2015-2016
ORDERING INFORMATION
Product Catalog
ORDERING INFORMATION To make ordering easy, please have the following information ready:
Your name, telephone and fax number Billing address and shipping address Purchase order number Product name, product number, quantity and price
You can place orders in 5 different ways, choose the most convenient one:
By phone: (800) 313 7224 or (905) 474 4493 By fax: (905) 474 5794 By email:
[email protected] By mail: 20 Konrad Crescent, Markham Ontario L3R 8T4 Canada By web: we provide an online shopping cart for orders placed at www.biobasic.com. U
U
U
U
Credit Card Purchase Bio Basic accepts Visa and MasterCard for product orders.
Bulk Discounts Bio Basic offers chemicals packaged in commonly used laboratory sizes ready to ship. If you are interested in bulk quantities and sizes that are not offered in this catalogue, please contact us. We will offer you very competitive prices, as BBI is the manufacturer for many Chemicals, Enzymes and Molecular Biology Kits.
International Order Please contact our local distributor for your region. If a local distributor is not available, please contact Bio Basic directly.
Pricing Our prices are current at the time of release of the catalogue. Due to changes beyond our control, including unexpected fluctuation the cost of raw materials, we reserve the right to change prices without prior notice. Sales taxes, if applicable, are extra to listing prices.
Terms & Conditions All prices in catalogue are in Canadian Dollars or US Dollars. Canadian orders are completed in Canadian Dollars while International orders are charged in US Dollars. Products are intended for vitro research or laboratory use only and are not to be used for in vivo purposes.
Shipping and shipping charges We take great care in choosing best shipping method for each order. Most orders are shipped via FedEx. Shipment is made in a timely manner after an order is received.
International shipping charges Minimum charge is USD $195.00 with maximum weight of 10 kg from Toronto airport, with an additional charge of $5.00 per kilogram if total weight is over 10 kg.
Returns Bio Basic strives to provide our customer with highest quality material shipped to you by the most efficient and accurate means. However, we realize that occasionally there may be problem or that products may be damaged during transit. We therefore are always willing to work with you for a return or replacement. Before returning any BBI products, you are required to call us to make arrangements. Bio Basic reserves the right to make decisions regarding accepting or rejecting a return.
Warranties and Liabilities Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
1
2015-2016 Product Catalog
ORDERING INFORMATION
Bio Basic products are warranted to meet the stated product specifications and to conform to the description on the label. In the event of a non-conformance with this warrant, Bio Basic will indemnify the buyer against loss by them in an amount not to exceed the price paid for the goods. Recommended storage conditions must be observed. Bio Basic Inc. reserves the right to accept or reject warranty claims. Every product offered by Bio Basic is intended for use only by qualified professionals, the burden for safe use in handling our chemicals rests entirely with the user. The user must determine suitability of a product for a particular use. We can not assume responsibility for the completeness or accuracy of any information supplied by us in regard to the hazards or recommended use of these chemicals. Bio Basic assumes no liability and shall not be responsible for any loss, damage or expense, either consequential or incidental, including but not limited to damage or injury to person or property, arising from or related to the use of these products. Bio Basic Inc. makes no warranties, expressed or implied, including without limitation, the warranties of merchantability or fitness for a particular purpose.
Storage Conditions Please check the storage condition on product labels.
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
2
2015-2016 Product Catalog
TABLE OF CONTENTS
TABLE OF CONTENTS
1 2 3 4 5 6 7 8 9 10 11 12 13
CONTENTS Biochemicals Molecular Biology Kits PCR Related Products & DNA, RNA Modifying Enzymes DNA, RNA, Protein Markers & Cloning Vectors Recombinant Proteins & Protein Related Products Culture Medium Labware Oligo Synthesis Gene Synthesis & Related Services Peptides Synthesis Standard DNA Sequencing Services Protein Purification Services Custom Antibody (Poly & Monoclonal) Services 0B
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
PAGE 4 137 180 194 211 266 273 307 330 334 340 346 351
3
2015-2016
Biochemicals
Product Catalog
AA see Adipic acid P (+)Abscisic acid (Dormin, ABA) ((+) Dormin, ABA; 5-(1-Hydroxy-2,6,6-trimethyl-4-oxo-2cyclohexen -1-yl)-ethyl-(2Z,4E)-pentadienoic acid) C15H20O4 264.3 [21293-29-8] Purity >98% mp:161-163°C λmax : 252nm White powder. Code Grade Size AB0001 Reagent 100 mg AB0001 Reagent 500 mg
Store: 15~20°C
ABA see (+) Abscisic acid ABTS, diammonium salt (2,2’-Azino-bis(3-ethylbenzthiazoline-6-sulfonic acid), diammonium salt) C18H24N6O6S4 548.70 Purity >98% mp>300°C Yellow-green crystal Code Grade Size AD0002 Ultra pure 1g AD0002 Ultra pure 5g
[30931-67-0] λmax : 342nm
ABTS, 10/140mg substrate tablets Each tablet contains 10mg of ABTS for quick and easy preparation of substrate solution. 138-142mg/Tablet Code Grade Size A0895 Ultra pure 10 T A0895 Ultra pure 50 T ACES [N-(Carbamoylmethyl)-2-aminoethane sulfonic acid] C4H10N2O4S 182.20 Purity >99% mp >220°C (dec) Useful pH range: 6.1-7.5 White crystal or powder. Soluble in water. Code Grade AD0004 High purity AD0004 High purity AD0004 High purity
[7365-82-4] pKa(25 °C): 6.8
Store: 2~8°C
Store: -15~-20°C
Store: 18~25°C pH (1%):3.6-4.4
Size 25 g 100 g 500 g
Acetamide [Acetic acid amide; Ethanamide] CH3CONH2 59.07 [60-35-5] Purity >98% mp:77°C bp: 220°C Residue on ignition 99% 16.2 °C Fe99% mp: 300°C (Dec) Copper 95% Loss on drying 98% by HPLC
pH 7.0
Code
Grade
Size
CB0321
High Purity
0.25ml
Cytochrome C from porcine heart Highly purified by affinity chromatography / 12,588
/
Store: -15~-20°C
[9007-43-6]
Store: -15~-20°C
Iron content >0.43% Red to brown powder (predominantly in the oxidized form) .Soluble in water (10mg/ml). Code Grade Size CB0354
High Purity
100 mg
Cytosine C4H5N3O 111.10 Purity >98% mp>300°C Loss on drying 99% mp: 328-330°C White crystal or powder. Soluble in water, DMF and DMSO. Code Grade DB0140 DB0140
Reagent Reagent
[71-30-7] λmax (pH2): 276nm
Store: 18~25°C Residue on ignition 13,300
Store: 18~25°C Purity >98% (HPLC)
[33430-61-4] Loss on drying 98% (HPLC) White powder. Soluble in water. Code Grade DB0365
[890-38-0] Heavy metals 98% (HPLC) Heavy metals 99.5 %
[75-09-2] Water 98.0% (HPLC)
/
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
47
2015-2016
Biochemicals
Product Catalog dATP, dCTP, dGTP, dTTP as separated solutions pH 6.8-7.2. RNase, DNase: non-detected Code Grade Size DD0058
Biotech
DD0058
Biotech
4x0.1ml 4x0.5ml
dNTP/dUTP Mix (2mM each) Solution / / / Purity of each >98.0% (HPLC) (2mM dATP, 2mM dCTP, 2mM dGTP and 4mM dUTP (pH 7.0). RNase, DNase: non-detected. Code Grade Size DB2236
Biotech
Store: -15~-20°C
1ml
Dodecyl-beta-D-glucopyranoside see Dodecyl-beta-D-Glucoside Dodecyl gallate (Lauryl gallate ) C19H30O5 Purity >99% Code DD1261
[1166-52-5]
338.44 Grade High Purity
Size 50 g
Dodecylglucopyranoside (Dodecyl-beta-D-glucoside) C18H36O6 348.5 [59122-55-3] Purity >99% pH (0.005% solution): 5-8 alpha-Isomer 99% by HPLC alpha-Isomer < 15% White powder. Soluble in water (>20%). Code Grade DJ424
Ultra Pure
DJ424
Ultra Pure
[69227-93-6] pH (1%, water) @°C: 5.0-8.0
Store: -15~-20°C
[148565-58-6] pH (1%, water) @°C: 5.0-8.0
Store: 2~8°C
[1119-94-4] Heavy metals 99% pH(5%): 6.0-8.0 White or yellowish crystal. Soluble in water & ethanol. Code Grade DB0431
High Purity
DB0431
High Purity
Size 50 g 250 g
Dodecyltrimethyl ammonium chloride (DTAC)
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
48
2015-2016
Biochemicals
Product Catalog C15H34ClN 263.9 Purity >99% pH(5%): 6.0-8.0 Soluble in water & ethanol. Code Grade DD0180
Ultra Pure
DD0180
Ultra Pure
[112-00-5] Heavy metals 98.0% by TLC Code X714501
Grade Ultra Pure
Size 100 mg
Xanthine C5H4N4O2
152.11
Purity >98.0% Code XN1197
Grade USP
Size 5g
Xanthine Oxidase /
/
FromButter milk Lyophilized. Reaction: Xanthine + O2 + H2O2 =Uric acid + H2O2 Specification >0.2 5U/mg. Code Grade Size Y46264003 60 U Y46265003
300 U
X-Gal [BCIG; 5-Bromo-4-chloro-3-indolyl-beta-D-galactopyranoside] C14H15BrClNO6 408.64
[7240-90-6]
Purity >99%
Specific rotation: -64º (C=1,DMF/water)
mp: 225-230°C
Store: -15~-20°C
White powder. RNase,DNase,Phosphotases, Proteases: non-detected. Soluble in DMF. Code Grade Size BB0083
Ultra Pure
100 mg
BB0083
Ultra Pure
1g
BB0083
Ultra Pure
5g
X-GlcA see X-GLUC X-GLUC (X-GlcA CHA;5-Bromo-4-chloro-3-indolyl-ß-D-glucuronic acid, cyclohexylammonium salt) C14H13BrClNO7·C6H13N 521.8 [114162-64-0] Purity >99%
Store: -15~-20°C
Water content 98%
mp: 288 ± 2°C
Store: -15~-20°C
λmax: 285nm
Dark green powder. Useful for staining malarial parasites in blood film. Soluble in ethanol, insoluble in water. Code Grade Size PB2525
Ultra Pure
250 mg
Xylene (mixed isomers) C6H4(CH3)2 Purity(xylene + ethylbenzene98.5%
106.17
[1330-20-7]
Store: 18~25°C
Water 46,000
[3618-43-7]
Store: 18~25°C
Dark green crystal. Soluble in water. Code Grade XB0005
Size
Indicator
5g
Xylenol orange C31H28N2Na4O13S
760.60
mp: 210°C Code XB0996
Grade Indicator
Size 10 g
Xylite see Xylitol Xylitol (Xylite) C5H12O5
152.1
[87-99-0]
Store: 18~25°C
Reducing Sugar 98%
Residue on ignition 1.8. 3. Compatible with many downstream applications such as PCR, restriction digestions, real-time PCR, multiplex PCR, RAPD, RFLP, AFLP, Southern Blotting and microsatellite analysis. 4. Suitable for a wide variety of plant species and tissue types including some recalcitrant specimens. Transportation: at ambient temperature. BS425 BS626 Components 50 preps 250 preps RNase A (10mg/ml) 150ul 750ul PCL Solution 15ml 75ml PP Solution 2ml 10ml
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
155
2015-2016
Molecular Biology Kits
Product Catalog
PB Solution Wash Solution Elution Buffer EZ-10 Spin Column 2ml Collection Tube Protocol
20ml 12ml 5ml 50 50 1
100ml 2X30ml 25ml 250 250 1
Genomic DNA isolated from various plant species using the EZ-10 Plant DNA mini-prep kit. Lane 1-2: Nicotiana tabacum Lane 3-4: Arabidopsis thaliana Lane 5-6: Oryza sativa Lane 7-8: Platycladus orientalis Lane 9-10: Wisteria sinensis M: DNA marker
EZ-500 Spin Column Plant Genomic DNA Maxi-Preps Kit PT92035 4 preps/ PT92036 20 preps The kit is designed for the isolation of large quantities of genomic DNA from a wide variety of plant species. Samples may be fresh, frozen, or dried. DNA in plant tissues and cells are selectively adsorbed on the EZ-500 maxi-prep spin column, while other impurities such as proteins, salts, and lipids do not bind to the column and are washed away. Up to 500ug of plant DNA can be obtained per preparation. Average size of DNA purified using this procedure is ~30-50 kb. Purified genomic DNA can be used directly for PCR, Southern Blotting, RAPD, and more. Features: 1. High Purity of DNA. OD260/280 of purified DNA is generally >1.8. 2. Compatible with many downstream applications, including such as PCR, RAPD, RFLP, AFLP, Southern Blotting and microsatellite analysis. 3. Suitable for a wide variety of plant species and tissue types including some very recalcitrant specimens. Transportation: At ambient temperature.
E.coli genomic DNA purified using the EZ-500 Spin Column Plant DNA Maxi-Preps Kit. Shown on a 0.8% agarose gel. M: DNA Marker 1-7: genomic DNA from E.coli 1
2
3
4
5
6
7
M
96-Well Plate Plant Genomic DNA Mini-Preps Kit This kit provides a rapid and convenient high-throughput technique for the preparation of high quality genomic DNA from various plant species. DNA in a plant lysate is selectively adsorbed on each column of the plate while other impurities such as proteins, salts, and lipids are eliminated from the column. Each column can adsorb up to 20ug of DNA. No phenol/chloroform extraction or ethanol precipitation is required. Purified plant genomic DNA is 20-40 kb, and is suitable for an array of downstream applications including PCR, Southern blotting, microsatellite analysis, AFLP, RFLP, and RAPD. Features: 1. Fast. Using a spin column format, the entire procedure takes less than 2 hours. 2. High purity of DNA. OD260/280 of purified DNA is generally >1.8. 3. Compatible with many downstream applications. 4. Suitable for a wide variety of plant species and tissue types including some very recalcitrant specimens. Transportation: at ambient temperature. Components
BS8361 2×Plates
Universal Buffer PCB
130ml
Universal Buffer BD
50ml
Universal PW Solution
72ml
Universal Wash Solution
30ml
TE Buffer (pH 8.0)
40ml
96-Well EZ Plate
2
96-Well Collection Plate
6
96-Well Storage Plate
2
Sealing film
8
Protocol
1
Plant genomic DNA purified using the 96-well Plate DNA Mini-Prep Kit.
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
156
2015-2016
Molecular Biology Kits
Product Catalog
EZ-10 Spin Column Soil DNA Mini-Preps Kit This kit provides PCR-inhibitor free DNA through a convenient and rapid method for the detection of microorganisms from soil, sand and fecal samples. These samples are considered challenging as they contain rich humic acid that can interfere with the PCR reaction. The kit removes all traces of humic acid using an optimized buffer during the spin column procedure. Briefly, the soil sample is lysed using lysis buffer (Buffer SCL). DNA is then bound to an EZ-10 column in the presence of chaotropic salt. Under these conditions only DNA will bind to the membrane while most of the contaminating RNA, proteins, and cell debris are removed in the flow through. Purified inhibitor-free DNA is then eluted into 50-100ul of the provided TE buffer or water. Total genomic DNA can be isolated and purified from various microorganisms found in soil, including bacteria, fungi and algae. Purified humic acid-free DNA is of the highest quality and is fully compatible with PCR applications or other downstream applications. The molecular size of the purified DNA is around 20-50 kb. Average DNA yields are 5-20ug per gram of soil sample. Features: 1. Fast. Using a rapid spin column format, the entire procedure takes 30 minutes. 2. Versatile. All types of soil samples can be processed with this kit, including sand and fecal samples. 3. High Quality of DNA. OD260/OD280 of purified DNA is generally 1.7-1.9. The purified DNA is almost free from all inhibitors including humic acid. 4. Economical Transportation: at ambient temperature. ST82316 Components 50 preps SCL Solution SP Solution SB Solution Wash Solution Elution Buffer
25ml 25ml 40ml 12ml 5ml
Spin Column 2ml Collection Tube
50 50
Protocol
1
DNA purified from soil samples.
