villages in Petauke District (n = 17) had the highest mean prevalence (24.6%), Lundazi villages (n = 10) had the lowest mean prevalence (0.8%), while the Katete villages (n = 7) were intermediate with a mean prevalence of 10.4%. Instituut voor Tropische Geneeskmde Antwerpen - Université Libre de Bruxelles - International Livestock Research Institute Financed by Met Fonds voor Wetenchappelijk Onderzoek Vlaanderen - Research Foundation Flanders

48

Results The parasitological and trypanosome antibody-ELISA results for the six villages in the longitudinal study in Katete and Petauke Districts hâve been reported elsewhere (Machila et al, 2001). In both of the two villages in Lundazi District, trypanosome prevalence was 0% at two visits (April and August 1998) and between 2.3 and 6% at two other visits (February and June 1998). Hence, parasitological prevalence of trypanosomosis varied widely between the eight villages and between visits. Overall, 5 villages (2 each in Katete and Lundazi Districts, 1 in Petauke District) had a minimum prevalence of 0%, and a maximum prevalence not greater than 6%. Three villages (1 in Katete District and 2 in Petauke District) had maximum prevalences between 20 and 30% and minimum prevalences between 2 and 5%. There was no particular season of peak prevalence, which was unpredictable.

2.1.4. Investigation of trypanocidal drug résistance in mice Seventy-one T. congolense stabilates collected during these studies were tested for sensitivity to isometamidium chloride and diminazene aceturate in mice. Using discriminatory doses of 1.0 mg/kg b.w isometamidium chloride and 20 mg/kg b.w diminazene aceturate, 38 (53.5%) were sensitive to both drugs, 24 (34%) were résistant to only isometamidium, 8 (11.3%) were résistant to only diminazene aceturate and 1 (1.4%) was résistant to both drugs. The géographie locations of villages from which evidence of drug résistance was obtained in mice are shown in Figure 13.

InstUuut voor Tropische Geneeskunde Antwerpen - Université Libre de Bruxelles - International Livestock Research Institute Financed byHet Fonds voor Wetenchappelijk Onderzoek Vlaanderen - Research Foundation Flanders

49

Results

Trypanocidal Drug Résistance in Eastern Province, Zambie

Figure 13 Géographie locations of villages from which evidence of drug résistance was obtained in mice

2.1.5. Investigation of trypanocidal drug résistance in calves Twenty-seven T. congolense stabilates were tested for drug sensitivity in 12 calves. Six pools of 3, 4 or 5 stabilates, each pool comprising stabilates from a single village in either Katete District (Kapeya village, 5 stabilates) or Petauke District (Njeleweka and Chipika villages, each 3 stabilates), 2 pools of 4 stabilates and one pool of 5 stabilates) were tested in 6 calves. Five of these calves were treated with diminazene aceturate at the first peak of parasitaemia. The sixth calf was treated with isometamidium chloride. One relapse infection was detected 100 days after diminazene treatment of a calf inoculated with a pool of three stabilates from Njeleweka village, Petauke District. No relapse infection was detected in this calf, after re-treatment one week later with isometamidium chloride, nor in any of the other five calves. Three further stabilates from Petauke District were each tested in two calves. No relapse infection was detected in the three calves treated with diminazene aceturate. One relapse infection was detected 57 days after treatment with

Instituut voor Tropische Geneeskunde Antwerpen - Université Libre de Bruxelles - International Livestock Research Institute Financed by Met Fonds voor Wetenchappelijk Onderzoek Vlaanderen - Research Foundation Flanders

50

Results isometamidium chloride in a calf infected with a stabilate from Njeleweka village. Relapse infection was not detected in the other two isometamidium-treated calves.

2.1.6. Investigations using isometamidium-ELISA Isometamidium-ELISA results were available for 1526 senun samples ffom cattle in the cross-sectional study. Sixty-three (4.1 %) of these sérum samples contained levels of isometamidium higher than 0.4 ng/ml. The geographical distribution of cattle with isometamidium concentrations above 0.4ng/ml in the varions study villages is shown in Figure 14.

Figure 14 Percentage of cattle in Petauke, Katete and Lundazi Districts, Eastern Province, Zambia treated with isometamidium chloride

Isometamidium concentrations exceeding 0.4 ng/ml in trypanosome-infected cattle were considered to provide evidence of drug résistance in the infecting parasite population (Eisler et al, 1997). Trypanosome infections were detected in 212 (13.9%) of the 1526 animais tested for sérum isometamidium. Of these 212 infected cattle,

Instituut voor Tropische Geneeskunde Antwerpen - Université Libre de Bruxelles - International Livestock Research Institute Financed by Met Fonds voor Wetenchappelijk Onderzoek Vlaanderen Research Foundation Flanders

51

Results only 6 (2.8%) had sérum levais of the drug above this concentration. There was no significant différence (x^ = 0.609, d.f. = 1; P = 0.435) between the proportions of male (4.5%) and female (3.7%) cattle treated with isometamidium, nor (x^ = 1.99, d.f. = 1; P = 0.159) between cattle aged less than 2 years (2.4%) and those older than 2 years of âge (2.4%). The différences in treatment rates among the three districts were significant (x^ = 12.4, d.f. = 2; P < 0.01), with relatively fewer cattle Avith evidence of isometamidium treatment in Lundazi District (1.9%) than in Petauke District (4.3%) and relatively more in Katete District (7.0%).

2.1.7. Summarized data per district In Table 2 is shown the summarized data for the three district showing that drug résistance was observed, as expected, where the disease prevalence and the drug use were higher.

District

Petauke

,

...........................Jl H,.

Disease prevalence

.

.1

I*-

.-..J.».....

24,6%

' % of villages with |53% ! ■ résistance observed

■

Lundazi

Katete El’ 10,4%

% of the cattle

l 4,3%

. ■

% W-

0%

■■■'

im

.

■

■ A

0,8%

,•

lÈ*'

'

... .

W 7%

'

■ ■■ .

-

•'W

■

■

: 1,9%

treated with ISMM Table 2 For the three districts: disease prevalence, percentage of villages where drug résistance was observed and percentage of the cattle found with ISMM concentration higher than 0,4 ng/ml in their sérum.

Instituut voor Tropische Geneeskunde Antwerpen - Université Libre de Bruxelles - International Livestock Research Institute Financed by Het Fonds voor Wetenchappelijk Onderzoek Vlaanderen - Research Foundation Flanders

52

Results

Drug use

Instituut voor Tropische Geneeskunde Antwerpen - Université Libre de Bruxelles - International Livestock Research Institute Financed by Het Fonds voor Wetenchappelijk Onderzoek Vlaanderen - Research Foundation Flanders

53

Results

2.2. Drug use Delespaux V. 2000. Drug Deliveiy System of trypanocides in Eastem Province of Zambia. I C P T V Newsletter 2:p. 29. Delespaux V, Geerts S, Brandt J, Elyn R, Eisler MC. 2002. Monitoring the correct use of isometamidium by farmers and veterinary assistants in Eastem Province of Zambia using the isometamidium-ELISA. Veterinary Parasitology 110:pp. 117-122.

2.2.1. Spécifie objective of this chapter The aim of this chapter is to describe and to comment underlying factors that could explain the observed cases of drug résistance (drug use habits).

2.2.2. Introduction A survey to monitor the use of trypanocidal drugs by cattle breeders was conducted in Zambia. Use was made of a questionnaire and of the isometamidium-ELISA technique. One hundred and twenty two farmers and fifty veterinary assistants were interviewed. The isometamidium-ELISA was used to monitor the isometamidium sérum concentration in 72 cattle one-week after unsupervised treatment by 56 farmers and 16 veterinary assistants. Although there was no clear indication of imderestimation of the weight of the animais and although farmers had adéquate knowledge of the correct usage of isometamidium, the results suggest frequent underdosing when considering isometamidium sérum concentrations one week after treatment. In 76% of the cases, the expected protection period was equal or shorter than 28 days and equal or shorter than 33 days in 90% of the treated cattle.

2.2.3. Questionnaire The following results were obtained by interviewing one hundred and twenty-two farmers (71%) and fifty veterinary assistants (29%). Ail of them knew the adéquate volume of water to add to a one-gram package of isometamidium (40ml) as well as the dose to treat an animal of 250-kg (5-ml). AU veterinary assistants and 76% of the farmers checked the expiry date of the package before use. The remaining 24 % of the farmers trusted the veterinary assistant about the quality of the drug. AU farmers bought isometamidium from veterinary assistants or directly from the Veterinary Offices. Veterinary assistants did buy from the Veterinary Offices. Veterinary Offices were supplied by the Drug Delivery System, the drug-marketing network created by the ASVEZA-East project. There was a clear corrélation (* P< 0.05) between the

Instituut voor Tropische Geneeskunde Antwerpen - Université Libre de Bruxelles - International Livestock Research Institute Financed by Het Fonds voor Wetenchappelijk Onderzoek Vlaanderen - Research Foundation Flanders

54

Results trypanocidal drug sales data and the results of the survey about the seasonality of drug use (Figure 15 and Table 3).

Figure 15 Expected répartition of isometamidium treatments from the sales of the Drug Delivery System and results of the survey. Eastern Zambia, 1997

Jan-Mar

3

Questionnaire

,

' J16

Expected from sales X' = 7.37

Apr-Junji

Jul-Sept

59

48

70

39

1

129 . j

i

■

L.______ _

Critical chi-square value = 7.81 with 3 df and p

0.05

Oct-Dec ,

Total

123 109

346

rz:

Table 3 Répartition of isometamidium treatments. Answers to questionnaire and expected répartition from the sales of the Drug Delivery System. Eastern Zambia, 1997.

The period of highest trypanocide use coincided with the end of the dry season when the highest morbidity due to trypanosome infections is expected (Van den Bossche et ai, 2000) and with the harvest of the first crops of the year increasing the available cash money of the cattle owners. Table 4 summarises the frequency of isometamidium treatments per animal per year. 51.7% (89) of the cattle breeders reported one isometamidium treatment per year, whereas 15.1% (26), 13.3% (23) and 19.7% (34) reported respectively two, three and Instituut voor Tropische Geneeskunde Antwerpen - Université Libre de Bruxelles - International Livestock Research Institute Financed by Het Fonds voor Wetenchappelijk Onderzoek Vlaanderen - Research Foundation Flanders

55

Results four treatments per year. No statistical différence (* P< 0.05) was found between the veterinary assistants and the farmers.

Questionnaire

Number of treatments

I

.2

67 Ji-z J Veterinary assistants 22

.,3

5

8

?■

Number of treatments

T’-l -'■ -"-i ''Farmeî-^

* '*‘63

Veterinary assistants ... ■ -y

1

.... -5

26 ‘ 89

Total

ïw

■8> riôii U Expected

4

2

3

50

15 34 4

ÿ: 122;,;.:

■ feSSi Total

rrsi' 16 . ■24-f ■"‘.'T2? ' ; 8

7

10

Wi- 23

50 172

X^ = 6.15

, Critical'chi-sqiiara valu

Table 4 Frequency of isometamidium treatments per animal per year by farmers and veterinary assistants: Eastern Zambia, 1997.

Of the 122 farmers, ail treating their animais themselves, 70% did so without any parasitological or clinical diagnosis by a veterinary assistant. According to 88% (108) of the interviewed farmers, the price and the commercial présentation of isometamidium in one-gram packages containing eight standard cattle doses are major constraints to the use of this drug. Veterinary assistants did not perceive the one-gram package as a constraint. Ninety-percent (110) of the farmers using isometamidium tried to recruit other farmers to share the remainder of a partly used package. Drug-sharing farmers (90%) did pay either by the number of animais treated (57%) or by the number of millilitres injected (43%). Only five-percent (6) of ail farmers either treated their entire herd with isometamidium or kept the drug for their own use at a later date. The water used to dilute the drugs originated ffom wells or streams and was boiled by 66% (114) of the cattle breeders. Needles were not easily available and were used until completely wom out. They were boiled by only 23% of the cattle breeders (39).