One-Tube Tissue DNA Extraction Kit This kit facilitates rapid isolation of genomic DNA from a wide array of sample types, including animal tissue, mouse tail and ear clips, human hair or saliva, and fish and insect tissue. There is no need for phenol extraction, overnight digestion, DNA precipitation or column purification; the lysate can be used in PCR directly. One-tube extraction kit minimizes the cross-contamination between samples. The procedure takes less than 15 minutes, and the kit is suitable for high throughput PCR screening of large numbers of samples. For other applications, Rapid Animal DNA Isolation Kit and EZ-10 Spin Column Animal DNA Mini-preps Kit (codes: BS427 AT4781; AT4780; BS428) are recommended. Samples recommended: 0.3-0.5 cm mouse tail; or 0.5-2 mm mouse ear punch; or 2-5mg piece of tissue; or 1-10 hairs with roots; or 20µl saliva; or 2-3 mm2 piece of zebrafish fin. Features: 1. Fast. The entire procedure takes less than 15 minutes. 2. High Quality of DNA. OD260/OD280 of purified DNA is generally 1.7-1.9. 3. Versatile. Compatible with tissues from mice, fish and insects, human hair, saliva, swab, blood clot and so on. 4. Easy to scale up. 5. Economic. Transportation: at ambient temperature. Components BS8401 BS8402 100 Preps 500 Preps Lysis-Buffer-T 20ml 100ml Proteinase K
2ml
10ml
Universal Buffer NST
20ml
100ml
Protocol
1
1
PCR amplification using DNA isolated by One-Tube Tissue DNA Extraction Kit as template. Lane 1-3: template DNA from Rat muscle Lane 4-6: template DNA from Rat liver
Rapid Animal Genomic DNA Extraction Kit This kit is designed for rapid small-scale extraction of high quality genomic DNA from a variety of fresh or frozen animal cells and tissues. Purified DNA can be used for many downstream applications such as PCR restriction digestion, hybridization and other applications. Features: 1. Rapid and simple. The entire procedure takes only 20 minutes. 2. High Quality of DNA. OD260/280 ratio of purified DNA is generally > 1.8. 3. Non-Toxic. 4. Easy to scale up. 5. Economic. Transportation: at ambient temperature.
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
157
2015-2016
Molecular Biology Kits
Product Catalog
Components Universal Buffer Digestion
AT4780 10 Preps 5ml
AT4781 50 Preps 24ml
AT4782 250 Preps 120ml
Buffer PA
3ml
12ml
60ml
TE Buffer
2ml
10ml
50ml
Protocol
1
1
1 Fig. DNA isolated from various animal tissues Lane 1-2: Rat muscle DNA Lane 3-4: mouse liver DNA Lane 5-6: fish DNA
EZ-10 Spin Column Animal Genomic DNA Mini-Preps Kit The kit is designed for rapid small scale extraction of genomic DNA from various animal tissues (fresh or frozen). DNA from cell lysate is selectively adsorbed on the spin column, while other impurities such as proteins, salts, and lipids are eliminated. No phenol extraction or ethanol precipitation is required. Purified DNA can be used for many downstream applications including PCR, restriction digestion, and hybridization. Features: 1. Fast. Using a rapid spin-column format, the entire procedure takes only 20 minutes. 2. High Quality of DNA. OD260/OD280 ratio of purified DNA is generally >1.8. 3. Compatible with many downstream applications. 4. Economic. Transportation: at ambient temperature. Components BS427 BS628 50 Preps 250 Preps ACL Solution
20ml
PBS Solution
75ml
100ml 2X200ml
AB Solution
20ml
100ml
CW2 Solution
9ml
45ml
Wash Solution
12ml
2X30ml
Elution Buffer
5ml
25ml
Proteinase K
20mg
100mg
EZ-10 Spin Column
50
250
2ml Collection Tube
50
250
Protocol
1
1
Gel electrophoresis of an animal genomic DNA sample purified using the EZ-10 Spin Column Animal DNA Minipreps Kit. Lane 1 is DNA marker.
EZ-500 Spin Column Animal Genomic DNA Maxi-Preps Kit This kit provides an efficient method for the purification of large quantities of animal genomic DNA. DNA in tissue lysates is selectively adsorbed on the EZ-500 spin column, while other impurities are unable to bind and eliminated in the flowthrough. No phenol extraction or ethanol precipitation is required. Purified genomic DNA can be used directly in a wide array of downstream applications. Features: 1. Fast. Uses a rapid spin-column format, the entire procedure takes 20 minutes only. 2. High Quality of DNA. OD260/OD280 ratio of purified DNA is generally > 1.8. 3. Suitable for large scale extraction of DNA from fresh or frozen animal tissues or cells. 4. Economic. Transportation: at ambient temperature. Components Universal Buffer ACL Universal Buffer CL CW1 Solution CW2 Solution CE Buffer Proteinase K EZ-500 Column 50-ml Collection Tube Protocol
PT92034 4 preps 50ml 60ml 13ml 9ml 20ml 6ml 4 4 1
Gel electrophoresis of an animal genomic DNA sample purified by using EZ-500 Spin Column Animal Genomic DNA Maxi-Preps Kit. Lane 1 is DNA marker.
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
158
2015-2016
Molecular Biology Kits
Product Catalog
96-Well Plate Animal Genomic DNA Mini-Preps Kit This kit provides a rapid and convenient high-throughput technique for the preparation of high quality genomic DNA from animal tissues and cells. DNA in a cell lysate is selectively adsorbed in the column while other impurities such as proteins, salts, and lipids are eliminated from the column. Each column can retain up to 20ug of DNA. No phenol/chloroform extraction or ethanol precipitation is required. Purified genomic DNA can be used for PCR and many other downstream applications. Features: 1. Fast. Using a high-throughput spin column format, the entire procedure takes only 15 minutes. 2. High Quality of DNA. OD260/OD280 ratio of purified DNA is generally > 1.8. 3. Suitable for extraction of DNA from fresh or frozen animal tissues or cells. Transportation: at ambient temperature. Components
BS4372 2×Plates
ACL Solution
80ml
BS437 5×Plates 200ml
PBS Solution
80ml
200ml
AB Solution
80ml
200ml
CW2 Solution
80ml
200ml
Wash Solution
2X35ml
4X48ml
Elution Buffer
20ml
50ml
Proteinase K
80mg
200mg
EZ-10 96 Well Plate
2
5
Deep Collection Plate
4
10
96 Storage Plate
2
5
Sealing film
10
25
Protocol
1
1
Genomic DNA from various animal tissues purified using the 96-well plate mini-preps kit. Shown on a 0.8% agarose gel.
One-Tube Clinical Sample DNA Extraction Kit This kit is designed for rapid isolation of genomic DNA from clinical samples including blood, blood clots, saliva, hair, swabs, and cell shedding. A simple and rapid lysis method is utilized, and there is no need for phenol extraction, overnight digestion, DNA precipitation or column purification. DNA can be used in PCR directly. The procedure takes less than 15 minutes to complete, and the kit is suitable for high throughput PCR screening of large-scale samples. Samples recommended: 5-20µl blood; or 20µl saliva; or 2-5mg blood clot; or Swab. Features: 1. Fast. The entire procedure takes less than 15 minutes. 2. Suitable for screening and high-throughput automation. 3. Easy to scale up. 4. Economical. Transportation: at ambient temperature. Components BS8403 BS8404 100 Preps 500 Preps Lysis Buffer-L 10ml 50ml Protocol 1 1
PCR amplification of DNA isolated using the One-Tube Clinical Sample DNA Extraction Kit. Lane 1-4: template DNA from human anti-coagulated blood. (+) Positive Control (-) Negative Control
Rapid Blood Genomic DNA Extraction Kit This kit facilitates the simple and rapid isolation of high quality genomic DNA from fresh or frozen anti-coagulated blood. Whole blood of mammalian animals consists of non-nucleated cells (e.g. red blood cells, platelets) and nucleated cells (e.g. white blood cells). The former is lysed and removed by a Red Blood Cell Lysis buffer (Buffer TBP), while the latter (containing genomic DNA) is collected and lysed by Buffer Digestion in the presence of Proteinase K. DNA is released to the solution and can be isolated by ethanol precipitation. Up to 5ml of blood can be used in each prep. Average DNA yields are 20-60μg per ml of whole blood. Purified DNA can be used directly in a wide range of downstream applications. Features: 1. Fast. The entire procedure takes 30 minutes. 2. Simple. 3. High Quality of DNA. OD260/OD280 ratio of purified DNA is generally >1.8. 4. Easy to scale up. 5. Economical. Transportation: At ambient temperature. Components Buffer TBP Universal Buffer Digestion Buffer PR
BT4782 50 Preps 40ml 10ml 4ml
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
159
2015-2016
Molecular Biology Kits
Product Catalog
Proteinase K TE Buffer Protocol
1.2ml 50ml 1
Genomic DNA purified from whole animal blood using the Rapid Blood Genomic DNA Extraction Kit. 1: Chicken Blood. 2: Rabbit Blood. 3: Pig Blood. M: lambda DNA. Shown on 0.8% agarose
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
160
2015-2016
Molecular Biology Kits
Product Catalog
EZ-10 Spin Column Blood Genomic DNA Mini-Preps Kit This kit provides a simple, rapid and efficient technique for isolation of high molecular weight genomic DNA from fresh, frozen and anti-coagulated whole blood. DNA from cell lysate is selectively adsorbed on the column while other impurities, including proteins and lipids, are unable to bind and are washed away. Purified genomic DNA can be used in a number of downstream applications, including PCR, Southern blotting and SNP genotyping. Features: 1. High quality of DNA. OD260/OD280 ratio of purified DNA is generally >1.8. 2. Fast. Using a rapid spin-column format, the entire procedure takes 20 minutes. 3. Non-Toxic. 4. Easy. No red blood cell lysis step required. 5. Economical. Transportation: at ambient temperature. Components TBP Buffer TBM Buffer
BS483 50 Preps 120ml
BS684 250 preps 60ml
25ml
65ml
15ml
45ml
Wash Solution
12ml
2X30ml
Elution Buffer
5ml
25ml
Proteinase K
2mg
10 mg
EZ-10 Spin Column
50
250
2.0ml Collection Tube
50
250
Protocol
1
1
TE (pH 8.0)
Genomic DNA preparations from a single blood sample of human whole blood using the Kit.
96-Well Plate Blood Genomic DNA Mini-Prep Kit This kit provides a simple, rapid and high-throughput method for the isolation of high quality genomic DNA from blood. DNA in a lysate is selectively adsorbed on each column in the plate while other impurities such as proteins, salts, and lipids are washed away. Purified genomic DNA can be used for PCR, Southern blot analysis and other applications. Average yield is about 20-60ug per ml of mammalian whole blood sample. Features: 1. High Quality of DNA . OD260/OD280 ratio of purified DNA is generally >1.8. . 2. Non-Toxic. No phenol extraction and no ethanol precipitation are required. 3. Easy. No red blood cell lysis step require 4. Economical. Transportation: at ambient temperature. BT92031 2 plates
BT92032 5 plates
PBS Solution
40ml
100ml
Universal Buffer CL
48ml
120ml
CW1 Solution (concentrate)
52ml
130ml
CW2 Solution (concentrate)
36ml
90ml
CE Buffer
40ml
120ml
Proteinase K
4.8ml
12ml
EZ-10 96 Well Plate
2
5
Deep Well Collection Plate
4
10
96 Storage Plate
2
5
Sealing film
8
20
Components
Genomic DNA purified from human blood using the 96-well plate Blood Genomic DNA Mini-preps Kit.
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
161
2015-2016
Molecular Biology Kits
Product Catalog
One-Tube Viral DNA Isolation Buffer The One Tube Viral DNA Isolation Buffer is used for isolation of viral DNA from a broad range of cell-free clinical samples including serum, urine and plasma. The one-tube procedure is simple and rapid; no transfer between tubes is necessary, which helps in minimizing cross-contamination. Purified viral DNA can be used for PCR, Real Time PCR, and many other downstream applications. Features: 1. High yield. The recovery yield is generally >85%. 2. Simple. 3. Compatible with many downstream applications including PCR and Real Time PCR. 4. Easy to scale up. 5. Economic. Transportation: at ambient temperature. Components Lysis Buffer-V Protocol
VT4785 50 preps 30ml 1
VT4786 100 preps 60ml 1
Viral DNA was extracted from 0.2ml blood plasma with HBV titer of 1000 copies/ml and dissolved in 200ul water. A 5uL aliquot was used in realtime PCR. Red and green line represent our product; the Blue line represents a product from a competitor.
EZ-10 Spin Column Viral DNA Mini-Preps Kit This kit provides a simple, rapid and highly reproducible method for the isolation of viral DNA from a broad range of cell-free clinical samples, including serum, urine and plasma. Viral DNA in lysate is selectively adsorbed in the spin column while impurities are unable to bind and are removed in the flow through. PCR inhibitors, proteins and salts are completely removed during wash steps. Purified nucleic acids are then eluted in either water or TE buffer. The procedure is simple and fast. Purified viral DNA can be used for PCR, Real Time PCR and other clinical research applications. Features: 1. Fast and Simple. Using a rapid spin-column format the entire procedure takes only 20 minutes. 2. Sensitive. 30-50 virus copies in 1ml of sample can be detected by PCR. 3. Non-Toxic. No phenol/chloroform or ethanol precipitation is required. 4. Versatile. Purified viral DNA can be used for PCR, Real Time PCR and other clinical applications. Suitable for broad range cell-free clinical samples including serum, urine and plasma. Transportation: at ambient temperature. VT81812 VT81813 Components 50 preps 250 preps Lysis-Buffer-V 30ml 150ml Universal Wash Solution 15ml 75ml TE Buffer 10ml 50ml Spin Column 50 250 2ml Collection Tube 50 250 Protocol 1 1
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
162
2015-2016
Molecular Biology Kits
Product Catalog
96-Well Plate Viral DNA Mini-Preps Kit This kit provides a fast, simple and high-throughput technique for the isolation of viral DNA from a broad range of cell-free clinical samples, including serum, urine and plasma. Viral DNA in lysates is selectively adsorbed in each spin column of the 96-well plate, while other impurities are unable to bind and are washed away. The procedure is simple and rapid. Purified viral DNA can be used for PCR, Real Time PCR and other clinical applications. Features: 1. Fast and Simple. Using a rapid spin-column & 96-well high throughput format, the entire procedure takes only 30 minutes. 2. Sensitive. 30-50 virus copies in 1ml of sample in each well can be detected by PCR. 3. Non-Toxic. No phenol/ chloroform and ethanol are required. 4. Compatible. Purified viral DNA can be used for PCR, Real Time PCR and other clinical applications. 5. Versatile. Suitable for broad range cell-free clinical samples including serum, urine and plasma. 6. Economical. Transportation: at ambient temperature. VT92032 2×plates 120ml 60ml 20ml 2 4 2 8 1
Components Lysis-Buffer-V Universal Wash Buffer Universal Elution Buffer EZ-10 96 Well Plate Deep Well Collection Plate 96 Storage Plate Sealing film Protocol
One-Tube Swab DNA Extraction Kit This kit is designed for one-tube isolation of PCR-ready genomic DNA from a variety of swab materials, including buccal swab and virginal swab. There is no need for phenol extraction, overnight digestion, DNA precipitation or column purification, and the lysate can be use as a PCR template directly. The one-tube manipulation minimizes the cross-contamination between specimens. The kit is also suitable for DNA extraction from many other clinical samples such as blood, dried blood and sperm. Purified swab DNA can be used for PCR. Features: 1. Fast and Simple. 2. Suitable for extraction of DNA from a wide range of clinical samples. 3. Non-Toxic. 4. Economical. Transportation: at ambient temperature. Components Lysis-Buffer-S Proteinase K Universal Buffer NST
T71612 20 Preps 4ml 0.4ml 4ml
T71613 100 Preps 20ml 2ml 20ml
T71614 500 Preps 100ml 10ml 100ml
One-Tube Hair DNA Extraction Kit This kit provides a simple and rapid method for the isolation of genomic DNA from hair and other forensic samples, including saliva, nails and dried blood. The kit includes Proteinase K and other reagents to break up most tissue samples as well as to separate proteins and other components from the DNA. No phenol extraction, overnight digestion, DNA precipitation or column purification. Lysate can be used directly as a PCR template. The one-tube manipulation minimizes cross-contamination between specimens. Features: 1. Fast and Simple. 2. Suitable for extraction of DNA from a wide range of clinical samples, including buccal swab, virginal swab, blood, dried blood and sperm. 3. Non-Toxic. 4. Economic. Transportation: at ambient temperature. BS8407 Components 50 Preps Lysis-Buffer-H 1.6ml Proteinase K 60ul Protocol 1
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
163
2015-2016
Molecular Biology Kits
Product Catalog
ONE-4-ALL Genomic DNA Mini-Preps Kit The kit is designed for rapid small scale extraction of genomic DNA from various sources of starting materials. DNA from cell lysate is selectively absorbed on the Spin Column, and other impurities such as proteins, salts are eliminated. No phenol extraction, no ethanol precipitations are required. Purified DNA can be used for many downstream applications such as PCR, restriction digestion, hybridization and other applications. Features: Fast. Using a rapid spin-column format, the entire procedure takes 20 minutes. High Quality of DNA. OD260/OD280 ratio of purified DNA is generally >1.8. Flexible and versatile. Isolation of genomic DNA from various sources. Transportation: At ambient temperature. Components
BS88503 50 Preps
Buffer ACL
10ml
50ml
Buffer CL
12ml
60ml
CW1 Solution
13ml
65ml
CW2 Solution
9ml
45ml
BS88505 250 Preps
CE Buffer
15ml
75ml
Proteinase K EZ-10 Spin Column 2ml Collection Tube Protocol
1.25ml
5X1.25ml
50
250
50
250
1
1
Gel electrophoresis of an animal genomic DNA sample purified by using ONE-4-ALL Genomic DNA Minipreps Kit. Lane 1 is DNA marker.
All-In-One DNA/RNA Mini-Preps Kit All-In-One DNA/RNA kit is designed for simultaneous extraction of total RNA and genomic DNA from a single biological sample. DNA and RNA are isolated without splitting the sample prior to extraction. DNA and RNA can be isolated from cultured eukaryotic cells, animal and plant tissues. Features: 1. Efficient. Genomic DNA and RNA can be simultaneously isolated in 1hr. 2. Simple. No phenol/chloroform extraction is required. 3. Versatile. Suitable for wide range of samples including animal tissue, cultured cells, and bacteria. 4. Easy to scale up. 5. High yield and reproducibility. Transportation: At ambient temperature. BS88203 Components 50 preps Buffer Lysis-DR 45 ml CW1 Solution 13 ml CW2 Solution 9 ml CE Buffer 10 ml GT Solution 18 ml NT Solution 6 ml RNase Free Water 5 ml EZ-10 DNA Column 50 RZ-10 RNA Column 50 Protocol 1
DNA/RNA/Protein Extraction Kits
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
164
2015-2016
Molecular Biology Kits
Product Catalog
All-In-One DNA/RNA/Protein Mini-Preps Kit All-In-One DNA/RNA/Protein kit is designed for simultaneous extraction of total RNA, genomic DNA and protein from a single biological sample. DNA, RNA and protein are isolated without splitting the sample prior to extraction. DNA, RNA and protein can be isolated from cultured eukaryotic cells, animal and plant tissues. Features: Efficient. Genomic DNA, RNA and proteins can be simultaneously isolated in 1hr. Simple. No phenol/chloroform extraction is required. Versatile. Suitable for wide range of samples including animal tissue, cultured cells, and bacteria. Easy to scale up. High yield and reproducibility. Transportation: at ambient temperature. Components Buffer Lysis-DRP CW1 Solution CW2 Solution CE Buffer GT Solution NT Solution RNase Free Water PP Solution PD Solution EZ-10 DNA Column RZ-10 RNA Column Protocol
BS88003 50 preps 45 ml 13 ml 9 ml 10 ml 18 ml 6 ml 5 ml 35 ml 10 ml 50 50 1
RNA Extraction & Purification Kits EZ-RNA Reagents EZ-RNA Reagents are used for the isolation of total RNA from cells and tissues. During sample homogenization or lysis, the reagents maintain the integrity of the RNA. Addition of chloroform followed by centrifugation separates the solution into an aqueous phase and an organic phase. RNA is then recovered by precipitation with ethanol or isopropyl alcohol. EZ-RNA Reagents perform well with both small and large quantities of tissue and cells, and are suitable for human, animal, plant or bacterial samples. RNA species of a wide MW range are isolated. The isolated RNA typically has an OD260/OD280 ratio of 1.8-2.0 when diluted into RNase-free water at pH 8.0, and can be used in most downstream applications. Features: 1. High recovery yield. 2. Simple and rapid. The entire procedure takes only 10 minutes. 3. High Purity of RNA. 4. Compatible with many downstream applications, including RT-PCR, Northern Blot, and cDNA synthesis. 5. Versatile. Suitable for RNA extraction from most sources including bacteria, fungi, animals and some plants. 6. Easy to scale up. 7. Economic. 25ml and 100ml of EZ-RNA Reagents are sufficient for 50 and 200 mini-preps. Transportation: at ambient temperature. Components One Step RNA Reagent Protocol
BS409A 50 Preps 25ml 1
Total RNA isolation by EZ-RNA Reagents. M: DNA marker. Lane 1-2: Nicotiana tabacum total RNA. Lane 3-4: Fish total RNA.
BS410A 100 Preps 100ml 1
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
165
2015-2016
Molecular Biology Kits
Product Catalog
EZ-10 Spin Column Total RNA Mini-preps Kit This kit is designed for the purification of total RNA from a wide range of sample types, including bacteria, fungi, animals and plants. This kit simplifies total RNA isolation by combining the stringency of guanidine isothiocyanate lysis with the speed and purity of silica-membrane based purification. Samples are first lysed and then homogenized. Ethanol is added to the lysate to provide optimal binding conditions. The lysate is then loaded onto the EZ column. RNA binds to the silica membrane, while proteins and other contaminants are removed in the flow-through. Purified RNA is then eluted in RNase-free Water, and is ideal for use in most downstream applications, including Northern blotting, RT-PCR, Quantitative PCR, Poly A+ RNA selection and Array analysis Features: 1. Fast. Using a rapid spin column format, the whole procedure takes less than 20 minutes. 2. High Quality of RNA. Purified RNA has an OD260/OD280 ratio of 1.9-2.0. 3. Versatile. Suitable for purification of total RNA from various samples such as bacteria, fungi, animals and some plants. 4. Economic. Transportation: at ambient temperature. Components
BS1361 50 Preps 25ml 30ml 12ml 5ml 50 50 1
Buffer RLT Buffer RW Universal RPE Solution RNase-free water Spin Columns Collection Tubes Protocol
Rapid Bacteria RNA Isolation Kit This kit is designed for the preparation of high quality total RNA from bacterial cells. 20μg total RNA can be purified from 5 x 107 bacterial cells using this kit. Purified RNA is ready for most downstream applications including RT-PCR, Northern Blotting, Poly (A) purification, nuclease protection and in vitro translation Features: 1. Fast. Using fast lysis buffer, the whole procedure takes less than 40 minutes. 2. High Quality of RNA. Purified RNA has an OD260/OD280 ratio of 1.9-2.0. 3. Easy to scale up. 4. Economical. Transportation: at ambient temperature. Components
Total bacterial RNA isolated using the Rapid RNA isolation Kit.
BS8625 50 Preps 50ml 5ml 1
Buffer Rlysis-B RNase-free Water Protocol
EZ-10 Spin Column Bacterial Total RNA Mini-Preps Kit This kit provides a simple spin column technique for preparation of high-purity intact total RNA. The reagent contains guanidine isothiocyanate and β-mercaptoethanol that can inactivate ribonucleases present in cell extracts. RNA is selectively absorbed on spin column and other impurities are washed away. Total RNA is eluted in he presence of RNase-Free Water. 5-15μg total RNA can be purified from 25mg animal tissue using this kit. Purified RNA is ready for most downstream applications such as RT-PCR, Northern Blotting, Poly(A)+ selection and in vitro translation. Features: 1. Fast. Using rapid spin column format and fast lysis buffer the whole procedure takes less than 30 minutes. 2. High Quality of RNA. Purified RNA has an OD260/OD280 ratio of 1.9-2.0. 3. Economical. Transportation: at ambient temperature.
Components
BS583 20 preps
BS584 100 preps
BS784 250 preps
RLT Solution
14ml
70ml
175ml
RW Solution
12ml
60ml
150ml
RPE Solution
5ml
22ml
230ml
RNase-free Water
1ml
5ml
12.5ml
EZ-10 Column
20
100
250
2-ml Collection Tube
20
100
250
Protocol
1
1
1
Fig. 1. Total RNA purified from E. coli using the EZ10 Column Bacteria Total RNA Mini-Prep Kit. M: Marker; Lane 1-2: E. coli total RNA.
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
166
2015-2016
Molecular Biology Kits
Product Catalog
96-Well Plate Bacterial Total RNA Mini-Preps Super Kit This kit provides a simple and rapid method for the extraction of high quality total RNA from a wide range of biological samples, including Gramnegative and Gram-positive cultures. RNA in a bacterial lysate is selectively bound on each column of the 96-well plate while other impurities such as proteins and salts are washed away. The entire procedure takes approximately 15 minutes. No ethanol precipitation is required. Purified bacterial total RNA can be used for many downstream applications such as RT-PCR, Northern Blot, and cDNA synthesis. The kit is also suitable for RNA extraction from animal, fungi and some of plants samples. The kit may not be suitable for RNA extraction from the plants which contain high levels of secondary metabolites, polyphenols and polysaccharides. Plant RNA Isolation Kit and EZ-10 Spin Column Plant RNA Isolation Kit are recommended (Codes PT4191 and BS82314 ). Features: 1. Fast. Using a rapid spin and 96-well high throughput format, the entire procedure takes less than 15 minutes only. 2. High Purity of RNA. Purified RNA has an OD260/OD280 ratio of 1.8-2.0. 3. Suitable for RNA extraction from both of Gram negative and positive bacteria. 4. Economic. Transportation: at ambient temperature. Components Buffer Rlysis-BG
BS5852 2×plates 80ml
BS585 5×plates 200ml
Universal GT Solution
72ml
180ml
Universal NT Solution
24ml
60ml
RNase-free Water
10ml
25ml
EZ-10 96-Well Plate
2
5
Deep Collection Plate
4
10
96-well Storage Plate
1
5
Sealing Film
8
20
Protocol
1
1
Reproducible yields of total RNA from a single sample using EZ-10 96well Spin Column Plate RNA Minipreps Kit. The bands at two ends are RNA markers
EZ-10 Spin Column RNA Cleanup & Concentration Kit. This kit is designed for the rapid purification and concentration of total RNA from in vitro transcription products or from various other materials. More than 80% of the RNA in a given sample can be recovered, and is ready for most downstream applications, such as RT-PCR, Northern Blotting and in vitro translation. Features: 1. Fast. Using a rapid spin-column format, the entire procedure takes only 5 minutes! 2. High Purity of RNA. Purified RNA can directly used for RT-PCR, electrophoresis and labelling reaction, Northern Blot and cDNA synthesis. 3. High recovery yield. 4. Economic. Transportation: at ambient temperature. Components Buffer RLT Universal RPE Solution RNase-free Water EZ-10 Spin Column 2-ml Collection Tube Protocol
BS91315 50 preps 50ml 12ml 5ml 50 50 1
96-Well Plate RNA Cleanup & Concentration Kit. This kit is designed for the rapid purification and concentration of total RNA from in vitro transcription products or various other materials. More than 80% of the RNA can typically be recovered, and is ready for most downstream applications including RT-PCR, Northern Blotting and in vitro translation. Features: 1. Fast. Using a rapid spin-column and 96-well high throughput format, the entire procedure takes 10 minutes. 2. High Yield: Up to 80% of the RNA will be recovered. 3. High Efficiency: Complete removal of contaminants 4. Economic. Transportation: at ambient temperature.
Buffer RLT
BRC1251 2×Plates 200ml
Universal RPE Solution
48ml
RNase-free Water
20ml
96-Well Plate
2
Components
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
167
2015-2016
Molecular Biology Kits
Product Catalog
2 ml Deep Well Collection Plate
4
96-Well Storage Plate
2
Caps for Storage Plate
24
Sealing film
8
Protocol
1
Rapid Fungal RNA Extraction Kit This kit is designed for the preparation of high quality total RNA from a wide range of fungal species. Total RNA can be purified from fresh or frozen filamentous fungi samples using this kit. Purified RNA is ready for most downstream applications including RT-PCR, Northern Blotting, Poly (A) purification, nuclease protection and in vitro translation. Features: 1. Simple and rapid. The entire procedure takes only 40 minutes. 2. High quality of RNA. OD260/OD280 ratio of purified RNA is generally > 1.8. 3. Easy to scale up. 4. Economic. Transportation: at ambient temperature Components Buffer Rlysis-F RNase-free Water Protocol
FT71416 50 preps 50ml 5ml 1
Total RNA purified from Pichia pastoris using the Rapid Fungal RNA Isolation Kit.
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
168
2015-2016
Molecular Biology Kits
Product Catalog
EZ-10 Spin Column Fungal RNA Mini-Preps Kit This kit is designed for the preparation of high quality total RNA from a wide range of fungal species. Fungal samples are first lysed and homogenized using Buffer FS. RNA in the homogenate is then selectively adsorbed on to the spin column. Finally, the total RNA is eluted from the membrane by the addition of RNase-Free Water. 3-5μg total RNA can be purified from 30mg filamentous fungi using this kit. Purified RNA is ready for most downstream applications such as RTPCR, Northern Blotting, Poly A+ purification, nuclease protection and in vitro translation. Features: 1. Fast. Using a rapid spin-column format, the entire procedure takes approximately 20 minutes. 2. High quality of RNA. OD260/280 of purified RNA is generally >1.8. 3. Intact RNA. RNA is purified with intergrity. 4. Economic. Transportation: at ambient temperature Components Buffer Rlysis-FG Universal GT Solution Universal NT Solution RNase-free Water EZ-10 Spin Column 2ml Collection Tube Protocol
BS91915 50 preps 25ml 18ml 6ml 5ml 50 50 1 Total RNA isolated from filamentous fungi using the Fungal RNA Mini-Preps Kit. Lane 1-3: Fungal total RNA.