Instituut voor Tropische Geneeskunde Antwerpen - Université Libre de Bruxelles - International Livestock Research Institute Financed by Het Fonds voor Wetenchappelijk Onderzoek Vlaanderen - Research Foundation Flanders

56

Results 2.2.4. Cattle bodyweight estimation The weight of 83 cattle in this trial, estimated using the weigh-band, varied from 100 to 500 kg. Incorrect estimation of bodyweight of this cattle by farmers did not appear to be a major problem for drug dose calculation, since it was correct to within 15% of the value obtained using a weigh-band in 75% of cases. Linear régression analysis showed that 78.3% of the variance of the estimated weight was due to the measured weight (r^= 0.7833) when disregarding weight overestimation which has no influence on drug résistance (Figure 16). Figure 16 Farmers estimâtes of bodyweight and measured bodyweight in cattle. Eastern Zambia, 1997.

♦ Estimated/Measured----- Régression line

Instituut voor Tropische Geneeskunde Antwerpen - Université Libre de Bruxelles - Iniemationaî Livestock Research Institute Financed by Het Fonds voor Wetenchappelijk Onderzoek Vlaanderen - Research Foundation Flanders

57

Results

2.2.5. Sérum isometamidium concentration Isometamidium concentrations in the sérum of 72 cattle seven days after unsupervised treatment varied from 0.4 to 6.0 ng/ml. When considering the pharmacokinetics of isometamidium chloride, the expected concentration seven days post treatment is of 5ng/ml (Bos Indicus) (Eisler et al., 1996).

In 76% of the cases, the expected protection period was equal or shorter than 28 days and equal or shorter than 33 days in 90% of the treated cattle (Table 5).

Table 5 Measured isometamidium sérum concentration ranges seven days after treatment and « (In Co protection period extrapolated from the équation of the exponential curve: y — c 0.0335 x)

Isometamidium

Expected protection

% of the

concentrations *

period

samples

■r- ■fçd.ys), ; 5.01 - 6

^

; (i=72)'

42

3

37

4

' ■ ■

4.01- 5^e« 3.01 - 4

Trm

2.01-3 1.01-2

I"

0.41-T'

28

29

“' , Tanzania

Lion j Lion

1 CIRDES ^

SA95

CIRDES

’Karan

ITM

Djuma

ITM

PA87

1 CIRDES

PA77

CIRDES

GUTR28 «

-

GUTR37

fLion7"^'' ...... ——^ IL 1180

Tanzahia

1 Provided bÿ^ ITM

j;SA268

Burkina Faso

L Gambia

T.congolense mxmhcx ot

code Dind

IL 3343

'

j ILRAD^-, ILRAD

rïLRi"®-'"""^;—^

“

IILRJ

ILRI

Uganda

Cattle

EATR01157

ITM

Zambia

Cattle

1 TRTx**(n=l9)

ITM

Zambia Zambia Zambia

Cattle ^

■

' -

1 IL 1Ï80 rS5

--A

.

J4J4

ITM

j Cattle

JM158

ITM

Cattle

JM210

in, ■„

ITM

^'^Institute of Tropical Medicine of Antwerp, Centre International de Recherche - Développement sur l'Elevage en zone Subhumide, International Laboratory for Research on Animal Diseases, International Livestock Research Institute. X for any number, Démocratie Republic of the Congo.

The parent clone ILl 180 and the résistant dérivative IL3343 were grown in mature rats by injecting approximately 10^ trypanosomes intra-peritoneally into each rat. At the first peak of parasitaemia, the rats were euthanized, and the blood collected with anticoagulant. The trypanosomes were separated from the blood éléments by centrifugation in Percoll gradients (Grab and Bwayo, 1982) followed by chromatography on a column of DE-52 (Lanham and Godffey, 1970). The purified trypanosomes were washed with 15 ml of phosphate buffered saline-glucose (PSG) pH 8.0, and then pelleted by centrifugation. The pellet was used immediately for the préparation of DNA following routine procedures (Sambrook et al., 1989). Cryostabilates of T.congolense field strains of trypanosomes were reactivated by intraperitoneal injection in mice. At first peak of parasitaemia, the mice were euthanized, and the blood collected with anticoagulant. The DNA was then extracted using the QIAamp® DNA Blood Midi Kit. The PCR-RFLP technique using the SsuInstituut voor Tropische Geneeskunde Antwerpen - Université Libre de Bruxelles - International Livestock Research Institute Financed by Het Fonds voor Wetenchappelijk Ondenoek Vlaanderen - Research Foundation Flanders

112

Materials and methods rDNA (small subunit of the ribosomal DNA) amplification (Geysen et al, 2003; Delespaux et al, 2003) was used to differentiate the savannah from the riverine/forest type of the T.congolense isolâtes. 4.5.2. AFLP AFLP was performed using the commercial kit AFLP Analysis System II ® (Gibco BRL™ - Life Technologies™, U.S.A.) according to the instructions of the supplier with the standard EcoR 1 and Mse I restriction enzymes. The kit includes 8 EcoR I primers containing a common segment (5’GAG TGC GTA CCA ATT C) combined with 8 different sélective nucléotide sequences (AA, AC, AG, AT, TA, TC, TG, TT) and 8 Mse / primers containing a common segment (5’GAT GAG TCC TGA GTA A) with 8 sélective nucléotide sequences (CAA, CAC, CAG, CAT, CTA, CTC, CTG, CTT). Primers used in the sélective AFLP amplification were labelled with [y-33P] ATP. The sixty-four possible primer combinations were used in the sélective amplification of DNA from the trypanosomes. The entire experiment was performed in duplicate to control the repeatability of the band pattern. 4.5.3. Polyacrylamide Gel Electrophoresis (PAGE) After PCR amplification, an equal volume (20pl) of formamide dye (95% formamide, lOmM NaOH, 0.05% bromophenol blue, 0.05% Xylene cyanol) was added to each reaction. The samples were heated at 95°C for 5 minutes and immediately chilled on ice. These were subsequently resolved by electrophoresis under denaturing conditions in a 6% polyacrylamide gel. After electrophoresis, the gel was fixed for 5 minutes in a solution containing 80% distilled water, 10% methanol and 10% acetic acid, then transferred to a filter paper and vacuum-dried for two hours. The filter paper was exposed to an x-ray film (Kodak® SB) for 72 hours at room température, for autoradiography.

Instituut voor Tropische Geneeshmde Antwerpen - Université Libre de Bruxelles - International Livestock Research Institute Financed by Het Fonds voor Wetenchappelijk Onderzoek Vlaanderen - Research Foundation Flanders

113

Materials and methods

4.5.4. DNA extraction from the polyacrylamide gel A portion of filter paper containing the DNA fragment of interest was eut out with a scalpel blade and placed in an Eppendorf tube with 500pl milliQ water, then gently agitated for 30 minutes at 56°C to elute the DNA from the paper. 4.5.5. PCR amplification of the purified fragments of DNA Standard PCR amplifications were conducted on 5 pi DNA eluate in 20 pl solution containing 50mM KCl, lOmM Tris-HCl (pH 8.3), 1.5mM MgC12, 200pM of each dNTP, 20 pmoles of each primer and 0.5 U Taq polymerase (Goldstar, Eurogentec™). The reaction mixture was overlaid with 50-pl fine neutral minerai oil (Sigma) and placed in a heating block of a programmable thermocycler (PTC-100 TM, M.J. Research Inc.). After a dénaturation step of 4 minutes at 94°C, each of the 40 cycles consisted of sequential steps of 30sec at 94°C, 45sec at 56°C and 60sec at 72°C. A 5pl volume of each sample was electrophoresed in a 2% agarose gel for 20min and stained with ethidium bromide for 30min before photography. 4.5.6. Cloning and sequencing The PCR Products were cloned using the Topo-cloning® kit (Invitrogen’’'"'^, Carlsbad CA, USA), exactly as described by the manufacturer. The recombinant plasmids containing the desired inserts were purified and their inserts completely sequenced using the Model 377-XL Sequencer (PE-Applied Biosystems, Eurogentec® Belgium). 4.5.7. DNA amplification of field strains A GAA test amplification assay was developed (Figure 37, page 82) and used to screen field strains which were characterized for isometamidium chloride résistance with the single dose mouse test. Standard PCR amplifications were carried out in 25pl reaction mixtures containing 5 pl DNA sample (at 10 ng pl-1 in case of référencé DNA samples), 50 mM KCl, 10 mM Tris-HCl (pH 8.3), 1.5 mM MgC12, 200 pM of each dNTP, 20 pmoles of each primer, 0.5 U Taq polymerase enzyme (Goldstar, Eurogentec™). The reaction mixture was overlaid by 50 pl fine neutral minerai oil (Sigma™) and placed on a heating block of a programmable thermocycler (PTC-100 TM, M.J. Research Inc.). After a dénaturation step of 4 minutes at 94°C each of the 40 cycles consisted of 30sec at 94°C, 45sec at 58°C and 60sec at 72°C. A 5 pl volume

Instituut voor Tropische Geneeskunde Antwerpen - Université Libre de Bnaelles - International Livestock Research Institute Financed by Het Fonds voor Wetenchappeîijk Onderzoek Vlaanderen - Research Foundation Flanders

114

Materials and methods

of each sample was electrophoresed in a 2% agarose gel for 20minutes and stained with ethidium bromide for SOminutes. 4.5.8. Primers The primers were designed using the Gene-Jockey II and Amplify (Engels, 1993) computer programmes on contigs of sequences available in the GenBank and neighbouring the AFLP fragment E6M6.1. The expected size of the GA A test amplicon was 381 base pairs and 383 base pairs for the sensitive and the résistant strains respectively, when using the forward E6M6.1F (TTTCTAAAACAGGTGGAGGG) and the reverse E6M6.1R (CTTGGAACGTAATCCAAGGC) primers. 4.5.9. Restriction Fragment Length Polymorphism The GAA test amplicons were digested with MboII in NEB buffer 2 with bovine sérum albiunin according to the manufacturer’s spécifications (MBI Fermentas™, Lithuania) using 10 units pg’l DNA (0.6 U pl'l PCR product) on 6 pl of amplified DNA in 15 pl total volume. The reaction was left ovemight in a water bath at the specified température. Four pl of digested sample mixed with 2 pl loading buffer was transferred onto a 10% polyacrylamide gel together with a lOObase pairs DNA ladder (MBI Fermentas, Lithuania) for fragment size détermination. DNA fragments were separated by electrophoresis in 0.5x TBE buffer at 100 V for 2.5 hrs. The gel was stained using a commercial silver staining kit (Silver staining kit DNA plusone, Pharmacia Biotech, Uppsala, Sweden) and mounted for storage. 4.5.10. Single dose mouse test The trypanosome isolâtes were tested in mice for sensitivity or résistance to isometamidium chloride (Img/kg) using the standardized protocol described by Eisler étal (2001).