Rapid Plant RNA Isolation Kit This kit is designed for the preparation of high quality total RNA from a wide variety of plant species and tissue types. Plant tissue is first lysed and homogenized using Buffer Rlysis-P. All contaminants, including polysaccharides and lipids, are removed by centrifugation. Purified RNA is ready for most downstream applications such as RT-PCR, Northern Blotting, Poly (A) purification, nuclease protection and in vitro translation Features: 1. Fast. The whole procedure can be completed in 40 minutes 2. High Quality of RNA. The OD260/OD280 of purified RNA is generally > 1.8 3. Versatile. Suitable for isolation of total RNA from a wide range of specimens such as Arabidopsis thaliana, tobacco, camphor and other samples. 4. Easy to scale up. 5. Economical. Transportation : at ambient temperature
Total RNA from a plant leaf purified using the Plant RNA Extraction Kit Components Buffer Rlysis-P Buffer PK RNase-free Water Protocol
PT4191 50 preps 35ml 4ml 5ml 1
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
169
2015-2016
Molecular Biology Kits
Product Catalog
EZ-10 Spin Column Plant RNA Mini-Preps Kit Plant polysaccharides and polyphenols have a tendency to form insoluble compounds with RNA, making the isolation of plant RNA a sometimesdifficult task. Our Total Plant RNA Purification Kit resolves this problem and can help you obtain the RNA samples you require for your research. RNA Purification using this kit is easy to operate, and the purified RNA sample is ready for most downstream applications such as RT-PCR, Northern Blotting, Poly A+ purification, nuclease protection and in vitro translation. Features: 1. Fast. Using a rapid spin-column format the entire procedure takes only 30 minutes. 2. Versatile. Suitable for the isolation of RNA from a wide range of specimens such as Arabidopsis thaliana, tobacco, camphor and other samples. 3. High Quality of RNA. The OD260/OD280 of purified RNA is generally > 1.9. 4. Economic. Transportation: at ambient temperature Components Buffer Rlysis-PG Universal GT Solution Universal NT Solution RNase-free Water EZ-10 Column 2-ml Collection Tube Protocol
BS82314 50 preps 25ml 18ml 6ml 5ml 50 50 1
Total RNA isolation from various plant species using the EZ10 Spin Column Plant RNA Mini-Prep Kit. Lane 1-2: Arabidopsis thaliana. Lane 3-4: Nicotiana tabacum. Lane 5-6: Spinacia oleracea. Lane 7-8: Oryza sativa. Lane 9-10: Cupressaceae. Lane 11-12: Cinnamomum camphora.
Rapid Viral RNA Extraction Kit This kit is designed for the preparation of high quality viral RNA from cell-free liquid specimens, including blood serum, urine, body fluids. This method is fast and easy to perform, and no mechanical disruption or column purification is required. Purified RNA is ready for most downstream applications including RT-PCR, Northern Blotting, Poly A+ purification, nuclease protection and in vitro translation. Features: 1. High recovery yield. >90% of viral RNA can be recovered. 2. Simple and rapid procedure. Entire procedure takes less than 30 minutes and can be completed in one tube. 3. High Quality of viral RNA: Complete removal of contaminants. Isolation of total RNA for use in a large range of applications 4. Economic. Transportation: at ambient temperature Components Buffer VG RNase-free Water Protocol
VT4184 50 preps 30ml 5ml 1
RNA isolated by Rapid Viral RNA Isolation Kit in Real-time PCR
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
170
2015-2016
Molecular Biology Kits
Product Catalog
EZ-10 Spin Column Viral Total RNA Extraction Kit This kit simplifies the isolation of viral RNA from cell-free body fluids with a fast spin-column format. Viral RNA binds specifically to the silica membrane while contaminants are removed in the flow-through. PCR inhibitors such as divalent cations and proteins are completely removed in two washing steps, leaving pure viral RNA to be eluted in RNase-free Water. Purified RNA is ready to use in RT-PCR, Northern blotting or other downstream applications. Features: 1. Fast. Using a rapid spin column format, the entire procedure takes about 20 minutes. 2. High Yield. The recovery yield of viral RNA is generally >85% 3. Versatile. Suitable for purification of viral RNA from a wide range of specimens, including serum, plasma, cell culture media, and milk. 4. Non-toxic. No Phenol/chloroform extraction. 5. Economic. Transportation: at ambient temperature VT82112 50 preps 30ml 12ml 5ml 50 50 1
Components Buffer Rlysis-VG Universal RPE Solution RNase-free Water EZ-10 Spin Column 2-ml Collection Tube Protocol
Rapid Animal Total RNA Extraction Kit This kit is designed for the preparation of high quality total RNA from animal tissue samples, including skeletal muscle, heart and connective tissues. Animal tissue is lysed and homogenized by Buffer Rlysis-A. RNA is then recovered by precipitation with Buffer LD. 10μg total RNA can be purified from 25mg animal tissue using this kit. Purified RNA is ready for most downstream applications such as RT-PCR, Northern Blotting, Poly (A) purification, nuclease protection and in vitro translation. Features: 1. Simple and rapid. The entire procedure takes approximately 40 minutes. 2. High Purity of RNA. OD260/OD280 ratio of purified RNA is generally 1.9-2.0. 3. Compatible with many downstream applications, including RT-PCR, Northern Blotting, cDNA synthesis, Poly (A) purification, nuclease protection and in vitro translation. 4. Easy to scale up. 5. Economic. Transportation: at ambient temperature Components Solution A Protocol
AT4181 50 preps 50ml 1
RNA isolated from various animal tissues using the Rapid Animal Total RNA Extraction Kit. Lane 1-2: rat muscle RNA. Lane 3-4: mouse liver RNA. Lane 5-6: fish RNA. M: DNA marker
AT4182 250 preps 250ml 1
EZ-10 Spin Column Animal Total RNA Mini-Preps Kit The EZ10 Spin Column Animal Total RNA Purification Kit provides a simple, rapid method for preparation of high-purity total RNA. The reagent contains guanidine isothiocyanate and β-mercaptoethanol that inactivate the ribonucleases present in cell extracts. RNA in the whole homogenate is selectively adsorbed on the spin column (silica membrane) while other impurities are washed away. Total RNA is eluted from the membrane by the addition of RNase-free water. Features: 1. Fast. Using a rapid spin-column format, the entire procedure takes approx 15 minutes. 2. High Purity of RNA. OD260/OD280 ratio of purified RNA is generally > 1.9. 3. Compatible with downstream applications such as Northern Blots, cDNA synthesis, RT-PCR and qRT-PCR. 4. High integrity. Buffer AG maintains the integrity of the RNA 5. Economic. Transportation: at ambient temperature Components Buffer Rlysis-AG Universal GT Solution Universal NT Solution RNase-free Water
BS82312 50 preps 25ml 18ml 6ml 5ml
BS82322 250 preps 125ml 90ml 30ml 25ml
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
171
2015-2016
Molecular Biology Kits
Product Catalog
EZ-10 Spin Column 2-ml Collection Tube Protocol
50 50 1
250 250 1
Total RNA purified using the EZ-10 Column Animal Total RNA Mini-Prep Kit. M: Marker; Lane 1-3: Rat tissue total RNA.
Rapid Blood RNA Isolation Kit This kit is designed for the preparation of high quality total RNA from anticoagulated blood. 20μg total RNA can be purified from 1ml anticoagulated blood using this kit. Purified RNA is ready for most downstream applications such as RT-PCR, Northern Blotting, Poly (A) purification, nuclease protection and in vitro translation. Features: 1. Fast. The entire procedure can be completed in 40 minutes. 2. Simple. Red Blood Cell Lysis Buffer is not required. 3. Easy to scale up. 4. Economic. Transportation: at ambient temperature Components Buffer Rlysis-R Buffer NS-A 2% SDS Solution RNase-free Water Protocol
BT4182 10 preps 3ml 4.5ml 0.5ml 6ml 1
BT4183 50 preps 12ml 22.5ml 2.5ml 30ml 1
BT4184 250 preps 60ml 108ml 12ml 150ml 1
Total RNA was isolated from 0.75ml rabbit whole blood using Rapid Blood RNA Isolation Kit and dissolved in 20ul water. 10ul was used in formaldehyde denaturing gel electrophoresis.
EZ-10 Spin Column Blood RNA Mini-Preps Kit The Blood total RNA Purification Kit provides a quick and simple method for preparation of high-purity intact total RNA. The reagent contains guanidine isothiocyanate and β-mercaptoethanol that inactivate the ribonucleases present in cell extracts. RNA in the whole homogenate is selectively adsorbed on the spin column while other impurities are washed away. Total RNA is eluted from the membrane in presence of RNasefree water. 5-15μg total RNA can be purified from 200μl anticoagulated blood using this kit. Purified RNA is ready for most downstream applications including RT-PCR, Northern Blotting, Poly (A) purification, nuclease protection and in vitro translation. Features: 1. Fast. Using rapid spin column format, the entire procedure takes 30 minute. 2. Simple. Red Blood Cell Lysis Buffer is not required. 3. High Quality of RNA. 4. Economic. Transportation: at ambient temperature Components Buffer Rlysis-R Buffer NS-A 2% SDS Solution Universal GT Solution Universal NT Solution RNase-free Water EZ-10 Column 2-ml Collection Tube Protocol
BS82313 50 preps 12ml 22.5ml 2.5ml 18ml 6ml 30ml 50 50 1
Agarose gel electrophoresis of total RNA from rat anticoagulated blood. Lane 1-3: blood total RNA.
mRNA Purification Kit from Total RNA This kit provides a convenient and easy-to-follow method for purification of mRNA from total RNA. Each prep can use up to 10ug total RNA as starting material. mRNA is selectively bound on oligo-dT cellulose, while 99% of the remaining RNA, including rRNAs and tRNAs, do not bind. Purified mRNA can be used for Norhtern blotting, RT-PCR, in vitro translation, differential display, cDNA synthesis or library construction, among others. Features: 1. Fast. The entire procedure takes only 30 minutes. 2. High Quality of mRNA. OD260/OD280 of purified mRNA is generally >1.8. 3. Compatible with many downstream applications. 4. Easy to scale up. Transportation: At ambient temperature Components 2X Binding Buffer 1X Binding Buffer Wash Solution
MT91928 25 Preps 15ml 40ml 30ml
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
172
2015-2016
Molecular Biology Kits
Product Catalog
RNA Elution oligo-dT cellulose LPA RNase-free Water Protocol
20ml 125mg 200ul 10ml 1
EZ-10 Spin Column Bacterial Total RNA Mini-Preps Kit The kit allows efficient purification of total RNA from various samples. Total RNA is easily purified from animal or human cells/tissues using a simple spin format. 5-15μg total RNA can be purified from 25mg animal tissue using this kit. Purified RNA is ready for most downstream applications such as RTPCR, Northern Blotting, Poly(A)+ selection and in vitro translation. Features: 1. Fast. Using rapid spin column format and fast lysis buffer the whole procedure takes less than 30 minutes. 2. High Quality of RNA. Purified RNA has an OD260/OD280 ratio of 1.9-2.0. 3. Economic. Transportation: At ambient temperature.
Components
BS88583 50 preps
BS88586 250 preps
Buffer RLT
20ml
100ml
DW Solution (concentrate)
36ml
180ml
RPE Solution (concentrate)
112ml
60ml
RNase-free Water
5ml
25ml
Proteinase K
0.6 ml
3 ml
EZ-10 Column
50
250
2-ml Collection Tube
50
250
Protocol
1
1
Fig. 1. Total RNA purified from E. coli using the EZ10 Column Bacteria Total RNA Mini-Prep Kit.
M: Marker; Lane 1-2: E. coli total RNA.
RNAse Free DNAse Set Buffer RDD is optimized for on-column DNase Digestion. The buffer is also well-suited for efficient DNAase digestion in solution. DNAse is supplied in liquid form. Store at -20°C for up to 9 months. No freeze-thaw. BS88253 Components 50 preps RNase-Free DNAse (1U/ul)
1.5ml
Buffer RDD
3ml
RNase-free Water
2ml
Protocol
1
EZ-10 DNAway RNA Mini-Preps Kit This kit is designed to purify RNA from small amounts of animal cells or tissues. Samples are lysed and homogenized by Buffer Lysis-DR. Genomic DNA contamination is removed using a gDNA Eliminator column. Purified RNA is ready for most downstream applications including RTPCR, Northern Blotting, Poly(A)+ selection and in vitro translation. Features: 1. Efficient. Remove DNA during RNA purification. 2. High Quality of RNA. Purified RNA has an OD260/OD280 ratio of 1.9-2.0. 3. Fast. Entire procedure can be completed in 30 minutes. Transportation: At ambient temperature.
Components
BS88133 50 preps
BS88136 250 preps
Buffer Rlysis-DR
20ml
100ml
GT Solution
18ml
90ml
NT Solution
6ml
30ml
RNase-free Water
5ml
25ml
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
173
2015-2016
Molecular Biology Kits
Product Catalog
gDNA Eliminator Column
50
250
EZ-10 Column
50
250
Protocol
1
1
Fig. 1. Total RNA purified from E. coli using the EZ10 Column Bacteria Total RNA Mini-Prep Kit. M: Marker; Lane 1-2: E. coli total RNA.
Gel Extraction Kit Gel Extraction Kit is an excellent tool offering a rapid and economic method to extract DNA from an agarose gel. This technology is based on binding DNA to silica-based membrane, followed by subsequent wash steps and then elute pure ready-to-use DNA. The high quality of extracted DNA can be used directly for any critical downstream application. Specification: Sampling
Recovery
Volume of Eluate
Handling Time
25 ~ 50 L
Within 25 min
Up to 200 mg 70 ~ 95 % Agarose Gel Transportation: At ambient temperature.
Components
9K-006-0001s
9K-006-0001
9K-006-0002
10 Preps
100 Preps
200 Preps
GEL 1 Solubilization Solution
10 ml
100 ml
200 ml
GEL 2 Washing Solution*
3 ml
30 ml
60 ml
GEL 3 Elution Solution
1 ml
10 ml
20 ml
GEL Column
10
100
200
Collection Tube 10 100 200 * Add 7 ml / 70 ml / 140 ml of ethanol (96 ~ 100%) to GEL 2 Washing Solution when first open.
PCR Purification Kit Bio Basic Inc’s PCR Purification Kit is an excellent tool offering a rapid and economic method to purify DNA samples from any enzymatic reactions. This technology is based on binding DNA to silica-based membrane, followed by subsequent wash steps and then elute pure ready-to-use DNA. The very high quality purified DNA can be used directly for any critical downstream application. Specification: Sampling
Recover
Up to 100 L of PCR / Enzymatic reaction Transportation: At ambient temperature.
Components
Volume of Eluate
80 ~ 95 %
Handling Time
25 ~ 50 L
Within 15 min
9K-006-0003s
9K-006-0003
9K-006-0004
10 Preps
100 Preps
200 Preps
PCR 1 Dilution Solution*
4 ml
40 ml
80 ml
PCR 2 Washing Solution**
2 ml
20 ml
40 ml
PCR 3 Elution Solution
1 ml
10 ml
20 ml
GEL Column
10
100
200
Collection Tube
10
100
200
* Add 1.7 ml/17 ml /34 ml of ethanol (96 ~ 100%) to PCR 1 Dilution Solution when first open. ** Add 8 ml/80 ml/160 ml of ethanol (96 ~ 100%) to PCR 2 Washing Solution when first open.