Instituut voor Tropische Geneeskunde Antwerpen - Université Libre de Bruxelles - International Livestock Research Institute Financed by Het Fonds voor Wetenchappelijk Onderzoek Vlaanderen - Research Foundation Flanders

115

References

5. References

1. Abdel Gadir F, Os man OM, Abdella HS and Abdel Razig MT. Ethidium bromide-resistant trypanosomes in Southern Darfur. Sudan Journal of Veterinary Research 3: 63-65, 1981. 2. Aerts D and Truc P. A kit for in vitro isolation of trypanosomes in the field: first trial with sleeping sickness patients in the Congo Republic. Trans R Soc Trop Med Hyg 86: 394-395,1992. 3. Afewerk Y, Cl ausen PH, Abebe G, Tilahun G and Mehlitz D. Multipledrug résistant Trypanosoma congolense populations in village cattle of Metekel district, north-west Ethiopia. Acta Tropica 76: 231-238,2000. 4. Agbo EE, Majiwa PA, Claassen HJ and te -Pas MF. Molecular variation of Trypanosoma brucei subspecies as revealed by AFLP fingerprinting. Parasitology 124: 349-358, 2002. 5. Ainanshe OA, Jenni ngs FW and Holmes PH. Isolation of drug-resistant strains of Trypanosoma congolense from the lower Shabelle région of Southern Somalia. TropAnim Health Prod 24: 65-73, 1992. 6. Al Qarawi AA, Omar HM, Abdel-Rahman HA, El Mougy SA and El Belely MS. Trypanosomiasis-induced infertility in dromedary (Camelus dromedarius) bulls: changes in plasma steroids concentration and semen characteristics. Anim Reprod Sci 84: 73-82,2004. 7. Ancelle T, Pauga m A, Bourlioux F, Merad A and Vigier JP. Détection des trypanosomes dans le sang par la technique du Quantitative Buffy Coat (QBC): évaluation experimentale. [Détection of trypanosomes in blood by the Quantitative Buffy Coat (QBC) technique: experimental évaluation]. Med Trop (Mars ) 57: 245-248, 1997. 8. Anjard C and Loomis WF . Evolutionary analyses of ABC transportera of Dictyostelium discoideum. Eukaryotic Cell 1: 643-652, 2002. Instituut yoor Tropische Geneeskunde Antwerpen - Université Libre de Bruxelles - International Livestock Research Institute Financed by Het Fonds voor Wetenchappelijk Onderzoek Vlaanderen - Research Foundation Flanders

116

Référencés

9.

Ardelli BF and Woo PT K. The in vitro effects of isometamidium chloride (Samorin) on the piscine hemoflagellate Cryptobia salmositica (Kinetoplastida, Bodonina). Journal ofParasitology 87: 194-202, 2001.

10. Assefa E and Abebe G . Drug-resistant Trypanosoma congolense in naturally infected donkeys in north Omo Zone, Southern Ethiopia. Vet Parasitol 99: 261-271,2001. 11. Authie E, Muteti DK a nd Williams DJ. Antibody responses to invariant antigens of Trypanosoma congolense in cattle of differing susceptibility to trypanosomiasis. Parasite Immunol 15: 101-111,1993. 12. Azando E . Etude de la validation de la PCR-RPLP dans le diagnostic de la trypanosomose bovine au Bénin. ITMA MSe Thesis 108: 1-46,2002. 13. Babiker HA, Pringle SJ, Abdel -Muhsin A, Mackinnon M, Hunt P and Walliker D. High-level chloroquine résistance in sudanese isolâtes of Plasmodium falciparum is associated with mutations in the chloroquine résistance transporter gene pfert and the multidrug résistance gene pfmdrl. Journal ofInfectious Diseases 183: 1535-1538,2001. 14. Bailey JW and Smith DH . The use of the acridine orange QBC technique in the diagnosis of African trypanosomiasis. Trans R Soc Trop Med Hyg 86: 630, 1992. 15. Bannai H, Sakurai T, Inoue N, Sugimoto C and Igarashi I. Cloning and expression of mitochondrial beat shock protein 70 of Trypanosoma congolense and potential use as a diagnostic antigen. Clin Diagn Lab Immunol 10: 926933,2003. 16. Basselin M, Denise H, Coo mbs GH and Barrett MP. Résistance to pentamidine in Leishmania mexicana involves exclusion of the drug ffom the mitochondrion. Antimicrobial Agents and Chemotherapy 46: 3731-3738,

2002.

Instituut voor Tropische Geneeskunde Antwerpen - Université Libre de Bruxelles - International Livestock Research Institute Financed by Het Fonds voor Wetenchappelijk Onderzoek Vlaanderen ~ Research Foundation Flanders

117

Référencés

17. Berger B J, Ca rter NS and Fairlamb AH. Polyamine and Pentamidine Metabolism in African Trypanosomes. Acta Tropica 54: 215-224, 1993. 18. Boibessot I, Turner CM, Watson DG, Goldie E, Connel G, Mcintosh A, Grant MH and Skellern GG. Metabolism and distribution of phenanthridine trypanocides in Trypanosoma brucei. Acta Trop 84: 219-228, 2002. 19. Boulange A, Katende J and Authie E. Trypanosoma congolense: expression of a beat shock protein 70 and initial évaluation as a diagnostic antigen for bovine trypanosomosis. Exp Parasitai 100: 6-11, 2002. 20. Burri C, Onyango JD, Auma JE, Burudi EME and Brun R. Pharmacokinetics of Melarsoprol in Uninfected Vervet Monkeys. Acta Tropica 58: 35-49, 1994. 21. Buza J and Naessens J. Trypanosome non-specific IgM antibodies detected in sérum of Trypanosoma congolense-infected cattle are polyreactive. Vet Immunol Immunopathol 69: 1-9,1999. 22. Carte r NS and Fairlamb AH. Arsenical-Resistant Trypanosomes Lack An Unusual Adenosine Transporter. Abjure 361: 173-176, 1993. 23. Cavalcanti D, Gui marâes PL, Fragoso SP, De Souza W, Goldenberg S and Motta MCM. The effect of toposiomerase II inhibitors on the kinetoplast ultrastructure of some trypanosomatids. Acta Microscopica 12 : 217-218, 2003. 24. Chitambo H and Arakawa A . Trypanosoma congolense: manifestation of résistance to Berenil and Samorin in cloned trypanosomes isolated from Zambian cattle. Zentralbl Bakteriol 277: 371-381, 1992. 25. Claes F, Agbo EC, Radwanska M, te-Pas MF, Baltz T, De Waal DT, Goddeeris BM, Claassen E and Buscher P. How does Trypanosoma equiperdum fit into the Trypanozoon group? A cluster analysis by RAPD and multiplex-endonuclease genotyping approach. Parasitology 126: 425-431, 2003. Instituut voor Tropische Geneeskxmde Antwerpen - Université Libre de Bruxelles ~ International Livestock Research Institute Financed by Met Fonds voor Wetenchappelijk Onderzoek Vlaanderen - Research Foundation Flanders

118

Référencés 26. Clausen PH, Sidibe I, Kabore I and Bauer B . Development of MultipleDrug Résistance of Trypanosoma-Congolense in Zebu Cattle Under High Natural Tsetse-Fly Challenge in the Pastoral Zone of Samorogouan, BurkinaFaso,

Tropica 51: 229-236, 1992.

27. Codjia V, Mulatu W, Majiwa PA, Leak SG, Ro wlands GJ, Authie E, d'Ieteren GD and Peregrine AS. Epidemiology of bovine trypanosomiasis in the Ghibe valley, Southwest Ethiopia. Occurrence of populations of Trypanosoma congolense résistant to diminazene, isometamidium and homidium.

Trop 53: 151-163, 1993.

28. Das A, Dasgupta A, Sengupta T and Majumder HK. Topoisomerases of kinetoplastid parasites as potential chemotherapeutic targets. Trends Parasitai 20:381-387,2004. 29. Davison HC, Thrus field MV, Husein A, Muharsini S, Partoutomo S, Rae P and Luckins AG. The occurrence of Trypanosoma evansi in buffaloes in Indonesia, estimated using varions diagnostic tests. Epidemiol Infect 124: 163172, 2000. 30. de Alm eida PJ, Ndao M, Van Meirvenne N and Geerts S. Diagnostic évaluation of PCR in goats experimentally infected with Trypanosoma vivax. Acta Trop 66: 45-50, 1997. 31. de Koning HP, Anderso n LF, Stewart M, Burchmore RJ, Wallace LJ and Barrett MP. The trypanocide diminazene aceturate is accumulated predominantly through the TbATl purine transporter: additional insights on diamidine résistance in african trypanosomes. Antimicrob Agents Chemother 48: 1515-1519,2004. 32. De Sousa JM, Lareau SM, P earson RD, Carvalho EM, Mann BJ and Jeronimo SM. Characteri2:ation of Leishmania chagasi DNA topoisomerase II: a potential chemotherapeutic target. Scand J Infect Dis 35: 826-829, 2003. 33. Delespaux V and Elyn R. The Full Cost Recovery Drug Delivery System in Eastem Province of Zambia: Report of trypanocidal drugs sales in Chadiza, înstitimt voor Tropische Geneeskimde Antwerpen - Université Libre de Bruxelles - International Livestock Research Institute Financed by Het Fonds voor Wetenchappelijk Onderzoek Vlaanderen - Research Foundation Flanders

119

References

Chipata, Katete, Lundazi and Petauke districts. Assistance to the Veterinary Services ofZambia in Eastern Province (ASVEZA-East) Annuel Report 1997 3: 49-50, 1997. 34. Delespaux V . Drug Delivery System of trypanocides in Eastern Province of Zambia. IC P T VNewsletter 2: 29, 2000. 35. Delespaux V, Ge erts S, Brandt J, Elyn R and Eisler MC. Monitoring the correct use of isometamidium by farmers and veterinary assistants in Eastern Province of Zambia using the isometamidium-ELISA. Vet Parasitol 110: 117-

122, 2002. 36. Delespaux V, Ayral F, Geysen D and Geerts S. PCR-RFLP using Ssu-rDNA amplification: applicability for the diagnosis of mixed infections with different trypanosome species in cattle. Veterinary Parasitology 117: 185-193, 2003. 37. Desquesnes M and Tresse L . Evaluation de la sensibilité du test de Woo pour la détection de Trypanosoma vivax. [Evaluation of the sensitivity of the Woo test for the détection of Trypanosoma vivax]. Rev Elev Med Vet Pays Trop 49: 315-321, 1996. 38. Desquesnes M and Tresse L . Evaluation de la sensibilité de la PCR pour la détection de l'ADN de Trypanosoma vivax selon divers modes de préparation des échantillons sanguins. [Evaluation of sensitivity of PCR for detecting DNA of Trypanosoma vivax with several methods of blood sample préparations]. Rev Elev Med Vet Pays Trop 49: 322-327, 1996. 39. Desquesnes M . Evaluation of a simple PCR technique for the diagnosis of Trypanosoma vivax infection in the sérum of cattle in comparison to parasitological techniques and antigen-enzyme-linked immimo sorbent assay. Acta Trop 65: 139-148, 1997. 40. Desquesnes M, McLaug hlin G, Zoungrana A and Davila AMR. Détection and identification of Trypanosoma of African livestock through a single PCR based on internai transcribed spacer 1 of rDNA. International Journal for Parasitology 1>\: 610-614, 2001. Instituut voor Tropische Geneeshmde Antwerpen - Université Libre de Bruxelles - International Livestock Research Institute Financed by Het Fonds voor Wetenchappelijk Onderzoek Vlaanderen - Research Foundation Flanders