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
174
2015-2016
Molecular Biology Kits
Product Catalog
Plasmid DNA Miniprep Kit Bio Basic Inc’s Plasmid DNA Extraction Miniprep Kit is an excellent tool offering a speed and economic method to purify plasmid DNA from bacteria cultures. This technology is based on binding DNA to silica-based membranes in chaotropic salts and washing DNA with specially formulated solutions. Compared with other harmful and time-consuming procedures, such as phenol / chloroform extraction and ethanol precipitation, Feldan Plasmid DNA Extraction Miniprep Kit shortens the handling time to about 25 min. The high quality plasmid DNA can be used directly for any downstream applications. Specification: Sampling
Yield
up to 20 g for high-copy plasmids
1~5 ml overnight culture
Handling Time
~25 min
Transportation: At ambient temperature. Components MINI 1 Resuspension Solution
9K-006-0009s 10 Preps 3 ml
9K-006-0009 100 Preps 30 ml
9K-006-0010 200 Preps 60 ml
MINI 2 Cell Lysis Solution
3 ml
30 ml
60 ml
MINI 3 Neutralization Solution
4 ml
40 ml
80 ml
MINI 4 Washing 1 Solution
3.5 ml
35 ml
70 ml
(concentrated)* MINI 5 Washing 2 Solution (concentrated)** MINI 6 Elution Solution
2 ml
20 ml
40 ml
RNase A (50mg/ml)
6 L
60 L
120 L
MINI Column
10
100
200
Collection Tube 10 100 * Add 1,5 ml/15 ml/30ml ethanol (96 ~ 100%) to MINI 4 Washing 1 Solution before first use. ** Add 8 ml/80 ml/160ml ethanol (96 ~ 100%) to MINI 5 Washing 2 Solution before first use.
200
Genomic DNA Prep Kit Blood 9K-006-0013 (400 preps) / 9K-006-0018 (3300 preps) Note: If you are using mammalian cells from cell culture, please start with pelleted cells at step 2. It is possible to use up to 6x106 cells per prep. 1. Add 300L of whole blood (or bone marrow) to a 1.5ml microcentrifuge tube containing 900L of RBC Lysis Solution. Incubate for 3min. at room temperature. (Note: If blood collection occured >1 hour ago, increase the incubation time to 10min to complete cell lysis. 2. Centrifuge for 30 sec. at 13,000-16,000xg. Remove the supernatant with a pipet for leaving behind the visible white cell pellet and about 10-20L of the residual liquid. 3. Vortex the tube vigorously for 10 sec. to resuspend the white cells in the residual liquid. (The white cells should be completely 4. Add 300L Cell Lysis Solution to the resuspend cells and pipet up and down to release the cells. 5. Add 100L of Protein Precipitation Solution to the cell lysate. 6. Vortex vigorously for 20 sec. to mix well. 7. Centrifuge at 13,000 ~16,000xg for 1min. The precipitated proteins should form a tight, dark brown pellet. (If the protein pellet is not tight, repeat Step 6, followed by incubation on ice for 5min then repeat Step 7.) 8. Transfer the supernatant to a clean1.5ml microcentrifuge tube containing 300L of 100% Isopropanol (2-propanol ). 9. Mix the sample thoroughly by gentle inversions. 10. Centrifuge at 13,000-16,000xg for 1 min. (White DNA pellet will be formed.) 11. Discard the supernatant and drain tube briefly on clean absorbent paper. Add 300L of 80% Ethanol and invert the tube several times to wash the DNA pellet. 12. Centrifuge at 13,000-16,000xg for 1 min. Carefully discard the ethanol and dry at room temperature for about 10~15 min. 13. Add 50L~100L of DNA Hydration Solution. 14. Vortex 5 sec. at medium speed to mix. 15. Incubate the sample at 65°C for 10~30 min. 16. Store the DNA at 4°C. (For long time storage, store sample at -20°C or -80°C).
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
175
2015-2016 Product Catalog
Molecular Biology Kits
Genomic DNA Prep Kit Bacteria 9K-006-0014 (400 preps) / 9K-006-0019 (3300 preps) Prepare 100% Isopropanol and 80% Ethanol before using kit. Please follow instruction on the provided vials to obtain recommended enzyme concentration: Lysozyme (100mg/ml) RNaseA (4mg/ml ) and store those solutions at -20°C. Preheat a bath at 37°C and 65°C for incubations. 1. Transfer 1 ml of cultured cell to a 1.5 ml microcentrifuge tube. In case cell density is low, 2ml of Cultured cells can be used. 2. Harvest the cells by centrifugation (13,000 ~16,000xg, 1 min.) and discard the supernatant. 3. Resuspend the cell pellet in 300L of Cell Resuspension Solution. 4. Add 2L of Lysozyme (100 mg/ml ) and mix well by inverting. 5. Incubate the tube at 37°C for 1 hour. 6. Centrifuge (13,000 ~ 16,000xg for 1 min.) and discard the supernatant. 7. Resuspend the pellet in 300L of Cell Lysis Solution. RNase Treatment 8. Add 1.5L of RNase A (4mg/ml) and mix by inverting. 9. Incubate at 37°C for 15 ~16 min. and cool on ice for 1 min. Protein Precipitation 10. Add 50~100L of Protein Precipitation Solution and vortex vigorously for 20 ~ 30 sec. 11. Centrifuge at 13,000 ~16,000xg for 5 min. 12. Transfer the supernatant to a clean 1.5ml micro tube containing 300L of 100% Isopropanol. 13. Mix the sample thoroughly by gentle inversions. 14. Centrifuge at 13,000 ~16,000xg for 1 min. (White DNA pellet will be formed.) 15. Discard the supernatant and drain tube briefly on a clean absorbent paper. Add 500L of (80% Ethanol) and invert the tube several times to wash the DNA pellet. 16. Centrifuge at 13,000 ~ 16,000xg for 1 min. Carefully discard the Ethanol. 17. Air dry at room temperature for 10 ~15 min. DNA Hydration 18. Add 20 ~100L of DNA Hydration Solution to the dried DNA pellet. 19. Hydrate the DNA by incubating at 65°C for 1 hour. 20. Store the DNA at 4°C. (For long time storage, store at -20°C or -80°C).
Genomic DNA Prep Kit Plant 9K-006-0015 (400 preps) / 9K-006-0020 (3300 preps) Prepare Isopropanol and 80% Ethanol before using the Kit. Please follow instructions on the vial to prepare the provided RNase A solution (4mg/ml) and store at -20oC. Prepare a bath at 65oC for incubation. Sample collection & Handling • Fresh or frozen tissue must be finely ground with a mortar and pestle in liquid nitrogen before DNA isolation. • Work quickly and keep tissue cold to minimize DNAase activity. Cell Lysis 1. Transfer the finely ground tissue (10~30mg) to a 1.5ml microcentrifuge tube. 2. Add 300L of Cell Lysis Solution to the tissue. 3. Incubate at 65°C for 60 min. mix invert the tube every 5~10 min. during the incubation. RNase Treatment 4. Add 1.5L of RNase A (4mg/ml) to the cell lysate. 5. Mix the sample by inverting the tube 25 times and incubate at 37°C for 15~60 min. Protein Precipitation 6. Cool the sample to room temperature and add 100L of Protein Precipitation Solution to the cell lysate. 7. Mix the solution by vortex. 8. Centrifuge at 13,000-16,000xg for 3min. (The precipitant should form a tight, green pellet. If the pellet is not tight, repeat step 7, incubate on ice for 10 min. and then repeat Step 8.) DNA Precipitation 9. Transfer supernatant to a clean 1.5ml microcentrifuge tube containing 300L of 100% Isopropanol (2-propanol). 10. Mix the sample thoroughly by gentle inversions. 11. Centrifuge at 13,000~16,000xg for 1min (white DNA pellet will be formed). 12. Discard the supernatant and drain tube briefly on clean absorbent paper. Add 300L of 80% Ethanol and invert tube several times to wash the DNA Pellet. 13. Centrifuge at 13,000~16,000xg for 1 min. Carefully discard the ethanol. 14. Air dry at room temperature for 10~15 min. DNA Hydration 15. Add 50L ~100L of DNA Hydration Solution to the dried DNA pellet. 16. Hydrate the DNA by incubating sample at 65°C for 1 hour. 17. Store DNA at 4°C (For long time storage, store at -20°C or -80°C).
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
176
2015-2016 Product Catalog
Molecular Biology Kits
Genomic DNA Prep Kit Fungi 9K-006-0016 (400 preps) / 9K-006-0021 (3300 preps) Prepare 100% Isopropanol and 80% Ethanol before using kit. Please follow instruction on the provided vials to prepare the RNase A solution (4mg/ml) and the proteinase K solution (20mg/ml) and store those vials at -20°C. Preheat a bath at 55°C for Proteinase K reaction incubation then at 65°C for RNase reaction incubation. Cell Lysis 1. Transfer 1ml of the cultured cell into a 1.5ml microcentrifuge tube. Alternatively, use 50-100mg of fungal tissue or 2-3 pieces of 0.5x1cm of Cultured plate. 2. Harvest the cell by centrifuge (13,000~16,000xg, 1 min.) and discard supernatant. 3. Resuspend the cell pellet in 300L of Cell Resuspension Solution. 4. Add 1.5L of Proteinase K (20mg/ml) and mix by inverting gently but thoroughly. 5. Incubate the tube at 55oC for 1hour. 6. Centrifuge (13,000~16,000xg, 1 min.), and discard the supernatant. 7. Resuspend the pellet in 300L of Cell Lysis Solution. Protein Precipitation 8. Add 100L of Protein Precipitation Solution and vortex vigorously for over 20 sec. 9. Centrifuge at 13,000~16,000xg for 5 min. DNA Precipitation 10. Transfer the supernatant to a clean1.5ml microcentrifuge tube containing 300L 100% Isopropanol (2-propanol). 11. Mix the sample by inverting gently but thoroughly. 12. Centrifuge at 13,000-16,000xg for 1 min. (white DNA pellet will be formed.) 13. Discard the supernatant and drain tube briefly on clean absorbent paper. Add 300L of 80% Ethanol and invert the tube several times to wash the DNA pellet. 14. Centrifuge at 13,000-16,000xg for 1 min. Carefully discard the Ethanol. 15. Air dry at room temperature for 10~15 min. DNA Hydration 16. Add 50L~100L of DNA Hydration Solution to the dried DNA pellet. 17. Hydrate the DNA by incubating at 65°C for 1 hour. 18. Add 1.5L of RNase A (4mg/ml) and incubate at 37°C for 60 min. 19. Store the DNA at 4oC. (For long time storage, store at -20°C or -80°C).
Genomic DNA Prep Kit Animal Tissue 9K-006-0016 (400 preps) / 9K-006-0021 (3300 preps) Prepare 100% Isopropanol and 80% Ethanol before using kit. Please follow instruction on the vials to prepare 4mg/ml RNaseA solution and 20mg/ml Proteinase K solution, then store those solutions at -20°C. Preheat a bath at 55°C for Proteinase K reaction incubation then at 65°C for RNase reaction incubation. Cell Lysis 1. Transfer 5~10mg of fresh tissue or frozen tissue to 1.5ml microcentrifuge tube. 2. Add 300l of Cell Lysis Solution to the tissue 3. Add 1.5L of Proteinase K (20mg/ml) to lysate and mix by inverting. Incubate at 55°C overnight or until the tissue has dissolved. Protein Precipitation 4. Cool the sample at room temperature and add 100L of Protein Precipitation Solution to the cell lysate. 5. Mix the solution well by vortex over 20 sec. 6. Centrifuge at 13,000~16,000xg for 3 min. (The precipitated protein should form a tight pellet. If the pellet is not tight, repeat step 5, incubate on ice for 10 min. and then repeat Step 6.) DNA Precipitation 7. Transfer the supernatant to a clean 1.5ml microcentrifuge tube containing 300L of 100% Isopropanol (2-propanol). 8. Mix the sample thoroughly by gentle inversions. 9. Centrifuge at 13,000~16,000xg for 1 min. The DNA will be visible as a pellet. 10. Discard the supernatant and drain tube briefly on clean absorbent paper. Add 300L of 80% Ethanol and invert tube several times to wash the DNA Pellet. 11. Centrifuge at 13,000~16,000xg for 1 min. Carefully discard the ethanol. 12. Air dry at room temperature for 10~15 min. DNA Hydration 13. Add 50L~100L of DNA Hydration Solution to the dried DNA pellet. 14. Hydrate the DNA by incubating sample at 65°C for 1 hour. 15. Add 1.5L of RNase A (4mg/ml) and incubate at 37°C for 30~60 min. 16. Store the DNA at 4°C (For long time storage, store at 20°C or -80°C).
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
177
2015-2016
Molecular Biology Kits
Product Catalog
Genomic DNA Prep Kit Yeast 9K-006-0017 (400 preps) / 9K-006-0022 (3300 preps) Prepare 100% Isopropanol and 80% Ethanol before using kit. Follow instruction on the provided vials of RNase A and Lyticase vial to obtain RNase A (4mg/ml) and Lyticase (2.5U/L) and store those vials at -20°C. Preheat a source at 65oC for RNase reaction incubation. Cell Lysis 1. Transfer 1ml of the cultured cell into a 1.5ml microcentrifuge tube. 2. Harvest the cell by centrifuging (13,000~16,000xg, 1 min.) and discard supernatant. 3. Resuspend the cell pellet in 300L of Cell Resuspension Solution. 4. Add 1L of Lyticase (2.5U/L) and mix by gentle inversions. 5. Incubate the tube at 37°C for 60 min. 6. Centrifuge (13,000~16,000g, 1 min), and discard the supernatant. 7. Resuspend the pellet in 300L of Cell Lysis Solution. Protein Precipitation 8. Add 100L of Protein Precipitation Solution and vortex vigorously for over 20 sec. 9. Centrifuge at 13,000~16,000xg for 5 min. DNA Precipitation 10. Transfer the supernatant to a clean1.5ml microcentrifuge tube containing 300L of 100% Isopropanol (2-propanol). 11. Mix the sample thoroughly by gentle inversions. 12. Centrifuge at 13,000~16,000xg for 1 min. (White DNA pellet will be formed.) 13. Discard the supernatant and drain the tube briefly on clean absorbent paper. Add 300L of 80% Ethanol and invert the tube several times to wash the DNA pellet. 14. Centrifuge at 13,000~16,000xg for 1 min. Carefully discard the ethanol. 15. Air dry at room temperature for 10~15 min. DNA Hydration 16. Add 50L~100L of DNA Hydration Solution to the dried DNA pellet. 17. Hydrate the DNA by incubating at 65°C for 1 hour. 18. Add 1.5Lof RNase A (4mg/ml) and incubate at 37°C for 30 min. 19. Store the DNA at 4°C. (For long time storage, store at -20°C or -80°C).