120

References 41. Diall O, Bajyana -Songa E, Magnus E, Kouyate B, Diallo B, Van Meirvenne N and Hamers R. Evaluation d'un test sérologique d'agglutination directe sur carte dans le diagnostic de la trypanosomose cameline a Trypanosoma evansi. [Evaluation of a direct sérologie card agglutination test for the diagnosis of camel trypanosomiasis caused by Trypanosoma evansi]. Rev Sci Tech 13: 793-800,1994. 42. Doran M . Socîo-economics of trypanosomosis. Implications for Control Strategies within the Common Fly-Belt ofMalawi, Mozambique, Zambia and Zimbabwe. Harare: RTTCP, 2000. 43. Dye C and Wi lliams BG. Multigenic drug résistance among inbred malaria parasites. Proc R Soc Lond B Biol Sci 264: 61-67,1997. 44. Eisler MC, Gault EA, S mith HV, Peregrine AS and Holmes PH. Evaluation and improvement of an enzyme-linked immunosorbent assay for the détection of isometamidium in bovine sérum. Ther Drug Monit 15: 236242, 1993. 45. Eisler MC, Arowolo ROA, Gault EA, Moloo SK, Hol mes PH and Peregrine AS. Isometamidium Concentrations in the Sera of Boran Cattle Corrélation with Prophylaxis Against Tsetse-Transmitted TrypanosomaCongolense. .4c/a Tropica 56: 39-50, 1994. 46. Eisler MC . Pharmacokinetics of the chemoprophylactic and chemotherapeutic trypanocidal drug isometamidium chloride (Samorin) in cattle. Drug Metab Dispos lA: 1355-1361,1996. 47. Eisler MC, Maruta J, Nqindi J, Connor RJ, Ushewokunze-Obatolu U, Holmes PH and Peregrine AS. Isometamidium concentrations in the sera of cattle maintained under a chemoprophylactic régime in a tsetse-infested area of Zimbabwe. Trop Med Int Health 1: 535-541, 1996. 48. Eisler MC, Gault EA, Moloo SK, Holmes PH and Peregrine AS. Concentrations of isometamidium in the sera of cattle challenged with drugresistant Trypanosoma congolense. Acta Trop 63: 89-100, 1997. Insütuut voor Tropische Geneeskunde Antwerpen - Université Libre de Bruxelles - International Livestock Research Institute Financed by Het Fonds voor Wetenchappelijk Onderzoek Vlaanderen - Research Foundation Flanders

121

References

49. Eisler MC, Stevenson P, Munga L and Smyth JB. Concentrations of isometamidium chloride (Samorin) in sera of Zebu cattle which showed evidence of hepatotoxicity following frequent trypanocidal treatments. J Vet Pharmacol Ther 20: 173-180, 1997. 50. Eisler MC, Lessard P, Masake RA, Moloo SK and Peregrine AS. Sensitivity and specifieity of antigen-capture ELISAs for diagnosis of Trypanosoma congolense and Trypanosoma vivax infections in cattle. Vet Parasitoll9: 187-201, 1998. 51. Eisler MC, Mc Dermott JJ, Mdachi RE, Murilla G, Sinyangwe L, Mubanga J, Machila N, Mbwambo H, Coleman PG, Clausen PH, Bauer B, Sidibe I, Geerts S, Holmes PH and Peregrine A. Rapid method for the assessment of trypanocidal drug résistance in the field. Proceedings of the 9th Symposium of the International Societyfor Veterinary Epidemiology and Economies paper 353, 2000. 52. Eisler MC, Brandt J, Bauer B, Clausen PH, De lespaux V, Holmes PH, Ilemobade A, Machila N, Mbwambo H, McDermott J, Mehlitz D, Murilla G, Ndung'u JM, Peregrine AS, Sidibe I, Sinyangwe L and Geerts S. Standardised tests in mice and cattle for the détection of drug résistance in tsetse-transmitted trypanosomes of African domestic cattle. Vet Parasitol 97: 171-182, 2001. 53. El Rayah lE, Kaminsky R, Schmid C and El Malik KH. Drug résistance in Sudanese Trypanosoma evansi. Vet Parasitol 80: 281-287, 1999. 54. Elrayah lE an d Kaminsky R. The effect of diminazene aceturate and isometamidium chloride on cultured procyclie forms of suseeptible and drugresistant Trypanosoma eongolense. Acta Trop 49: 201-213, 1991. 55. Elyn R . Baseline data used to calculate the mean number of trypanocide treatments per head of cattle per year in five districts of Estem Province of Zambia. Assistance to the Veterinary Services of Zambia in Eastern Province (ASVEZA-East) Annual Report 1997 3: 50, 1997.

Instituut voor Tropische Geneeskmde Antwerpen - Université Libre de Bruxelles - International Livestock Research înstitute Financed by Het Fonds voor Wetenchappelijk Onderzoek Vlaanderen - Research Foundation Flanders

122

Référencés 56. Engels WR . Contributing Software to the Internet - the Amplify Program. Trends in Biochemical Sciences 18: 448-450, 1993. 57. Gall Y, Woitag T, Bauer B, Sidibe I, McDer mott J, Mehlitz D and Clausen PH. Trypanocidal failure suggested by PCR results in cattle field samples. Acta Trop 92: 7-16, 2004. 58. Gaud A, Carrington M, Deshusses J and Schaller DRG. Polymerase chain reaction-based gene disruption in Trypanosoma brucei. Molecular and Biochemical Parasitology SI: 113-115,1997. 59. Ge erts S and Holmes PH. Drug management and parasite résistance in bovine trypanosomiasis in Afiica. PAAT Technical Scientific Sériés, 1 1998. 60. Ge erts S, Ndung-u-J-M, Murilla GA, Mbwambo H, Sinyangwe L, Machila N, Delespaux V, Brandt J, Peregrine AS, McDermott J, Holmes PH and Eisler MC. A simplified cost-effective method for area-wide testing of trypanocidal drug sensitivity of T. congolense in mice [abstract]. 25th Meeting of the International Scientific Council for Trypanosomiasis Research & Control (ISCTRC); Mombasa, Kenya, 27/9 1/10 1999 41, 1999. 61. Ge erts S, Diarra B, Eisler MC, Brandt J, Lemmouchi Y, Kageruka P, De Deken R, Ndao M, Diall O, Schacht E, Berkvens D, Speybroeck N and Holmes PH. Extension of the prophylactic effect of isometamidium against trypanosome infections in cattle using a biodégradable copolymer. Acta Trop

73: 49-58,1999. 62. Geysen D, Delespaux V and Geerts S. PCR-RFLP using Ssu-rDNA amplification as an easy method for species-specific diagnosis of Trypanosoma species in cattle. Veterinary Parasitology 110: 171-180, 2003. 63. Gott esman MM. Mechanisms of cancer drug résistance. Annual Review of Medicine 53: 615-627, 2002. 64. Gove rnment of the Republic of Zambia. ASIP Appraisal Report. Ministery ofAgriculture, Food and Fisheries Lusaka: 1994. Instituut voor Tropische Geneeskunde Antwerpen - Université Libre de Bruxelles -* International Livestock Research Institute Financed by Het Fonds voor Wetenchappelijk Onderzoek Vlaanderen - Research Foundation Flanders

123

Référencés

65. Grab DJ and Bwayo JJ . Isopycnic isolation of African trypanosomes on Percoll gradients formed in situ. Acta Trop 39: 363-366, 1982. 66. Gray MA and Peregrine AS. An in vitro assay for drug sensitivity of Trypanosoma congolense using in vitro-derived metacyclic trypanosomes. Acta Trop 54: 291-300, 1993. 67. Haag J, O'hUigi n C and Overath P. The molecular phylogeny of trypanosomes: evidence for an early divergence of the Salivaria. Molecular and Biochemical Parasitology 91: 37-49,1998. 68. Ham marton TC, Clark J, Douglas F, Boshart M and Mottram JC. Stagespecific différences in cell cycle control in Trypanosoma brucei revealed by RNA interférence of a mitotic cyclin. J Biol Chem 278: 22877-22886, 2003. 69. Hanke T, Ramiro MJ, Trigueros S, Roca J and Larraga V. Cloning, functional analysis and post-transcriptional régulation of a type II DNA topoisomerase firom Leishmania infantum. A new potential target for anti­ parasite drugs. Nucleic Acids Res2>\ \ 4917-4928, 2003. 70. Rayes JD and Wolf CR . Molecular Mechanisms of Drug-Resistance. BiochemicalJournal272: 281-295, 1990. 71. Henderson JF, Batt ell ML, Zombor G and Khoo MKY. Effects of Ethidium and Isometamidium on Adenosine-Triphosphate Catabolism and Purine Nucléotide Synthesis in Ehrlich Ascites Tumor-Cells Invitro. Cancer Research 37: 3434-3441, 1977. 72. Hilali M, Abdel -Gawad A, Nassar A, Abdel-Wahab A, Magnus E and Buscher P. Evaluation of the card agglutination test (CATT/T. evansi) for détection of Trypanosoma evansi infection in water buffaloes (Bubalus bubalis) in Egypt. Vet Parasitai 121: 45-51, 2004. 73. Hirumi H, Hirumi K and Peregrine AS. Axenic Culture of TrypanosomaCongolense - Application to the Détection of Sensitivity Levels of BloodStream Trypomastigotes to Diminazene Aceturate, Homidium Chloride, Instituut voor Tropische Geneeskmde Antwerpen - Université Libre de Bruxelles - International Livestock Research Institute Financed by Het Fonds voor Wetenchappelijk Onderzoek Vlaanderen ~ Research Foundation Flanders

124

References

Isometamidium Chloride and Quinapyramine Sulfate. Journal ofProtozoology Research 3: 52-63, 1993. 74. Hoare CA . The Trypanosomes of Mammals. A Zoological Monograph. Blackwell Scientific Publications, Oxford, UK 749 pp, 2005. 75. Hoet S, Opperdoes F, B run R and Quetin-Leclercq J. Natural products active against African trypanosomes: a step towards new drugs. Nat Prod Rep 21:353-364,2004. 76. Holmes PH, Eisler M and Geerts S. Current Chemotherapy of Animal Trypanosomiasis. In: The Trypanosomiasis, edited by Maudlin 1, Holmes PH and Miles MA. Wallingford: CAB International, 2004, p. 431-444. 77. Hopki ns JS, Chitambo H, Machila N, Luckins AG, Rae PF, Van den Bossche P and Eisler MC. Adaptation and validation of antibody-ELISA using dried blood spots on filter paper for epidemiological surveys of tsetsetransmitted trypanosomosis in cattle. Prev Vet Med 37: 91-99, 1998. 78. Ismail MA, Brun R, We nzler T, Tanious FA, Wilson WD and Boykin DW. Dicationic biphenyl benzimidazole dérivatives as antiprotozoal agents. Bioorg Med Chem 12: 5405-5413, 2004. 79. Jones PM and G eorge AM. Mechanism of ABC transporters: A molecular dynamics simulation of a well characterized nucleotide-binding subunit. Proceedings of the National Academy ofSciences of the United States of America 99: 12639-12644,2002. 80. Joshua RA, Ob wolo MJ, Bwangamoi O and Mandebvu E. Résistance to diminazine aceturate by Trypanosoma congolense from cattle in the Zambezi Valley of Zimbabwe. Vet Parasitai 60: 1-6,1995. 81. Kalu AU . Sensitivity of animal-derived Trypanozoon stocks from sleeping sickness endemic foci of Nigeria to trypanocides and human plasma. Rev Elev Med Vet Pays Trop 48: 139-144, 1995.