Plasmid DNA Maxi Kit Bio Basic Inc’s Plasmid DNA Extraction Maxiprep Kit is an excellent tool offering a rapid and economic method to purify plasmid DNA from bacteria cultures. This technology is based on alkaline lysis and purification by Anion-exchange chromatography. Compared with other harmful and time-consuming procedures such as phenol / chloroform extraction and ethanol precipitation, Bio Basic’s Plasmid DNA Extraction Kit shortens the handling time to about 2 hours. The high quality plasmid DNA can be used directly for any downstream applications. Specification: Sampling Yield Handling Time
100~250 ml of bacteria culture for high copy plasmids 200~400 ml of bacteria culture for low copy plasmids Transportation: At ambient temperature. Components
up to 500 g for high-copy plasmid
About 2 hours
MAXI 1 Resuspension Solution
9K-006-0023s 1 Preps 11 ml
9K-006-0023 10 Preps 110 ml
9K-006-0027 30 Preps 3X110 ml
MAXI 2 Cell Lysis Solution
11 ml
110 ml
3X110 ml
MAXI 3 Neutralization Solution
11 ml
110 ml
3X110 ml
MAXI 4 Equilibration Solution
13.5 ml
135 ml
3X135 ml
MAXI 5 Washing Solution
55 ml
2X275 ml
6X275 ml
MAXI 6 Elution Solution
13.5 ml
135 L
3X135 L
RNase A (50 mg / ml)
22 L
220 L
3X220 L
MAXI Column
1
10
30
Collection Tube
1
100
30
1. Solutions provided in this kit contain irritants, wear gloves and lab coat when handling. 2. Briefly spin RNase A tube to remove drops from the inside of the lid. Transfer tube content into MAXI 1 Resuspension Solution bottle. Add 250µL of MAXI 1 Resuspension Solution into RNase A tube, rinse tube inside and transfer back into MAXI 1 Resuspension Solution bottle. Store at 4°C. 3. Check MAXI 2 Cell Lysis Solution before use. Warm MAXI 2 Cell Lysis Solution at 37°C if any precipitation formed. Prevent vigorous shaking of the MAXI 2 Cell Lysis Solution. 4. To avoid acidification of MAXI 2 Cell Lysis Solution from CO2 in the air, close the bottle immediately after use.
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
178
2015-2016 Product Catalog
Molecular Biology Kits
Columns & 96 Well Plates Code
Description
Size
SD5005
EZ-10 Column & collection tube (blue tube, clear ring, clear collection)
100
SD5005-EMPTY
EZ-10 Empty Column without filter, without collection tube & O-ring
1000
SD5008
EZ10 RNA Column & collection tube(clear tube, clear ring, clear collection)
100
SD5003
EZ-200 Column & collection tube (set)
12
SD5004
EZ-500 Column & collection tube (set)
12
SD5006
96 well filter plate (960ul each well)
12
SD5006-EMPTY
96 well filter plate (no filter)
12
SD5007
96 well DNA plate with membrane (960ul each well)
12
SD5009
96 well RNA plate with membrane (960ul each well)
12
SD5010
96 well sample storage plate (200ul each well), 10/PK
1PK
SD5011
96 Well Vacuum System
1
SD5012
Medi preps or Maxi preps Column Plug
1
BR480-N
48 WELL 4ML U-SHAPED DEEP-WELL PLATES, 10/BAG
1PK
BR581-96N
96 WELL 2ML DEEP PLATE, NATURAL,EDGE FILLED, 10PLATES/BAG
1PK
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
179
2015-2016 Product Catalog
PCR Related Products & DNA, RNA Modifying Enzymes
A. PCR Related Products A-1 Standard PCR Taq DNA Polymerase (5U/ul) (Supplied with 10×reaction buffer and 20mM magnesium sulfate) Code Size B0089-200U 200 U B0089-5×200U 5×200 U B0089-1000U 1, 000U B0089-5×1000U 5×1,000 U Bulk Storage: -20°C Taq is a thermostable DNA Polymerase isolated from a strain of Thermus sp. It is designed for use in primer extension reactions. Taq is highly purified. No detectable contaminating endonuclease, exonuclease and nicking activity observed. O Quality Testing: For endonuclease assay, 1g of Lambda-HindIII DNA is incubated with 20 units of the enzyme in assay buffer at 75 Cfor 16 hrs and no visible contaminating activity is observed. For exonuclease assay, 1g of pBR322 plasmid DNA is incubated with 10 units of O the enzyme for 16 hrs at 75 C in assay buffer and no detectable activity is observed. Moreover, the purity of the enzyme is also detectable by adding 10 units of Taq DNA Polymerase in 0.1ml buffer of a reaction mixture for making first strand cDNA at beginning and no impaired effect on the first strand cDNA is observed. Unit Definition: One unit incorporates 10nmole of dNTP into acid-insoluble material in 30 min. at 74°C Concentration in 5 units/ul in 100mM KCl, 20mM Tris HCl ( pH 8.0, 22°C ), 0.1mM EDTA, 0.5mM PMSF, 1mM DTT, 50% glycerol. Storage Buffer: 10×Tsg Reaction Buffer: 100mM KCl, 100mM (NH4)2SO4, 200mM Tris HCl (pH 8.75) at 22°C, 1% Triton X-100 and 1mg/ml BSA. Buffer is optimized for use with 200uM dNTPs. Magnesium 20mM MgSO4. The final magnesium sulfate may be variable according to individual requirements. In general, 2mM MgSO4 is recommended. Sulfate: Primer Extension Taq has the template-independent terminal transferase activity which results in the addition of a single nucleotide Characteristics: (adenosine) at 3’ end of extension product. So TA cloning vector is recommended if the extension product is needed to be cloned. Storage: -20°C * This product is not available in Canada Taq DNA Polymerase (5U/ul) (High Purity) (Supplied with 10×reaction buffer and 20mM magnesium sulfate) Code Size HTD0078-200U 200 U HTD0078-5×200U 5×200 U HTD0078-1000U 1, 000U HTD0078-5×1000U 5×1,000 U Bulk Storage: -20°C Taq is a thermostable DNA Polymerase isolated from a strain of Thermus sp. It is designed for use in primer extension reactions. No detectable contaminating endonuclease, exonuclease and nicking activity observed in Taq DNA Polymerase. Taq DNA Polymerase (High Purity) is further purified from Taq DNA Polymerase and therefore has a higher purity grade than Taq DNA polymerase. Quality Testing: For endonuclease assay, 1g of Lambda-HindIII DNA is incubated with 20 units of the enzyme in assay buffer at 75°C for 16 hrs and no visible contaminating activity is observed. For exonuclease assay, 1g of pBR322 plasmid DNA is incubated with 10 units of the enzyme for 16 hrs at 75°C in assay buffer and no detectable activity is observed. Moreover, the purity of the enzyme is also detectable by adding 10 units of Taq DNA Polymerase in 0.1ml buffer of a reaction mixture for making first strand cDNA at beginning and no impaired effect on the first strand cDNA is observed. Unit Definition: Concentration in Storage Buffer: 10×Tsg Reaction Buffer: (New!) Magnesium Sulfate: (New!) Primer Extension Characteristics:
One unit incorporates 10nmole of dNTP into acid-insoluble material in 30 min. at 74°C. 5 units/ul in 100mM KCl, 20mM Tris HCl ( pH 8.0, 22°C ), 0.1mM EDTA, 0.5mM PMSF, 1mM DTT, 50% glycerol,.
100mM KCl, 100mM (NH4)2SO4, 200mM Tris HCl (pH 8.75) at 22°C, 1% Triton X-100 and 1mg/ml BSA. Buffer is optimized for use with 200uM dNTPs. 20mM MgSO4. The final magnesium sulfate may be variable according to individual requirements. In general, 2mM MgSO4 is recommended. Taq has the template-independent terminal transferase activity which results in the addition of a single nucleotide (adenosine) at 3’ end of extension product. So TA cloning vector is recommended if the extension product is needed to be cloned. Storage: -20°C * This product is not available in Canada
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
180
PCR Related Products & DNA, RNA Modifying Enzymes
2015-2016 Product Catalog
3G HotStart Taq DNA Polymerase (5U/ul) (Supplied with 10 x reaction buffer and 25mM magnesium sulfate) 3G HotStart Taq DNA Polymerase includes recombinant Taq DNA Polymerase and a kind of primer matching factor (PMF) for automatic hot start PCR. It is a new generation of hot start DNA polymerase, features PMF keeping primers free at ambient temperature and catalyzing the oligos binding precisely to DNA templates at annealing temperature. In contrast to chemically modified or antibody based hot start DNA polymerase, 3G HotStart Taq DNA polymerase promotes accurate primer-template annealing and prevents mispriming at each PCR cycle, which guarantees the least dimmer and non-specific products formation. Advantages: Increased specificity; Prevents the formation of primer dimmers; Reaction can be setup at ambient temperature; Robust yields with minimal optimization; Incorporate dUTP and dITP; Excellent performance in multiplex PCR; Hot start does not require extra activation step Unit Definition: One unit is defined as the amount of enzyme required to incorporate 10 nmoles of dNTP into acid-insoluble material in 30 min at 74°C. Quality Assurance: No detected endonuclease, exonuclease and nicking activities Storage Buffer: 50mM Tris-HCl (pH 8.0), 100mM NaCl, 0.1mM EDTA, 5mM DTT, 50% glycerol and 1.0% Triton7X-100. 10X Reaction Buffer: 200mM Tris-HCl (pH 8.4), 200mM KCl, 25mM MgCl2 supplied separately. Magnesium Chloride: 25mM MgCl2. The final magnesium chloride concentration may be variable according to individual requirements. In general, 1.5mM MgCl2 is recommended. Storage: -20°C
Code 3GHST81
Size 500 U
3GHST81
5x500 U Bulk
Tsg DNA Polymerase (5 u/ul) (Supplied with 10×reaction buffer and 20mM magnesium sulfate) Code Size D0081-200U 200 U D0081-5×200U 5×200 U D0081-1,000U 1, 000U D0081-5×1,000U 5×1,000 U Bulk Storage: -20°C Tsg DNA Polymerase is a thermostable DNA Polymerase isolated from a strain of Thermus sp. Tsg has a half life of 3 hours at 95°C, 6 and is therefore more stable than Taq DNA Polymerase. Tsg has high fidelity with an error frequency 10/10 (or 0.01/103) during DNA synthesis. Taq is designed for use in primer extension reaction. Tsg can also be used for sequencing. DNA sequencing at high temperature may decrease the secondary structure of some DNA templates and permit polymerization through base-paired region. DNA sequencing with Tsg DNA Polymerase produces uniform band intensities and low background. Tsg DNA Polymerase is highly purified and free of contaminating endonucleases, exonucleases and nicking activity. For endonuclease assay, 1ug of Lambda / Hind III DNA was incubated with 20 units of the enzyme in assay buffer at 75°C for 16 hrs and no visible contaminating activity was observed; For exonucleases assay, 1ug of pBR322 plasmid DNA is incubated with 10 units of enzyme for 16 hrs at 75°C in assay buffer and no detectable exonuclease is observed. The purity of the enzyme is also evaluated by adding 10 units of Tsg DNA Polymerase in 100ul of a reaction mixture for making first strand cDNA at beginning and no impaired effect on the first strand is observed. Unit Definition: Concentration in Storage Buffer: 10×Tsg Reaction Buffer: (New!) Magnesium Sulfate: (New!) Primer Extension Characteristics: Storage:
One unit incorporates 10nmole of dNTP into acid-insoluble material in 30 min. at 74°C. 5 units/ul in 100mM KCl, 20mM Tris HCl ( pH 8.0, 22°C. ), 0.1mM EDTA, 0.5mM PMSF, 1mM DTT, 50% glycerol. 100mM KCl, 100mM (NH4)2SO4, 200mM Tris HCl (pH 8.75) at 22°C., 1% Triton X-100 and 1mg/ml BSA. Buffer is optimized for use with 200uM dNTPs. 20mM MgSO4. The final magnesium sulfate may be variable according to individual requirements. In general, 2mM MgSO4 is recommended. Tsg has the independent terminal transferase activity which results in the addition of a single nucleotide (adenosine) at 3' end of the extension product. TA cloning vector is recommended if the extension product is needed to be cloned. -20°C.
A-2 High Fidelity PCR Pfu DNA Polymerase* (5 u/ul) (Supplied with 10×reaction buffer) Code B0093-100U B0093-5x100U Store: . -20°C
Size 100U 5x100U
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
181
PCR Related Products & DNA, RNA Modifying Enzymes
2015-2016 Product Catalog
Pfu DNA polymerase* is isolated from Pyrococcus furiosus. The multi-functional thermostable enzyme possesses both 5’ to 3’ DNA polymerase and 3’ to 5’ exonuclease activity, which results in a 12-fold increase in fidelity over Taq DNA polymerase. Pfu DNA polymerase has a temperature optimum of between 72°C and 78°C and remains more than 95% active following one hour incubation at 95°C. Primer Extension Characteristics: Unit Definition: Concentration in Storage Buffer: 10×Reaction Buffer: Stability: Storage:
As Pfu DNA Polymerase possesses both of 5’ to 3’ polymerase and 3’ to 5’ exonuclease activity, it produces blunt ends during DNA synthesis One unit incorporates 10nmol of dNTP into acid-insoluble material within 30 min at 72°C. 5 units /ul in 50mM Tris HCl (pH8.2), 0.1mMEDTA, 1mM DTT, 0.1% Tween 20, 0.1% Nonidet P-40 and 50% glycerol ( v/v) 200mM TrisHCl ( pH 8.8), 100mM KCl, 100mM (NH4)2SO4, 20mM MgSO4, 1% Triton X-100, and 1mg/ml nuclease-free bovine serum albumin Pfu DNA Polymerase is stable within twelve months after receiving -20°C
* This product is not available in US, Europe and Japan.
A-3 Long Range PCR Taq Plus DNA Polymerase (5 u/ul) (Supplied with 10×reaction buffer) Code D0090-200U D0090-5×200U Store: . -20°C
Size 200U 5×200U
Taq Plus is a mixture of Taq and Pfu. Taq is a thermostable DNA polymerase isolated from a strain of Thermus sp. (product number B0089). Taq Plus is used to improve the reliability and yield of conventional primer extension reaction. Taq Plus has two advantages 6
over Taq Plus: high fidelity with an error frequency 1.6/10 during DNA synthesis. Taq Plus increases the efficiency of the polymerization reaction, resulting in a greater percentage of extenuation reaction completion up to 10-30 kb. Pfu has a temperature optimum of between 72-78°C and remains > 95% active following 1-hour incubation at 95°C. Concentration: 10×Taq Plus reaction buffer: Reaction Conditions:
Optimization of DNA synthesis:
Storage:
1ul contains pfu and 5 units Taq DNA Polymerase 200mM TrisHCl ( pH 8.8),100mM KCl,100mM (NH4)2 SO4,20mM Mg SO4 ,1% Triton X-100,1 mg /ml bovine serum albumin ( BSA ) Note: All reagents, including Taq Plus, should be mixed immediately before use. DNA synthesis is performed in a 100ul mixture containing 20-200uM dNTPs, 0.3-1 uM Primers, 0.1- 0.25 ng of template DNA, 10ul of 10×reaction buffer and 2.5-5 units of Tsg Plus. Mix the reaction gently, centrifuge briefly and then overlay with light mineral oil. Initially, denature the reaction by incubating at 95°C for 5 minutes and then cool to 40-68°C for 5 minutes to allow the primers to anneal to the template DNA. It is important to add the reaction components in the following order: 1. H2O 2. 10×reaction buffer 3. dNTPs 4. DNA template and primers 5. Tsg Plus -20°C
Tsg Plus DNA Polymerase (5 u/ul) (Supplied with 10×Reaction Buffer) Code
Size
D0088-200U D0088-5×200U
200U 5×200U
Store: -20°C Tsg Plus is a mixture of Tsg and Pfu. Tsg is a thermostable DNA polymerase isolated from a strain of Thermus sp. (see product number D0081). Tsg Plus is used to improve the reliability and yield of conventional primer extension reactions. Tsg Plus has two advantages 6
over Taq Plus: high fidelity - with an error frequency of only 1.6/10 during DNA synthesis. Tsg Plus also increases the efficiency of the polymerization reaction, resulting in a greater percentage of extenuation reaction completion up to 10-30 kb. Pfu has a temperature optimum of between 72-78°C and remains > 95% active following 1-hour incubation at 95°C. Concentration: 1ul contains pfu and 5 units Tsg DNA Polymerase 200mM Tris HCl ( pH 8.8),100mM KCl,100mM (NH4)2 SO4,20mM Mg SO4 ,1% Triton X-100,1 mg /ml bovine serum 10×Tsg Plus reaction buffer: albumin ( BSA ) Note: All reagents, including Tsg Plus, should be mixed immediately before use. DNA synthesis is performed in a 100ul mixture containing 20-200uM dNTPs, 0.3-1 uM Primers, 0.1- 0.25 ng of Reaction template DNA, 10ul of 10×reaction buffer and 2.5-5 units of Tsg Plus. Mix the reaction gently, centrifuge briefly and Conditions: then overlay with light mineral oil. Initially, denature the reaction by incubating at 95°C for 5 minutes and then cool to 40-68°C for 5 minutes to allow the primers to anneal to the template DNA.