Instituui voor Tropische Geneeskunde Antwerpen - Université Libre de Bruxelles - International Livestock Research Institute Financed by Het Fonds voor Wetenchappelijk Onderzoek Vlaanderen - Research Foundation Flanders

125

References

82. Ka minsky R and Brun R. In-Vitro Assays to Déterminé Drug Sensitivities of African Trypanosomes - A Review. Acta Tropica 54: 279-289, 1993. 83. Karanja W M, Mdachi RE and Murilla GA. A compétitive enzyme-Iinked immunosorbent assay for diminazene. Acta Trop 84: 75-81, 2002. 84. Ket remindie L. Risque de trypanosomose dans les élevages laitiers autour d'Abidjan. Etude de la résistance au Trypamidium. IMTA - Thèse de MSe 116: 1-32,2003. 85. Kinabo LD and Boga n JA. The pharmacology of isometamidium. J Vet Pharmacol Ther 11: 233-245, 1988. 86. Kita K, Miyadera H, Saruta F and Miyoshi H. Parasite mitochondria as a target for chemotherapy. Journal ofHealth Science 47: 219-239,2001. 87. Kone PS. Comparaison des tests in vivo: test sur souris et test sur bovins pour la détection de la résistance vis-à-vis de l'isometamidium chez Trypanosoma congolense. ITMA MSe Thesis 84: 1-46,1999. 88. Kratzer, R. D. and Ondi ek, F. O. The buffy coat double centrifugation technique, an improved method for the diagnosis of African trypanosomosis. 1989. Proceedings of the International Scientific Committee for Trypanosomosis Research and Control, Mombassa, Kenya, April 1989. Ref Type: Report 89. Kuboki N, Inoue N, Sak urai T, Di Cello F, Grab DJ, Suzuki H, Sugimoto C and Igarashi I. Loop-mediated isothermal amplification for détection of African trypanosomes. J C/m Microbiol 41: 5517-5524, 2003. 90. Kukla B A, Majiwa PA O, Young JR, Moloo SK and Olemoiyoi O. Use of Species-Specific Dna Probes for Détection and Identification of Trypanosome Infection in Tsetse-Flies. Parasitology 95: 1-16, 1987.

Instituut voor Tropische Geneeskunde Antwerpen - Université Libre de Bruxelles - International Livestock Research Institute Financed by Met Fonds voor Wetenchappelijk Onderzoek Vlaanderen - Research Foundation Flanders

126

Référencés 91. Lanham SM and Godfrey DG . Isolation of salivarian trypanosomes from man and other mammals using DEAE-cellulose. Exp Parasitai 28: 521-534, 1970. 92. Lanteri CA, Tru mpower BL, Tidwell RR and Meshnick SR. DB75, a novel trypanocidal agent, disrupts mitochondrial fimetion in Saccharomyces cerevisiae. Antimicrob Agents Chemother 48: 3968-3974, 2004. 93. Leach TM and Roberts CJ . Présent status of chemotherapy and chemoprophylaxis of animal trypanosomiasis in the Eastem hemisphere. Pharmacol Ther 13: 91-147, 1981. 94. Lejon V, Buscher P, Magnus E, Moons A, Wouters I and Van Meirvenne N. A semi-quantitative ELIS A for détection of Trypanosoma brucei gambiense spécifie antibodies in sérum and cerebrospinal fluid of sleeping sickness patients. Acta Trop 69: 151-164, 1998. 95. Lejon V, Rebeski DE, Ndao M, Baelmans R, Wi nger EM, Paye D, Geerts S and Buscher P. Performance of enzyme-linked immunosorbent assays for détection of antibodies against T. congolense and T. vivax in goats. Vet Parasitai U6\ 87-95,2003. 96. Letunic I, Copley RR, Schmidt S, Cicca relli FD, Doerks T, Schuitz J, Ponting CP and Bork P. SMART 4.0: towards genomic data intégration. Nucleic Acids Research 32: D142-D144, 2004. 97. Lienert K, Krishnan R, Fowler C and Russ G. HLA DPBl genotyping in Australian aborigines by amplified fragment length polymorphism analysis. Hum Immunol 36: 137-141, 1993. 98. Lin DM, Chen TY, Wang LF, Hui CF and Hw ang J. Characterization of drug résistance to VM-26 in A2780 ovarian carcinoma cells. Zoological Studies 40:11-78, 2001. 99. Luckins AG . Trypanosoma Evansi in Asia. Parasitology Today 4: 137-142, 1988. Instituut voor Tropische Geneeskunde Antwerpen - Université Libre de Bnaelles - International Livestock Research Institute Financed by Het Fonds voor Wetenchappelijk Onderzoek Vlaanderen - Research Foundation Flanders

127

Référencés

100. Luckins AG . Trypanosomiasis in Small Ruminants - A Major Constraint to Livestock Production. British Veterinary Journal 148: 471-473, 1992. 101. Machila N, Sinyang we L, Mubanga J, Hopkins JS, Robinson T and Eisler MC. Antibody-ELISA seroprevalence of bovine trypanosomosis in the Eastem Province of Zambia. Prev Vet Med 49: 249-257, 2001. 102. Magnus E, Vervoort T. and Van Meirvenne N. A card agglutination test with stained trypanosomes (GATT) for serological diagnosis of T. b. gambiense trypanosomiasis. Ann Soc BelgMed Trop 169-176, 1978. 103. Magona JW, Mayende JS, Olaho -Mukani W, Coleman PG, Jonsson NN, Welburn SC and Eisler MC. A comparative study on the clinical, parasitological and molecular diagnosis of bovine trypanosomosis in Uganda. Onderstepoort J Vet Res 70: 213-218, 2003. 104. Majiwa PAO, Masake RA, Nantulya VM, Hamers R and Matthyssens G. Trypanosoma (Nannomonas) Congolense - Identification of 2 Karyotypic Groups. Embo Journal 4: 3307-3313, 1985. 105. Majiwa PAO and Webster P. A Répétitive Deoxyribonucleic-Acid Sequence Distinguishes Trypanosoma-Simiae ffom Trypanosoma-Congolense. Parasitology 95: 543-598, 1987. 106. Ma mman M, McKeever DJ, Aliu YO and Peregrine AS. Pharmacokinetics of diminazene in plasma and lymph of goats. American Journal of Veterinary Research 51:1\Q-1\A, 1996. 107. Maser P, Sutterlin C, Kralli A and Kaminsky R. A nucleoside transporter ffom Trypanosoma brucei involved in dmg résistance. Science 285: 242-244, 1999. 108. Matovu E, Iten M, Enyaru JC, Schmid C, Lubega GW, Brun R and Kaminsky R. Susceptibility of Ugandan Trypanosoma brucei rhodesiense isolated from man and animal réservoirs to diminazene, isometamidium and melarsoprol. Trop Med Int Health!: 13-18, 1997. Instituut voor Tropische Geneeskunde Antwerpen - Université Libre de Bruxelles - International Livestock Research Institute Financed by Het Fonds voor Wetenchappelijk Ondenoek Vlaanderen - Research Foundation Flanders

128

References 109. Matovu E, Stewart ML, Geise r F, Brun R, Maser P, Wallace LJ, Burchmore RJ, Enyaru JC, Barrett MP, Kaminsky R, Seebeck T and de Koning HP. Mechanisms of arsenical and diamidine uptake and résistance in Trypanosoma brucei. Eukaryot Cell 2: 1003-1008,2003. 110. McDe rmott J, Woitag T, Sidibe I, Bauer B, Diarra B, Ouedraogo D, Kamuanga M, Peregrine A, Eisler M, Zessin KH, Mehlitz D and Clausen PH. Field studies of drug-resistant cattle trypanosomes in Kenedougou Province, Burkina Faso. Acta Trop 86: 93-103,2003. 111. Mdachi RE . Epidemiological studies into the impact of trypanocidal drug résistance on the control of trypanosomiasis in Coastal Kenya. PhD Thesis, University of Glasgow 1999. 112. Mer esse P, Dechaux E, Monneret C and Bertounesque E. Etoposide: discovery and médicinal chemistry. Curr Med Chem 11: 2443-2466,2004. 113. Morrison DA and Ellis JT. Effects of nucléotide sequence alignment on phylogeny estimation: a case study of 18S rDNAs of apicomplexa. Mol Biol Evol 14: 428-441, 1997. 114. Moser D R, Cook GA, Ochs DE, Bailey CP, McKane MR and Donelson JE. Détection of Trypanosoma congolense and Trypanosoma brucei subspecies by DNA amplification using the polymerase chain reaction. Parasitology 99 Pt 1: 57-66, 1989. 115. Mubanga J . Studies on chemoprophylaxis of trypanosomiasis using a compétitive enzyme immunoassay for the détection of isometamidium and homidium in cattle and sheep. MVM Thesis, University of Glasgow 1-174, 1996. 116. Mugunieri GL and Mu rilla GA. Résistance to trypanocidal drugs: suggestions from field survey on drug use in Kwale district, Kenya. Onderstepoort J Vet Res 70: 29-36, 2003.

Instituut \ooT Tropische Geneeskunde Antwerpen - Université Libre de Bruxelles - International Livestock Research Institute Financed by Het Fonds voor Wetenchappelijk Onderzoek Vlaanderen - Research Foundation Flanders

129

References

117. Mulugeta W, Wilkes J, Mulatu W, Majiwa PA, Masake R and Peregrine AS. Long-term occurrence of Trypanosoma congolense résistant to diminazene, isometamidium and homidium in cattle at Ghibe, Ethiopia. Acta Trop 64: 205-217, 1997. 118. Murilla GA, Eisler MC, Peregrine AS, Ndung'u JM and Holmes PH. Development and évaluation of an enzyme-linked immunosorbent assay (ELISA) for the détermination of the trypanocidal drug homidium in sérum of treated cattle. J Vet Pharmacol Ther 22: 301-307,1999. 119. Murilla GA, Hol mes PH, Peregrine AS, Eisler MC and Ndung'u JM. Some pharmacokinetic parameters of the trypanocidal drug homidium bromide in Friesian and Boran steers using an enzyme-linked immunosorbent assay (ELISA). J Vet Pharmacol Ther 22: 295-300, 1999. 120. Murray M, Murray PK and Mcintyre WIM. An improved parasitological technique for the diagnosis of African trypanosomosis. Trans R Soc Trop Med //yg71: 325-326,1977. 121. Nantulya VM, Musoke AJ, Ruranginva FR and Moloo SK . Résistance of Cattle to Tsetse-Transmitted Challenge with Trypanosoma-Brucei Or Trypanosoma-Congolense After Spontaneous-Recovery ffom SyringePassaged Infections. Infection andImmmity 43: 735-738,1984. 122. Ndao M, Pandey VS, Zinsstag J, Pfister K and Vanmeirvenne N. Evaluation of Sodium Dodecyl-Sulfate (Sds) As A Hemolytic Agent for the Détection of Microfilariae and Trypanosomes in the Blood of Cattle. Annales de la Société Belge de Medecine Tropicale 75: 145-148, 1995. 123. Ngaira JM, Njagi EN, Ngeranwa JJ and Olembo NK. PCR amplification of RoTat 1.2 VSG gene in Trypanosoma evansi isolâtes in Kenya. Vet Parasitai 120:23-33, 2004. 124. Nicholson MJ and B utterworth MH. A guide to condition scoring ofzebu cattle. Addis Ababa: International Livestock Centre for Africa, 1986.

înstituut voor Tropische Geneeskunde Antwerpen - Université Libre de Bruxelles - International Livestock Research Institute Financed by Met Fonds voor Wetenchappelijk Onderzoek Vlaanderen - Research Foundation Flanders

130

References

125. Note mi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, Amino N and Hase T. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res 28: E63, 2000. 126. O.I.E.World Organisât! on for Animal Health. Manual of Standards for Diagnostic Tests and Vaccines. Office International des Epizooties Fourth Edition: 856-857,2000. 127. Olbrich C, Gessner A, Schroder W, Kayser O and Muller RH. Lipid-drug conjugale nanoparticles of the hydrophilic drug diminazene-cytotoxicity testing and mouse sérum adsorption. J Control Release 96: 425-435, 2004. 128. Papadopoulos MC, Abel PM, Ag ranofîD, Stich A, Tarelli E, Bell BA, Planche T, Loosemore A, Saadoun S, Wilkins P and Krishna S. A novel and accurate diagnostic test for human African trypanosomiasis. Lancet 363: 1358-1363,2004. 129. Pathak K ML, Singh Y, Meirvenne NV and Kapoor M. Evaluation of varions diagnostic techniques for Trypanosoma evansi infections in naturally infected camels. Veterinary Parasitology 69: 49-54,1997. 130. Pe regrine AS and Mamman M. Pharmacology of Diminazene - A Review. Acta Tropica 54: 185-203, 1993. 131. Pinder M and Authie E . The appearance of isometamidium résistant Trypanosoma congolense in West Africa. Acta Trop 41: 247-252, 1984. 132. Rebeski DE, Winger E M, Rogovic B, Robinson MM, Crowther JR and Dwinger RH. Improved methods for the diagnosis of African trypanosomosis. Memorias do Instituto Oswaldo Cruz 94: 249-253, 1999. 133. Rebeski DE, Winger EM, Van Rooij EMA, Sc hochl R, Schuller W, Dwinger RH, Crowther JR and Wright P. Pitfalls in the application of enzyme-linked immunoassays for the détection of circulating trypanosomal antigens in sérum samples. Parasitology Research 85: 550-556, 1999.