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
182
PCR Related Products & DNA, RNA Modifying Enzymes
2015-2016 Product Catalog
Optimization of DNA synthesis:
Storage:
It is important to add the reaction components in the following order: 1. H2O 2. 10×reaction buffer 3. dNTPs 4. DNA template and primers 5. Tsg Plus -20°C
A-4 RT-PCR (Reverse Transcription) AMV Reverse Transcriptase (10 u/ul) Supplied with 5×incubation buffer Code Size B0999 200U B0999 1000U Store:-20°C Avian Myeloblastosis Virus particles One unit of the enzyme is the amount required to catalyze the incorporation of 1nmol of dTTP into acid-insoluble form in 10 minutes at 37°C in a buffer containing: 50mM Tris, pH 8.3, 7mM MgCl2, 40mM KCl, 1mM DTT, 0.1mg/ml BSA, 0.5mM radio-labelled dTTP, 35ug/ml rA400:dT50 Incubation Buffer 50mM Tris, pH 8.3, 10mM MgCl2, 50mM KCl, 0.5mM Spermidine, 10mM DTT Storage Buffer: 100mM KPO4, pH 7.2, 2mM DTT, 0.2% Triton X-100 and 50% Glycerol Concentration: 10U/ul Purity of the enzyme: >95% Function Autoradiographic analysis of synthesized 1.2Kb cDNA DNase activity: 4500U/mg (50% Glycerol Solution) from Calf Intestine. Conjugation Grade. Specific activity approx 4500 U/mg Soluble in water or dilution buffer Alkaline phosphatase AP >4500U/mg (Ammonium sulfate suspension) from Calf Intestine. Conjugation Grade. Specific activity: approx 4500 U/mg Soluble in water or dilution buffer Alkaline phosphatase AP >4500U/mg (Freeze-dried powder) from Calf Intestine. Molecular Biology Grade. Specific activity: approx 4500 U/mg Soluble in water or dilution buffer, Free of endonuclease, exonuclease and RNase activities Alkaline phosphatase AP >4500U/mg (50% Glycerol Solution) from Calf Intestine. Molecular Biology Grade Specific activity: approx 4500 U/mg Soluble in water or dilution buffer, Free of endonuclease, exonuclease and RNase activities Alkaline phosphatase AP >4500U/mg (Ammonium sulfate suspension) from Calf Intestine. Molecular Biology Grade Specific activity: approx 4500 U/mg. Soluble in water or dilution buffer, Free of endonuclease, exonuclease and RNase activities
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
5 KU 5 KU 5 KU 5 KU 5 KU 5 KU
185
2015-2016 Product Catalog
PCR Related Products & DNA, RNA Modifying Enzymes
B-3 Thermophilic DNA Polymerases Taq DNA Polymerase (D0089) see Standard PCR. Tsg DNA (D0081) polymerase Standard PCR. HoTaq DNA Polymerase (BHT500 & BHT2500) see Standard PCR Pfu DNA polymerase (D0090P) see Standard PCR. Hot Start Taq DNA Polymerase see Standard PCR.
B-4 Mesophilic DNA Polymerases DNA Polymerase I (10U/ul) DNA Polymerase I is a DNA-dependent DNA polymerase that catalyzes 5' -> 3' synthesis of DNA and exhibits 3' -> 5’ exonuclease proofreading activity. 5' -> 3' exonuclease activity mediates nick translation during DNA repair. The enzyme is inactivated by heating at 75°C for 10 min or by addition of EDTA Applications: (1) Nick translation of DNA in making probes. (2) Second-strand synthesis of cDNA. Unit definition: One unit of enzyme required to catalyze the conversion of 10nmol of dNTPs into an acid-insoluble form in 30 min at 37°C using activated DNA as the template-primer. Storage Buffer: Supplied in 50% glycerol, 50mM Tris-HCl (pH 7.5), 0.1mM EDTA, 1mM DTT, 50.1mM NaCl, 0.1% Triton X-100. 10× Reaction Buffer: 500mM Tris-HCl (pH 7.5 at 25°C), 100mM MgCl2, 10mM DTT. Code Size BEP0041 500U Storage: -20°C phi29 DNA Polymerase (10U/ul) phi29 DNA Polymerase is an enzyme that assists in DNA replication. It has exceptional strand displacement and processive synthesis properties with an inherent 3´->5´ proofreading exonuclease activity. It is derived from E.coli cells possessing a cloned copy of Gene 2 of the Bacillus subtilis phage phi29 (F29). Applications: (1) Rolling circle amplification/replication (RCA/RCR). (2) Multiple displacement amplification (MDA). (3) Unbiased amplification of whole genome. (4) DNA template preparation for sequencing. (5) Protein-primed DNA amplification. (6) In situ genotyping with padlock probes. Unit definition: One unit of the enzyme catalyzes the incorporation of 0.5 pmol of dCMP into a polynucleotide fraction (adsorbed on DE81) in 10 min at 30°C. Storage Buffer: Supplied in 50mM Tris-HCl (pH 7.5), 0.1mM EDTA, 1mM DTT, 100mM KCl, 0.5% (v/v) Nonidet P40, 0.5% (v/v) Tween-20 and 50% (v/v) glycerol. 10X Reaction Buffer: 330mM Tris-acetate (pH 7.9), 100mM Mg-acetate, 660mM K-acetate, 1% (v/v) Tween 20, 10mM DTT. Code Size BEP0091 250U BEP0092 1000U Storage: -20°C T4 DNA Polymerase (5U/ul) A template-dependent polymerase possessing 5’ -> 3’ polymerase and 3’ -> 5’ exonuclease activities. Unlike DNA Polymerase I, T4 DNA Polymerase has much greater 3’ -> 5’ exonuclease activity, and no 5´-> 3´ exonuclease function. Applications: (1) Used to label DNA termini with protruding 5' ends (fill-in reaction). (2) Removal of 3'-A overhangs to form blunt-ends. (3) Labeling the 3’-termini of DNA molecules with flush or protruding ends (exchange reaction). (4) Oligonucleotide-directed site-specific mutagenesis. Unit definition: One unit of the enzyme converts 10nmol of dNTP into acid-insoluble material in 30 min at 37°C under standard assay conditions. Storage Buffer: Supplied in 50% glycerol, 50mM Tris-HCl (pH 7.5), 0.1M NaCl, 1mM DTT, 0.1mM EDTA, and 0.1% Triton X-100. 5× Reaction Buffer: 335mM Tris-HCl (pH 8.8 at 25°C), 33mM MgCl2, 5mM DTT, 84mM (NH4)2SO4 Code Size BEP0061 100U Storage: -20°C
B-5 Reverse Transcriptases AMV Reverse Transcriptase (B0999) see RT-PCR M-MuLV Reverse Transcriptase (B1552) see RT-PCR
B-6 RNA Polymerases T7 RNA Polymerase (10U/ul) T7 RNA Polymerase is a DNA-dependent RNA polymerase that catalyzes the formation of RNA in the 5'to 3' direction. It is extremely promoter-specific and only transcribes bacteriophage T7 DNA or DNA cloned downstream of a T7 promoter. Its source is the T7 bacteriophage, which is a virus that infects only bacteria. Applications: (1) Radiolabeled RNA probe preparation. (2) RNA generation for in vitro translation. (3) Expression control via anti-sense
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
186
2015-2016 Product Catalog
PCR Related Products & DNA, RNA Modifying Enzymes
RNA. Unit definition: One unit of the enzyme incorporates 1 n mol of AMP into a polynucleotide fraction (adsorbed on DE-81) in 60 minutes at 37°C. Storage Buffer: Supplied in 50mM Tris-HCl (pH 8.0), 150mM NaCl, 5mM DTT, 0.1 mg/ml BSA, 0.03% (v/v) ELUGENT Detergent, 50% (v/v) glycerol. 5X Reaction Buffer: 200mM Tris-HCl (pH 7.9 at 25°C), 30mM MgCl2, 50mM DTT, 50mM NaCl, 10mM spermidine. Code Size BEP0117 5,000 U Storage: -20°C
B-7 RNase Inhibitors & RNase-Be-Gone RB0478 Storage: -20°C
DB0339 Storage: 18-25°C
RT4201 Storage: 18-25°C
RNase Inhibitor ( Ribonuclease inhibitor) >40U/ul 50% glycerol solution. From Human Placenta Source. Unit Definition: One unit will reduce the activity of 5ng of ribonuclease A by 50% in a cytidine 2’, 3’-cyclic monophosphate system. Storage buffer: 50% glycerol solution containing 20mM HEPES-KOH, (pH 7.6), 50mM KCl and 8mM DTT. DNAse & RNase Away Solution Easy to use and safer than traditional alternatives such as DEPC. Ideal for removing nucleases and DNA contamination from bench tops, instruments, pipettors, glass and plastic ware. Ideal for labware and surfaces that cannot be autoclaved. Ready to use right out of the bottle, these solutions leave no residue on work surfaces when used as directed. DNase & RNase-Be-Gone B ( RNase & DNase-Be-Gone B) 1 X1000 Solution Features: (1) Effectively inactivates up to 100ug surface-contaminated RNases such as RNase T1, RNase H, BAL31, S1, Mung bean nuclease etc. and DNases in 10 minutes. (2) Faster than using DEPC. (3) Non-toxic (4) Economical. (5) Simple. Simply dilute RNase-Be-Gone B solution with water in a ratio of 1:1000 (v/v) and wash surfaces of glasswares, plasticwares and instruments and keep for 10 minutes at room temperature. (6) Can be used for making RNase-free water. (For making RNase-free water add 1% of RNase-Be-Gone B solution to dd-water and keep for 24 hours or longer at room temperature. Stability: stable at RT for 2 years.
1 KU 5 KU
200ml
50ml 5x50ml
B-8 Nucleases (DNases, RNases) DNase I (Deoxyribonuclease I) From Bovine Pancreas, Dnase I is an endonuclease that digests single- and double-stranded DNA. It hydrolyzes phosphodiester bonds producing oligodeoxyribonucleotides with 5'-phosphate and 3'-OH groups. Highly purified by chromatography. Activity >500 Kunitz U/mg Residue on ignition 90%. RNase: essentially free. Code Size DD0099 250mg 1g 5g Storage: -20°C Endonuclease IV, E. coli (2U/ul) Endonuclease IV is a class II apurinic/apyrimidic (AP) enzyme that cleaves 5’ to an AP site by hydrolysis leaving a hydroxyl group at the 3´ terminus and a deoxyribose 5´-phosphate at the 5´ terminus. Endo IV can be used in vivo to repair free radical damage in DNA. Applications: (1) DNA damage and repair. (2) Single cell gel electrophoresis. (3) Anti-tumor drug studies.(4) SNP analysis. Unit Definition: One unit of the enzyme relaxes 1µg of partially depurinated, covalently closed supercoiled plasmid DNA in 30 min at 37°C. Storage Buffer: Supplied in 50% glycerol, 50mM Tris-HCl (pH 7.5), 1mM DTT, 0.1M NaCl, 0.1% Triton X-100. 10×Reaction Buffer: 500mM Tris-acetate (pH 7.5), 500mM KCl, 10mM EDTA, 0.5% (v/v) Triton X-100 Code Size BEN0591 100U Store: -20°C T4 Endonuclease V (5U/ul)
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
187
2015-2016 Product Catalog
PCR Related Products & DNA, RNA Modifying Enzymes
T4 Endonuclease V, also known as T4 PDG, possesses DNA glycosylase and apurinic/apyrimidinic lyase (AP lyase) activity. The protein recognizes cis-syn-cyclobutane pyrimidine dimers formed on exposure to UV light. T4 Endonuclease V binds to pyrimidine dimers in double-stranded DNA, then cleaves the glycosyl bond of the 5’-pyrimidine dimer and cleaves the phosphodiester bond 3’ to the resting basic site. Applications: (1) Used in Single cell gel electrophoresis. (2) Studies of DNA damage by UV. (3) Genotyping. Unit Definition: One unit converts 1ug of UV irradiated supercoiled DNA to nicked plasma in 30 minutes at 37°C. Storage Buffer: Supplied in 50% glycerol, 50mM Tris-HCl (pH 7.5), 0.1mM EDTA, 1mM DTT, 100mM NaCl, 0.1% Triton X-100. Code
Size
BEN0141
250U
Store: -20°C Lambda Exonuclease (10U/ul) Lambda Exonuclease is a processive 5'->3' exodeoxyribonuclease. It digests the phosphorylated strand of double-stranded DNA. The enzyme will also degrade single-stranded DNA and non-phosphorylated DNA at a greatly reduced rate, and has no activity at nicks and limited activity at gaps in DNA. Applications: (1) Generating single-stranded PCR products for use in DNA sequencing and analysis of DNA single-strand conformation polymorphism (SSCP). (2) Producing single-stranded DNA from double-stranded DNA fragments. (3) Cloning of PCR products. Unit Definition: One unit of the enzyme catalyzes the release of 10nmole of acid soluble reaction products from double-stranded substrate in 30 min at 37°C. Storage Buffer: Supplied in 50% glycerol containing 50mM Tris-HCl pH 8.0, 20mM NaCl and 2mM MgCl2 Code Size BEN0561 1,000U Store: -20°C RNase A RB0473 Storage: -20°C (9001-99-4) RB0474 Storage: -20°C
RNase A (Ribonuclease A) 60-120U/mg (Kunitz Unit) From Bovine pancreas Molecular Biology Grade. White powder. Highly purified by affinity chromatography. Protease & DNase: essentially free. RNase A Solution (10mg/ml) Molecular Biology Grade Highly purified by affinity chromatography. DNase: essentially free.
25 mg 100 mg 500 mg 1ml
RNase H (5U/ul) RNase H is an endonuclease that hydrolyzes phosphodiester bonds of RNA in an RNA:DNA hybrid. It does not hydrolyze phosphodiester bonds in double-stranded DNA or single-stranded nucleic acids. Applications: (1) Eliminates the RNA strand of the RNA/DNA duplex prior to second-strand synthesis of cDNA. (2) Removal of poly (A) tails on mRNA after hybridization with oligo dT. (3) Site-specific cleavage of RNA. (4) Destruction of hybrid-arrested mRNAs. (5) In vitro destruction of hybrid-arrested mRNAs during translation. Unit Definition: One unit of the enzyme hydrolyzes 1nmol of RNA to acid-soluble ribonucleotides in 20 min at 37°C. Storage Buffer: 50% glycerol, 50mM Tris-HCl (pH 7.5), 0.1 M NaCl, 0.1mM EDTA, 1mM DTT, 0.1% Triton x-100.. 10X Reaction Buffer: 200mM Tris-HCl (pH 7.8), 400mM KCl, 80mM MgCl2, 10mM DTT Code Size BEN0202 500U Store: -20°C RNase I, E. coli (10U/ul) RNase I (E.coli) catalyzes the hydrolysis of single-stranded RNA to nucleoside 3’-monophosphates via 2’, 3’ cyclic monophosphate intermediates. The enzyme is inactivated by heating at 70°C for 15 minutes. Applications: (1) Remove RNA from DNA preparations. (2) Removal of RNA from recombinant protein preparations. (3) RNase protection assays. Unit Definition: One unit of enzyme required to catalyze the degradation of 100 ng of E. coli ribosomal RNA per second into acid-soluble nucleotides at 37°C. Storage Buffer: 50% glycerol, 50mM Tris-HCl (pH 7.5), 100mM NaCl, 0.01mM EDTA. Code Size BEN0601 1,000U Store: -20°C
B-9 Other Enzymes Proteinase K PB0451 Storage: -20°C [39450-01-6]
Proteinase K Lyophilized from Tritirachium album. Biotech Grade. Protein purity >90%, Activity>30U/mg. One unit will hydrolyze urea-denatured hemoglobin to produce color equivalent to 1.0 μmole of tyrosine per min at pH 7.5 at 37 °C, Soluble in water (10mg/ml), DNase, RNase & Nickase: none detected.