Instituut voor Tropische Geneeskunde Antwerpen - Université Libre de Bruxelles - International Livestock Research Institute Financed by Het Fonds voor Wetenchappelijk Onderzoek Vlaanderen - Research Foundation Flanders

131

References

134. Roberts CJ . The lack of infectivity to cattle of a strain of Trypanosoma simiae transmitted by Glossina morsitans and G. tachinoides. Ann Trop Med Parasitai 65: 319-326, 1971. 135. Ross CA and Barns AM . Alteration to one of three adenosine transporters is associated with résistance to Cymelarsan in Trypanosoma evansi. Parasitology Research^!: 183-188,1996. 136. Rowlan ds G J, Mulatu W, Authie E, Dieteren GDM, Leak SGA, Nagda SM and Peregrine AS. Epidemiology of Bovine Trypanosomiasis in the Ghibe Valley, Southwest Ethiopia .2. Factors Associated with Variations in Trypanosome Prevalence, Incidence of New Infections and Prevalence of Récurrent Infections,

Tropica 53: 135-150,1993.

137. Sambrook J, Fritsch EF and Maniatis T. Molecular Cloning: A Laboratory Manual. New York: Cold Spring Harbor Laboratory Press, 1989. 138. Schnau fer A, Domingo G J and Stuart K. Natural and induced dyskinetoplastic trypanosomatids: how to live without mitochondrial DNA. International Journal for Parasitology 32: 1071-1084, 2002. 139. Schonefeld A, Rottcher D and Moloo SK. The sensitivity to trypanocidal drugs of Trypanosoma vivax isolated in Kenya and Somalia. Trop Med Parasitons-. 177-180, 1987. 140. Schuitz J, Milpetz F, Bo rk P and Ponting CP. SMART, a simple modular architecture research tool: Identification of signaling domains. Proceedings of the National Academy of Sciences of the United States ofAmerica 95: 58575864,1998. 141. Sekoni VO, Rekwot PI and Ba wa EK. The effects of trypanosomosis on sperm morphology in Zebu x Friesian crossbred bulls. Trop Anim Health Prod 36: 55-64, 2004. 142. Shapiro TA an d Englund PT. Sélective Cleavage of Kinetoplast Dna Minicircles Promoted by Antitrypanosomal Drugs. Proceedings of the Instituut voor Tropische Geneeskunde Antwerpen - Université Libre de Bruxelles - International Livestock Research Institute Financed by Het Fonds voor Wetenchappelijk Onderzoek Vlaanderen - Research Foundation Flanders

132

References National Academy ofSciences of the United States ofAmerica 87: 950-954, 1990. 143. Shap iro TA. Inhibition of topoisomerases in African trypanosomes. Acta Trop 54: 251-260,1993. 144. Sinyang we L, Delespaux V, Brandt J, Geerts S, Mubanga J, Machila N, Holmes PH and Eisler MC. Trypanocidal drug résistance in eaistem province ofZambia. Veterinary Parasitology 119: 125-135,2004. 145. Sones K. Pharmaceutical companies: partners or enemies 1ICPTV Newsletter 3: 19-21,2001. 146. Sones KR, Njogu AR a nd Holmes PH. Assessment of Sensitivity of Trypanosoma-Congolense to Isometamidium Chloride - A Comparison of Tests Using Cattle and Mice. Acta Tropica 45:153-164,1988. 147. Sones KR, Holm es PH and Urquhart GM. Interférence Between DrugResistant and Drug-Sensitive Stocks of Trypanosoma-Congolense in Goats. Research in Veterinary Science 47: 75-77, 1989. 148. Stephen LE . Trypanosomiasis: a veterinary perspective. Pergamon Press, UK 1-551,1986. 149. Stevens J and Rambaut A. Evolutionary rate différences in trypanosomes. Infect Genet Evol T. 143-150, 2001. 150. Stevens JR, Noyés HA, Dover GA and Gibson WC. The ancien! and divergent origins of the human pathogenic trypanosomes, Trypanosoma brucei and T. cruzi. Parasitology 118: 107-116, 1999. 151. Stevens JR, Teixeira M M, Bingle LE and Gibson WC. The taxonomie position and evolutionary relationships of Trypanosoma rangeli. Int J Parasitol 29: 749-757, 1999. 152. Sturk LM, Brock JL, B agnell CR, Hall JE and Tidwell RR. Distribution and quantitation of the anti-trypanosomal diamidine 2,5-bis(4Instituut voor Tropische Geneeskunde Antwerpen - Université Libre de Bruxelles - International Livestock Research Institute Financed by Het Fonds voor Wetenchappelijk Onderzoek Vlaanderen - Research Foundation Flanders

133

Référencés

amidinophenyl)furan (DB75) and its N-methoxy prodrug DB289 in murine brain tissue. Acta Trop 91: 131-143, 2004. 153. Sutherland IA, Pereg rine AS, Lonsdaleeccles JD and Holmes PH. Reduced Accumulation of Isometamidium by Drug-Resistant TrypanosomaCongolense. Parasitology 103: 245-251,1991. 154. Sutherland IA an d Holmes PH. Alterations in Drug Transport in Résistant Trypanosoma-Congolense.

Tropica 54: 271-278, 1993.

155. Tait A, Masiga D, Oum a J, MacLeod A, Sasse J, Melville S, Lindegard G, Mcintosh A and Turner M. Genetic analysis of phenotype in Trypanosoma brucei: a classical approach to potentially complex traits. Philos Trans R Soc LondBBiol Sci 357: 89-99,2002. 156. Taylor KA. Immune responses of cattle to African trypanosomes: protective or pathogenic? Int JParasitol 28: 219-240, 1998. 157. Uilenber g, G. A field guide for the diagnosis, treatment and prévention of African animal trypanosomosis. FAO. 1998. Rome. Ref Type: Serial (Book,Monograph) 158. Van den Bossche P., Do ran M and Connor RJ. An analysis of trypanocidal drug use in the Eastem Province of Zambia. Acta Trop 75: 247-258, 2000. 159. Van den Bossche P and Vale GA . Tsetse and trypanosomosis in Southern Africa. Harare: RTTCP, 2000. 160. Van den Bossche P, Chigoma D and Shumba W. The décliné of antitrypanosomal antibody levels in cattle after treatment with trypanocidal drugs and in the absence of tsetse challenge. Acta Tropica 77: 263-270,2000. 161. Vos P, Hoge rs R, Bleeker M, Reijans M, van de Lee T, Homes M, Frijters A, Pot J, Peleman J, Kuiper M and et a. AFLP: a new technique for DNA fmgerprinting. Nucleic Acids Res 23: 4407-4414, 1995.

Instituut voor Tropische Geneeskunde Antwerpen - Université Libre de Bruxelles - International Livestock Research Institute Financed by Het Fonds voor Wetenchappelijk Onderzoek Vlaanderen - Research Foundation Flanders

134

References 162. Walker PJ . Capillary concentration technique applicable to infections of T. congolense in cattle. Trans R Soc Trop Med Hyg 66: 348,1972. 163. Wang ZF, Morris JC, Drew ME and Englund PT. Inhibition of Trypanosoma brucei gene expression by RNA interférence using an integratable vector with opposing T7 promoters. Journal of Biological Chemistry 275: 40174-40179, 2000. 164. Wang ZF and Englund PT. RNA interférence of a trypanosome topoisomerase II causes progressive loss of mitochondrial DNA. Embo Journal 20: 4674-4683, 2001. 165. Whitelaw DD, Gault EA, Holm es PH, Sutherland IA, Rowell FJ, Phillips A and Urquhart GM. Development of An Enzyme-Linked-ImmunosorbentAssay for the Détection and Measurement of the Trypanocidal Drug Isometamidium Chloride in Cattle. Research in Veterinary Science 50: 185189,1991. 166. Whiteside EF . Interactions between drugs, trypanosomes and cattle in the field. In: Goodwin, L G and Nimmo-Smith, R H (eds) Drugs, Parasites and HostsJandA Churchill, London 116-141, 1962. 167. Whiteside EF . Recent work in Kenya on the control of drug résistant cattle trypanosomiasis. Proceedings of the 8th ISCTRC Meeting, Jos 62: 141-154, 2004. 168. Wilkes JM, Mulugeta W, Wells C and Per egrine AS. Modulation of mitochondrial electrical potential: a candidate mechanism for drug résistance in African trypanosomes. Biochem J 326: 755-761, 1997. 169. Witola WH, Inoue N, O hashi K and Onuma M. RNA-interference silencing of the adenosine transporter-1 gene in Trypanosoma evansi confers résistance to diminazene aceturate. Exp Parasitol 107: 47-57, 2004. 170. Woo PT . The haematocrit centrifuge technique for the diagnosis of African trypanosomiasis. Acta Trop 27: 384-386, 1970. Instituut voor Tropische Geneeshmde Antwerpen - Université Libre de Bruxelles - International Livestock Research Institute Financed by Met Fonds voor IVetenchappelijk Onderzoek Vlaanderen - Research Foundation Flanders

135

References

171. Woo PT . Cryptobia (Trypanoplasma) salmositica and salmonid cryptobiosis. J Fish Dis 26: 627-646, 2003. 172. Zilberstein D, Wilkes J, Hirumi H and Pe regrine AS. Fluorescence Analysis of the Interaction of Isometamidium with Trypanosoma Congolense. BiochemicalJournal 292: 31-35, 1993.

Instituut voor Tropische Geneeskmde Antwerpen - Université Libre de Bruxelles - International Livestock Research Institute Financed by Het Fonds voor Wetenchappelijk Onderzoek Vlaanderen - Research Foundation Flanders

136

List offigures and tables

6. Figures Figure 1 Life cycle of Trypanosoma brucei.................................................................14 Figure 2 Phylogenetic tree based on bootstrapped maximum parsimony analysis of 18S SSU ribosomal RNA gene sequences....................................................................16 Figure 3 Summary of possible strategies of cells to develop résistance to drugs. (Gottesman, 2002).......................................................................................................... 29 Figure 4 Molecular structure of isometamidium......................................................... 30 Figure 5 Molecular structure of quinapyramine.......................................................... 30 Figure 6 Molecular structure of homidium...................................................................30 Figure 7 Molecular structure of diminazene aceturate................................................ 31 Figure 8 Giemsa stained T.congolense sampled ffom a mouse before treatment with isometamidium chloride..................................................................................................34 Figure 9 Giemsa stained sensitive T.congolense IL 1180 sampled from a mouse 24 hours after treatment with lOmg/kgisometamidium chloride....................................... 34 Figure 10 Giemsa stained résistant T.congolense TRT57cl sampled from a mouse 24 hours after treatment with lOmg/kg isometamidium chloride...................................... 35 Figure 11 Example of the standard AFLP® procedure (Invitrogen life technologies copyright).........................................................................................................................44 Figure 12 Trypanosome prevalence in cattle in Petauke, Katete and Lundazi Districts, Eastem Province, Zambia............................................................................................... 48 Figure 13 Géographie locations of villages from which evidence of drug résistance was obtained in mice...................................................................................................... 50 Figure 14 Percentage of cattle in Petauke, Katete and Lundazi Districts, Eastem Province, Zambia treated vvdth isometamidium chloride...............................................51 Figure 15 Expected répartition of isometamidium treatments from the sales of the Dmg Delivery System and results of the survey. Eastem Zambia, 1997....................55 Figure 16 Farmers estimâtes of bodyweight and measured bodyweight in cattle. Eastem Zambia, 1997...................................................................................................... 57 Figure 17 Results of the first mn amplification (using primers 18 ST nF2 and 18 ST nR3) of DNA from the trypanosome reference stocks:................................................62 Figure 18 Results of the semi-nested amplification (using primers 18ST nF2 and 18ST nR2) of template DNA from the trypanosome reference stocks................................... 63

Instituut voor Tropische Geneeskunde Antwerpen - Université Libre de Bruxelles - International Livestock Research Institute Financed by Het Fonds voor Wetenchappelijk Onderzoek Vlaanderen - Research Foundation Flanders

137

List offigures and tables

Figure 19 Results of the semi-nested run amplification of DNA from varions dilutions of a known trypanosome parasitaemia sample.............................................................. 64 Figure 20 RPLP restriction enzyme analysis using Mspl and Eco51\ digestion of 18 Ssu rDNA from varions trypanosome isolâtes and fractionated on a 10% PAGE gel, stained with silver.............................................................................................................65 Figure 21 RFLP restriction enzyme analysis using MboW digestion of 18 Ssu rDNA from varions trypanosome isolâtes and fractionated on a 10% PAGE gel, stained with silver.................................................................................................................................. 66 Figure 22 In vitro mixed infections of Trypanosoma congolense and Trypanosoma vivax mixed in the following ratios;...............................................................................69 Figure 23 In vitro mixed infections of Trypanosoma congolense and Trypanosoma vivax mixed in the following ratios:...............................................................................69 Figure 24 In vitro mixed infections of Trypanosoma congolense and Trypanosoma brucei mixed in the following ratios:..............................................................................70 Figure 25 In vitro mixed infections of Trypanosoma vivax and Trypanosoma brucei mixed in the following ratios:..........................................................................................70 Figure 26 In vitro mixed infections of Trypanosoma theileri and Trypanosoma brucei mixed in the following ratios:.......................................................................................... 71 Figure 27 In vitro mixed infections of Trypanosoma theileri and Trypanosoma congolense mixed in the following ratios:..................................................................... 71 Figure 28 In vitro mixed infections of Trypanosoma theileri and Trypanosoma congolense mixed in the following ratios:.......................................................................72 Figure 29 In vitro mixed infections of Trypanosoma theileri and Trypanosoma vivax mixed in the following ratios:.......................................................................................... 72 Figure 30 /« vitro mixed infections of Trypanosoma theileri and Trypanosoma vivax mixed in the follo^ving ratios;.......................................................................................... 73 Figure 31 Single and mixed infections in field samples from cattle sampled in Bénin ...........................................................................................................................................73 Figure 32 AFLP fmgerprint (detail).................................................................................77 Figure 33 Close-up of a section of the autoradiograph shown in Figure 31................78 Figure 34 Amino acid sequence of protein predicted from the alignment of the nucléotide sequences of contigs adjacent to the E6M6.1 AFLP fragment...................79 Figure 35 Prédiction of transmembrane domains........................................................... 80

InstUuut voor Tropische Geneeskunde Antwerpen - Université Libre de Bruxelles - International Livestock Research Institule Financed by Met Fonds voor Wetenchappelijk Onderzoek Vlaanderen - Research Foundation Flanders

138

List offigures and tables

Figure 36 Sequences of the GAA test amplicons with the E6M6.1 AFLP fragment underlined, primers in italic font and GAA insertion as italic underlined font........... 81 Figure 37 Examples of PCR-RFLP profiles of the GAA test amplicon......................82 Figure 38 Sampling sites in Petauke, Katete and Limdazi Districts, Eastem Province, Zambia........................................................................................................................... 98

7. Tables Table 1 Host range of the principal animal trypanosomes.......................................... 15 Table 2 For the three districts: disease prevalence, percentage of villages where drug résistance was observed and percentage of the cattle found with ISMM concentration higher than 0,4 ng/ml in their sérum............................................................................. 52 Table 3 Répartition of isometamidium treatments. Answers to questionnaire and expected répartition ffom the sales of the Drug Delivery System. Eastem Zambia, 1997.................................................................................................................................55 Table 4 Frequency of isometamidium treatments per animal per year by farmers and veterinary assistants: Eastem Zambia, 1997...................................................................56 Table 5 Measured isometamidium sérum concentration ranges seven days after treatment and protection period extrapolated from the équation of the exponential curve:y = e^'"^°-°°”^’‘^................................................................................................. 58 Table 6 Description of the armealing sites of the three primers on the 18S sequence of varions trypanosome species with the expected amplicon sizes for both runs............63 Table 7 Number of AFLP bands observed only in the DNA of the résistant isogenic clone of T.congolense using 64 combinations of EcoR I and Mse / primers...............76 Table 8 General organization of thepredicted protein................................................... 80 Table 9 Corrélation between sensitivity or résistance to isometamidium chloride based on the single dose mouse test and the presence or absence of the GAA codon (PCRRFLP test)........................................................................................................................ 83 Table 10 Bovine trypanocidal dmg résistance: proposed guidelines for action......... 96 Table 11 Description of the trypanosome isolâtes used in

the PCR

amplifications..105

Table 12 Description of the trypanosome isolâtes used in

the PCR

amplifications..108

Table 13 DNA ratio used for in vitro mixed infections.............................................. 109 Table 14 Origins of the T.congolense isolâtes used in the

study...........................112

Instituut voor Tropische Geneeskunde Antwerpen - Université Libre de Bruxelles - International Livestock Research Institute Financed by Het Fonds voor Wetenchappelijk Onderzœk Vlaanderen - Research Foundation Flanders

139

8. Index Antibody-ELISA, 49, 99, 101

A AATF. See African Agricultural Technology Foundation

Anticoagulant, 112 Antigen, 21, 22, 23, 24 Antigen-detecting tests, 24

ABC-transporters, 95

Arsenical, 35, 95

ABC-type multidrug / protein / lipid

ASVEZA, 54, 103

transporter, 82 ABC-type multidrug transport System, 95

ATPase activity, 95 ATP-binding cassette, 81 Autoradiograph, 76, 78

Abomey-Calavi, 110

Autoradiography, 113

Abortion, 13

Axenic culture, 40

Abscesses, 88

B

Acaricide, 100 Accumulation, 32

Babesia, 61, 104

Acetic acid, 113

Becton Dickinson'*'^, 99

Adenosine transporter-1 gene, 35

Belgian Coopération, 4

Adenosylmethionine, 111

Bioavailability, 88

AFLP, 43, 75, 78, 94, 95,111,113,

Blast Search tool, 107

115

Block treatment, 17, 85

AFLP Analysis System II ®, 113

Blood smears, 99

AFLP fingerprint, 77

Bodonina, 32

Africa, 13,30,31,32, 43

Bodyweight estimation, 57

African Agricultural Technology

Boran, 41, 87

Foundation, 3

Bos indicus, 87

Agarose gel, 106, 114, 115

Bos taurus, 87

Ag-ELISA, 24

Bovine sérum albumin, 115

Amplicon, 61, 62, 81, 110, 115

Breakthrough infection, 38

Amplified fragment-length

Bromophenol blue, 113

polymorphism. See AFLP

Bubalus bubalis, 24

Amplify computer program’’’^, 115

Buffer Y+/Tango, 107, 111

Anaemia, 13,17, 18

Buffy coat, 20, 21, 61, 90, 105, 110

Antibodies, 21, 22, 24, 41, 101

Burkina Faso, 83, 107, 108, 112

c Cachexia, 18 Camels, 24, 30 Cancerology, 32

Cryostabilates, 112 Cryptobia salmositica, 32 Curative dose, 38 CYC6 gene, 34

Card agglutination test, 24

D

Cash money, 55 GATT test. See Card agglutination CATT/T. evansi, 24 CD. See Curative dose CD50,39,111 CD80, 39 CD95, 39 Chelex-100 resin, 105 Chemoprophylaxis, 17 Chemotherapy, 17 Chipika, 50 Chromogen-substrate, 22, 41 CIRDES,3,112 Cleavage site, 79 Clinical signs, 17 Cluster tribe, 81 Coating buffer, 101 Codon insertion, 81 Concentration ranges 7 days after treatment, 58 Contigs, 79,115 Control campaigns, 17 Corrélation coefficient, 103 Cross résistance, 29 Cross-reactivity, 41 Cross-sectional study, 98 Crushpen, 98, 99 Cryopreservative, 99

Dark-ground/phase-contrast buffy coat technique, 20, 99, 100 Ddel, 61 DDS, 87, See Drug Delivery System Détection limit, 58 Diagnosis of trypanocidal résistance, 38 Diamidine, 29 Diminazene, 29, 31, 35, 36, 39,41, 42, 47,49, 50, 85, 86, 87, 99,100,101 Diminazene résistance, 35 Direct examination, 18 Discriminatory dose, 39, 49 Disease prevalence, 47 DNA, 24, 35,44,61, 62, 63,64, 65, 66, 68, 69, 70, 71,72, 73, 75, 76, 77, 82,90,92,104,105,106,107,108, 109,110,111,112,113,114,115 DNAladder, 64,106,107,110,111, 115 dNTP, 106,110,114 Drug Delivery System, 54, 55, 103 Drug pressure, 36, 87 Drug Résistance, 17, 36, 38,43, 47, 49, 50,51,57, 85,86, 87, 103,111 Drug use, 54, 55, 85, 87, 102, 103 Drug use survey, 102 Drug-sharing farmers, 56

Filterpaper, 25,61,90,91, 105, 110,

Dry season, 55 Dynatex Technologies™, 101 Dyskinetoplastic, 35

113, 114 Fingerprint, 45, 75, 76 Flagellum, 19

E

Fluoresceine, 22

Early diagnosis of treatment failure, 42

Fluorescent conjugate, 22

Eco 571,61,65, 90, 107, 111

Fluorescent dye, 22

EcoR 1,15,16,11, 78,113

Fly-proof, 38,100

ED. See Effective dose

Fonds voor Wetenschappelijk

ED50, 39

Onderzoek, 4

ED80, 39

Formamide dye, 113

ED95, 39

Frei Universitàt Berlin, 4

Effective dose, 38

FWO,4

Efflux, 33

G

Egypt, 24 Eiaquik©, 101

GAA insertion, 79, 81, 94

ELISA, 22,40,41,47, 51, 54, 58, 85,

GAA négative, 82

87,88,91,101,103

GAA positive, 82, 94

Epidemiological survey, 17

GAA test amplicon, 82

Eppendorf, 105, 106, 114

GAA test amplification assay, 114

Ethidium bromide, 33, 106, 110, 114,

GenBank, 61,91,104, 106, 107, 115

115

Gene amplification, 36

Ethiopia, 35,42, 86, 112

GeneJockey II™, 106,107, 115

Eurogentec™, 114

Genetic marker, 75, 94

Exponential curve, 103

Genetic stability, 35

Expression libraries, 94

Genomic complexity, 44

Extrapolation ffom mice to cattle, 39

Geo-reference, 98 Ghibe, 42, 86

F

Gibco BRL™, 113

Facilitated diffusion, 33

Giemsa, 99

False négative, 24

Glycerol, 20, 99

Farmer, 31, 54, 56, 57, 87, 88, 102,

Goat, 90

103 Fermentas™, 107, 110, 111, 115

GPS, 98 Grazing areas, 13

H

Inoculum, 100 Insert, 114

Haemolysis, 103 Haemolytic agent. See sodium dodecyl

Invitrogen™, 114 Isogenic, 45, 75, 76, 81, 94,111

sulfate Heat shock protein, 23 Heating block, 106, 110,114

Isogenic clone, 111 Isometamidium, 29, 31, 32, 33, 35, 36, 39,40, 41, 42, 43, 45, 47, 49, 50, 51,

Heterozygous, 94 Homidium, 29, 31,41 Homology search, 78

52, 54, 55, 56, 58, 75, 77, 82, 83, 85, 86, 87, 88, 94, 95, 99,100,101,103, 104,111,114, 115

Homozygous, 94 Horseradish peroxidase, 41,101 Hot start principle, 106,110 Hybridisation probes, 25 Hydrophobie residue, 82 Hypothetical protein, 81, 95

Isometamidium concentrations, 51, 58, 101.103 Isometamidium résistance, 31 Isometamidium-ELISA, 54, 86, 87, 88, 99.101.103 ITM, 3,105,108,112

I

Ivermectin, 100

IFAT. See Indirect fluorescent

J

antibody test IL1180, 65, 66, 75, 77, 82, 83, 111,

Jugular venipuncture, 99

112

K

IL3343, 75, 77, 82, 83,111,112 ILNat3.1,111 ILRI,3,105,112 Immulon4™, 101 Immunoglobulins, 21,22 Immunoskan 352™, 101 In vitro assays, 40 In vitro cultivation, 40 INCO-DC, 3 Indirect diagnosis, 21 Indirect fluorescent antibody test, 21 Infertility, 18

Katete, 47,48,49, 50, 51, 52, 86, 98, 99,102 KCl, 106,110,114 Kenya, 24, 85,105 Kilifi, 65,104 Kinetoplast, 19, 32, 33, 35 Kinetoplastida, 32 Kit for In Vitro Isolation, 107 KIVI. See Kit for In Vitro Isolation Kodak®, 113

L Laboratory rodents, 75, 95 Leishmania, 32, 33, 36

Mitochondrial topoisomerase II, 32 Mitotic block, 34 Mitotic cyclin gene, 34 Mixed infections, 68, 69, 70, 71, 72,

Libéralisation, 31 Life Technologies™, 113 Liquid nitrogen, 99 Lithuania, 106, 107, 110, 111, 115 Long slender form, 19 Longitudinal parasitological data, 42 Longitudinal study, 42,47, 49, 85, 99 LSGG motif, 82, 95 Lundazi, 47,48,49, 51, 52, 86, 98, 99

73,90,91,92, 107, 109 Molecular structure of diminazene aceturate, 31 Molecular structure of homidium, 30 Molecular structure of isometamidium, 30 Molecular structure of quinapyramine, 30 Monitoring of cattle bodyweight, 103

M

Morbidity, 55

MJ. Research Inc. ™, 110

Morphological characteristics, 19

Management, 32

Mse 1,15,16,11, 78, 113

Marketing network, 54

Msp\,6\,65, 90, 111

MBI Fermentas™, 106, 111, 115

Multi-copy locus, 25

MboII,66, 82,115

Multiple drug-resistant, 36

Membrane protein, 95

Multiple kinetoplasts, 34

Metabolic size, 39

Multiplex PCR, 91

Metacyclic, 40

Muped II™, 106

Methanol, 113

Murray method, 20

Mexicana, 33

N

MgCb, 106, 110,114 Microhaematocrit centrifugation technique, 20 Microscope, 18, 21,99 Minerai oil, 106, 110, 114 Mini anion exchange column, 104, 108 Mitochondria, 32 Mitochondrial electrical potential, 33 Mitochondrial potential, 33

Needles, 56, 88 Nested PCR, 64, 90 Njeleweka, 50 Non-tsetse area, 38 Northern blotting, 94 Nucleoside transporter System, 35 Nucleoside transporters, 95 Nucléus, 19

O Office International des Epizooties, 99 Open reading frame, 79 Optical density (O.D.), 22, 108

Phylogenetic application, 91 Phylogenetic studies, 45 Plant genetics, 45 Plasma membrane, 33 Plasmid, 114

Orthologues, 81 Orthophosphoric acid, 101

Polyacrylamide, 76, 78, 111, 113, 114, 115

Overgrazing, 13 Oxytetracycline, 100

Polyacrylamide Gel Electrophoresis, 113

P

Polymorphie fragments, 94

P2. See Nucleoside transporter System

Pooled stabilates, 100,101

P2 déficient mutant, 35

Preadapted Unes, 40

Packed red blood cell volumes. See

Prevalence, 17

PCV Pan-Trypanosome assay, 90

Prevalence of bovine trypanosomosis, 48

Parasite concentration techniques, 20

Primer combinations, 76, 113

Parasitological diagnosis, 18

Probes, 25, 91

PCR, 24,25,42,43, 59,60,61, 67,68,

Procyclic forms, 40

75, 76, 82, 83,90,91,92,94, 95,

Protection period, 54, 58, 104

104, 105,106,107,108,110,111,

Protective pathway, 36

112,113,114,115

Proteomic databases, 78

PCR-RFLP, 67,68, 75, 82,90, 91,94, 95,107,111 PCV, 92,99, 100

Proteomic signature analysis, 25 PSG. See Phosphate buffered salineglucose

Peak of parasitaemia, 39, 50,100,112 Pellets, 104, 107,108 Percoll gradients, 112 Petauke, 47,48,49, 50, 51, 52, 85, 98, 99,102 Pharmacia Biotech, 111 Pharmacia B iotech™, 107, 115 Phenanthridine, 29, 30 Phosphate buffered saline-glucose, 112

Q QIAamp kit, 104,108 QIAamp® DNA Blood Midi Kit, 112 Questionnaire, 54, 55, 56, 87, 88, 102 Quinapyramine, 30, 41

R Rabbit anti-bovine conjugate, 22

Rabbit anti-isometamidium hyperimmune sérum, 101

Sigma™, 114 Signal peptide, 79

RBC, 18, 20,21

Silica gel, 105,110

rDNA locus, 91

Single dose mouse test, 115

Red blood cell. See RBC

Size polymorphism, 61

Régression analysis, 57

Small ruminants, 38, 91

Relapse, 50, 82, 100, 101

Small scale farmer, 17

Restriction enzyme, 44, 90, 91, 107,

Small sub-tinit ribosomal gene, 106

113

Sodium dodecyl sulfate, 18

Restriction Fragment Length Polymorphism, 24, 61, 107, 111, 115 RFLP, 25, 59, 60, 61, 65,66, 68, 80,

Sodium perborate, 101 Somalia, 38 Spectrophotometer, 108

82, 83,90,91,94, 104, 106, 110,

Ssu-rDNA, 90, 106

112

Standardised tests, 86

RNA interférence, 32, 35

STIB900 mouse model, 31

RONDO®, 103

Stress-response, 36

RoTat 1.2 VSG gene. See Card

Surra, 24

agglutination test RTTCP, 85, 98

Survey, 47, 54, 55, 85, 88, 98, 102 Sweden, 107, 111, 115

S

T

S-adenosylmethionine, 107

Tanzania, 85, 108, 112

Samorin®, 103

Taq polymerase, 106, 110,114

Sanative pair, 47, 85, 86

TbATl-nuIl mutants. See Nucleoside

Savannah type, 65, 111

transporter System

Seasonality, 55

TBE buffer, 107, 111, 115

Self-cure, 21

Tests in mice, 39

Semi-nested PCR, 61, 90, 106, 111

Tests in ruminants, 38

Serial dilutions, 22

Tetramethylbenzidine substrate-

Serological tests, 21 Sérum, 21, 22, 24, 40, 41, 47, 51, 52, 54, 58, 86, 87, 88, 99, 101, 103, 104, 115 Short stumpy form, 19

chromogen, 101 Tetramethylbenzidine-hydrogen peroxide, 41 Theilerîa, 61, 104 Thermocycler, 106, 110, 114

Thick blood film, 19

Trypanosoma vivax, 13, 19, 25, 39, 47,

Thick blood smears, 99

48, 61, 62, 63, 65, 66, 68, 69, 70, 72,

Thin blood smears, 19, 99

73,90, 104, 108

TMHMM Server, 79 Topo-cloning® kit, 114

Trypanosomosis, 17, 20, 25, 29, 31, 47,49, 85, 87, 98, 99

Topoisomerase, 32

Tsetse, 13,30,38,41,90,91

Topoisomerase II inhibitors, 32

Tsetse challenge, 41

Transmembrane domains, 79, 80

Tween 20,101

Transport db, 82

U

Tris-HCl, 106, 110, 114 TRT57cl,81,82,111

ULB,3

Trypanocidal drug ELISAs, 40

Ultrasound, 22

Trypanocidal drug sensitivity tests in

Ultraviolet light or UV, 22,106,110

calves, 100 Trypanocidal drug sensitivity tests in mice, 100 Trypanosoma brucei, 13, 19, 70, 71, 107

Underdosage, 32, 86, 87, 88 Université Libre de Bruxelles, 3 University of Glasgow, 3 Uptake rates, 33 USA, 111,114

Trypanosoma brucei gambiense, 20

V

Trypanosoma congolense, 13, 19, 20, 23, 31,33,35,36, 39,43,45,47,48, 49, 50,61, 62,63, 64, 65, 66, 68, 69, 70,71, 72, 75,76, 77, 78, 79, 86, 88, 90,92, 94, 95,99,100,104, 105, 107, 108,111,112,113 Trypanosoma equiperdum, 35

Vector control, 102 Veterinary assistant, 54, 56, 87,102, 103 Vetoquinol™, 101 Virulence, 13 Vortex, 106

Trypanosoma evansi, 24, 35, 62, 63,

w

65, 90, 91, 95,104 Trypanosoma simiae, 61, 62, 63, 65, 66,90,91,104 Trypanosoma theileri, 19, 61, 62, 63, 65,66, 68,71,72, 73,90,91,92, 104, 107,108

Walker B motif, 82, 95 Weighband, 57, 103 West African Riverine/Forest type, 104 Wet blood film, 18 Whatman®, 105, 110 Woo method, 20

X X-ray, 113 Xylene cyanol, 113

Zambia, 47, 48, 51, 54, 55, 56, 57, 83, 85, 87,88, 98, 103, 111, 112 Zero-input System, 17 Zimbabwe, 90

The aim of this thesis was to provicie a picture of the tryponosomosis and drug résistance prevalence in Eastern Province of Zombio, to understond the underlying foctors of drug resistonce (drug use hobits), to improve the diagnosis of tryponosomosis in livestock and finally. to improve the diagnosis of isometamidium résistance in T.congolense. After an introductory port where ovailable tryponosomosis and trypanocide résistance diognostic methods ore described and discussed, the body of the thesis is divided in two moin sections. In the first section ore presented the results of o cross-sectionol and a longitudinol epidemiologicol survey describing the geographicol distribution of tryponosomosis cases, of resistont isolâtes and of cattle treated with isometomidium chloride. The results of the monitoring of unsupervised treatments of cattle with isometomidium by farmers and veterinary assistants with the Isometamidium-ELISA technique are aiso presented. The second section describes the development of two new diognostic methods, the first one allowing the diagnosis of trypanosome infections with high sensitivity ond specificity through semi-nested polymerase chain reaction and restriction fragment length polymorphism. This is the first report of a pan-trypanosome PCR test (a single PCR test for the diagnosis of oll importont pothogenic tryponosomes of cattle). The second new method that was developed allows the diagnosis of isometamidium résistant T.congolense strains by PCR-RFLP. This is the first report of a PCR based diognostic test of tryponocide résistance in T. congolense.