50 mg 250 mg
Pyrophosphatase, Inorganic (from Yeast) (0.1U/ul) Pyrophosphatase, Inorganic catalyzes the hydrolysis of inorganic pyrophosphate to two orthophosphates (see Fig.1). The enzyme requires a
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
188
2015-2016 Product Catalog
PCR Related Products & DNA, RNA Modifying Enzymes
2+
divalent metal cation, with Mg conferring the highest activity. Applications: (1) High yield RNA synthesis by in vitro transcription. (2) DNA polymerization reactions: preventing accumulation of pyrophosphate. (3) Removal of contaminant PPi in reagents used for SNP genotyping by methods based on the detection of pyrophosphate Unit Definition: One unit of the enzyme hydrolyzes 1µmol of inorganic pyrophosphate in 1 min at 25°C. Enzyme activity is assayed in the following mixture: 100mM Tris-HCl (pH 7.2), 2mM MgCl2 and 2mM inorganic pyrophosphate (PPi). Storage Buffer: in 20mM Tris-HCl (pH 8.0), 100mM KCl, 1mM Dithiothreitol, 0.1mM EDTA, 50% Glycerol. Code Size BEF0221 10 U Store: -20°C Uracil-DNA Glycosylase ( UDG) ES446 Uracil-DNA Glycosylase (UDG) (1U/ul ) Store: -20°C Supplied with 10×Reaction Buffer Purified from E.coli strain K12. Catalyzes the hydrolysis of N-glycosylic bond between uracil and sugar, leaving an apyrimidinic site in uracilcontaining single or double-stranded DNA. It shows no activity for RNA. Unit Definition: 1 unit of enzyme catalyzes the degradation of 1ug single-stranded uracil-containing DNA in 0 60 minutes at 37 C Reaction Buffer: 20mM Tris-HCl (pH8.0), 1mM EDTA and 1mM DTT Storage Buffer: 20mM Tris-HCl (pH 8.0), 50mM NaCl, 7mM 2- Mercaptoethanol, 1mM EDTA and 50% glycerol
200 U
Taq DNA Polymerase With dNTP Mix: 9K-001-0031 (500U) / 9K-001-0034 (1000U) / 9K-001-0032 (3000U) / 9K-001-0018 (6000U) Without dNTP Mix: 9K-001-0035 (1000U) / 9K-001-0033 (6000U) Code Description 9K-001-0031 Taq DNA Polymerase with dNTP Mix (500U) 9K-001-0034 Taq DNA Polymerase with dNTP Mix (1000U) 9K-001-0032 Taq DNA Polymerase with dNTP Mix (3000U) 9K-001-0018 Taq DNA Polymerase with dNTP Mix (6000U) 9K-001-0035 Taq DNA Polymerase (1000U) 9K-001-0033 Taq DNA Polymerase (6000U)
Size 500U 1000U 3000U 6000U 1000U 6000U
Fast-Taq DNA Polymerase With dNTP Mix: 9K-001-0003 (500U) / 9K-001-0004 (2500U) Without dNTP Mix: 9K-001-0036 (500U) Code Description 9K-001-0003 Fast-Taq DNA Polymerase with 10mM dNTP Mix (500U) 9K-001-0004 Fast-Taq DNA Polymerase with 10mM dNTP Mix (2500U) 9K-001-0036 Fast-Taq DNA Polymerase (500U)
Size 500U 2500U 500U
High-Taq DNA Polymerase With dNTP Mix: 9K-001-0005 (250U) / 9K-001-0006 (1000U) / 9K-001-0020 (5000U) Code 9K-001-0005 9K-001-0006 9K-001-0020
Description High-Taq DNA Polymerase with 10mM dNTP Mix (250U) High-Taq DNA Polymerase with 10mM dNTP Mix (4x250U) High-Taq DNA Polymerase with 10mM dNTP Mix (5000U)
Size 250U 4x250U 5000U
Pfu DNA Polymerase With dNTP Mix: 9K-001-0010 (250U) / 9K-001-0009 (500U) / 9K-001-0021 (10000U) Code 9K-001-0009 9K-001-0010 9K-001-0021
Description Pfu DNA Polymerase with 10mM dNTP Mix (500U) Pfu DNA Polymerase with 10mM dNTP Mix (250U) Pfu DNA Polymerase with 10mM dNTP Mix (10000U)
Size 500U 250U 10000U
Fast-Pfu DNA Polymerase With dNTP Mix: 9K-001-0022 (250U) / 9K-001-0023 (500U) / 9K-001-0024 (Buffer) Code 9K-001-0022 9K-001-0023 9K-001-0024
Description Fast-Pfu with 10mM dNTP Mix (250U) Fast-Pfu with 10mM dNTP Mix (500U) 10X Fast-Pfu Buffer (5*1mL)
Size 250U 500U 5X1mL
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
189
2015-2016 Product Catalog
PCR Related Products & DNA, RNA Modifying Enzymes
2X Taq PCR Mix 9K-002-0005 (5*1ml) / 9K-002-0006 (5*1ml) /9K-002-0007 (5*1ml)/ 9K-002-0008 (5*1ml)/ 9K-002-0009(5*1ml) Code 9K-002-0005 9K-002-0006 9K-002-0007 9K-002-0008 9K-002-0009
Description 2X Taq PCR Premix (5*1mL) 2X Taq PCR Premix with 0.5X Band Sharpener 2X Taq PCR Premix with 1.0X Band Sharpener 2X Taq PCR Premix with 1.5X Band Sharpener 2X Taq PCR Premix with 2.0X Band Sharpener
(5*1mL) (5*1mL) (5*1mL) (5*1mL)
Size 5X1mL 5X1mL 5X1mL 5X1mL 5X1mL
2X Pfu PCR Mix 9K-002-0022 (5*1ml) / 9K-002-0023 (5*1ml) /9K-002-0024 (5*1ml)/ 9K-002-0025 (5*1ml)/ 9K-002-0026(5*1ml) Code 9K-002-0022 9K-002-0023 9K-002-0024 9K-002-0025 9K-002-0026
Description 2X Pfu PCR Premix (5*1mL) 2X Pfu PCR Premix with 0.5X Band Sharpener (5*1mL) 2X Pfu PCR Premix with 1.0X Band Sharpener (5*1mL) 2X Pfu PCR Premix with 1.5X Band Sharpener (5*1mL) 2X Pfu PCR Premix with 2.0X Band Sharpener (5*1mL)
Size 5X1mL 5X1mL 5X1mL 5X1mL 5X1mL
Description Green-2-Go qPCR –ROX ® TM qPCR instrument: ABI 7000, 7300, 7700, 7900; StepOnePlus StepOne; ® Eppendorf Realplex 4 Green-2-Go qPCR Low ROX ® ® qPCR instrument: ABI 7500; Stratagene Mx3000, Mx3005, Mx4000 Green-2-Go qPCR iCycler ® ® TM TM qPCR instrument: BioRad iCycler , iQ 5, MyiQ Green-2-Go qPCR-S ® ® qPCR instrument: BioRad CFX96; Roche LightCycler 480, MJ TM TM ® ResearchOpticon and Opticon 2; MJ research Chromo 4; ® ® Corbett Rotor-grene 600, 3000; Eppendorf Realplex 2
Size
QPCR Mixtures Code QPCR001-R (2X) QPCR002-L (2X) QPCR003-IC (2X)
QPCR004-S (2X)
4X1.25mL 4X1.25mL 4X1.25mL
4X1.25mL
PCR READY MIXTUREs
Code
BS9295
Description Taq PCR Master Mix (2x, blue dye) Taq PCR Master Mix (2X, blue dye) is a ready-to-use solution containing Taq DNA polymerase, dNTP, MgCl2, PCR buffer, PCR stabilizers, gel loading reagent and dye. PCR products can be loaded onto agarose gel directly. Optimized Taq PCR Master Mix (2X, blue dye) can amplify targets up to 5 kb in length from lambda DNA. Users only need to add a template, water and primers to set up a PCR reaction.
Size
1ml
Taq PCR Master Mix (2x, blue dye)
BS9296
Taq PCR Master Mix (2X, blue dye) is a ready-to-use solution containing Taq DNA polymerase, dNTP, MgCl2, PCR buffer, PCR stabilizers, gel loading reagent and dye. PCR products can be loaded onto agarose gel directly. Optimized Taq PCR Master Mix (2X, blue dye) can amplify targets up to 5 kb in length from lambda DNA. Users only need to add a template, water and primers to set up a PCR reaction.
5X1ml
Taq PCR Master Mix (2x, red dye)
BS9297
Taq PCR Master Mix (2X, red dye) is a ready-to-use solution containing Taq DNA polymerase, dNTP, MgCl2, PCR buffer and PCR stabilizers. Optimized Taq PCR Master Mix (2X, red dye) can amplify targets up to 5 kb in length from lambda DNA. Users only need to add a template, primers and water to set up a PCR reaction.
1ml
Taq PCR Master Mix (2x, red dye) BS9298
Taq PCR Master Mix (2X, red dye) is a ready-to-use solution containing Taq DNA polymerase, dNTP, MgCl2, PCR buffer and PCR stabilizers.
5X1ml
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
190
2015-2016 Product Catalog
PCR Related Products & DNA, RNA Modifying Enzymes
Optimized Taq PCR Master Mix (2X, red dye) can amplify targets up to 5 kb in length from lambda DNA. Users only need to add a template, primers and water to set up a PCR reaction.
T4 DNA Ligase (40000U)
• Cloning of restriction fragments • Joining linkers and adapters to blunt-ended DNA Code 9K-005-0002 Store: -20°C
Size 40000U
High Reverse Transcriptase (10000U) High RT Kit includes a recombinant genetically engineered version of a thermostable M-MULV reverse transcriptase. Since this is more thermostable than M-MLV, the synthesis of cDNA is possible over 50°C and this modified enzyme shows an optimal activity at 50°C. In addition, the synthesis of cDNA is achieved efficiently because 2nd structure of RNA can be retarded more easily comparing to that in low temperature. (below 42°C reaction) Code Size 9K-005-0005 10000U Store: -20°C
C. Nucleotides AB0311 Storage: -20°C
D0046A Storage: -20°C D0046C Storage: -20°C D0046G Storage: -20°C DD0046T Storage: -20°C DM1244 Storage: -20°C
DD0056 Storage: -20°C DD0057 Storage: -20°C DD0058 Storage: -20°C DB2236 Storage: -20°C ND0056 Storage: -20°C ND0057 Storage: -20°C ND0059 Storage: -20°C
ATP 100mM Solution Adenosine 5’-triphosphate, disodium salt, trihydrate Molecular Biology Grade. C10H14O13N5P3Na2·3H2O MW 605.24 Purity >98%, Chloride 98% (HPLC) , Sulfate 98% (HPLC), Heavy metals 10ppm, pH: 6.8-7.2, RNase, DNase: non-detected GTP see NTP (ND0056) dNTP mixture (10mM) (dATP, dCTP, dGTP dTTP each 10mM) pH 7.0 Purity of each >98.0% (HPLC) RNase, DNase: non-detected. dNTP mixture (25mM) (dATP, dCTP, dGTP dTTP each 25mM) pH 7.0 Purity of each >98.0% (HPLC) RNAse, DNase: non-detected. dNTP Set Solutions (100mM each ) dATP, dCTP, dGTP, dTTP as separated solutions pH 6.8-7.2 , Purity of each >98.0% (HPLC) RNase, DNase: non-detected, Stable at-20°C for one year. dNTP/dUTP Mix Solution (2mM dATP, 2mM dCTP, 2mM dGTP and 4mM dUTP (pH 7.0) Purity of each >98.0% (HPLC) RNase &DNase: non-detected. NTP Mixture Solution (10mM) (ATP, CTP, GTP and UTP each 10mM) pH 7.0. Purity of each >98.0% (HPLC) RNase & DNase: non-detected. NTP Mixture Solution (25mM) (ATP, CTP, GTP and UTP each 25mM) pH 7.0 Purity of each >98.0% (HPLC) RNase & DNase: non-detected. NTP Set Solutions (100mM each ) ATP, CTP, GTP, TTP as separated solutions pH 6.8-7.2 , Purity of each >98.0%
0.25ml
0.5ml
0.5ml
0.5ml
0.5ml
0.25ml
0.5ml 0.5ml 4x0.1ml 4x0.5ml 1ml 0.5ml 0.5ml 4x0.25ml
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
191
2015-2016 Product Catalog
PCR Related Products & DNA, RNA Modifying Enzymes
(HPLC) RNase, DNase: non-detected, Stable at-20°C for one year.. UTP see NTP (ND0056)
E. DNA, RNA-EZ Series Products Bio Basic Inc. has developed many unique products – referred to as the EZ-DNA and EZ-RNA series - which help to increase the efficienc of PCR, cloning, DNase or Rnase removal, RNA/DNA protection and RNA/DNA Purification. Code
Product & Description
Size
BS409A BS410A Storage: 2-8°C
EZ-RNA Reagents Suitable for the isolation of total RNA from cells and tissues. During sample homogenization or lysis, EZ-RNA Reagents maintain the integrity of RNA. The addition of chloroform is followed by centrifugation, which separates the solution into an aqueous phase and an organic phase. RNA is then recovered by precipitation with ethanol or isopropyl alcohol. EZ-RNA Reagents perform well with small or large samples of human, animal, plant or bacterial origin, and facilitate the isolation of a variety of RNA species of ranging molecular weight. EZ-DNA Reagents The EZ-DNA Reagent is a ready-to-use reagent for the isolation of genomic DNA from various samples including animal tissue, cultured cells, and bacteria. The method is based on the use of an optimized guanidine-detergent solution, which lyses the tissue quickly and selectively precipitates DNA from a cell lysate. EZDNA Reagents provide a fast, simple, versatile and economic method to isolate genomic DNA from wide range of samples. DNA, RNA-EZ B1 (DNA-Be-Down) Solution Designed as a co-precipitant for increasing the recovery of DNA in precipitation steps. It is useful for the isolation of small amounts of DNA or increasing the yield of DNA. This product is particularly suitable for the extraction of small amounts of DNA or diluted DNA solution. It can be directly added to diluted DNA solution, or to lysis & extraction buffer for DNA isolation. It is chemically inert, with no UV absorbance at 250, 260 and 280 nm. Store: stable for two years at 20°C. 100ul can be used for 20 mini-preps. DNA, RNA-EZ B3 (RNA-Be-Down) Solution The RNA-Be-Down reagent is a molecular biology grade RNase-free solution designed for isolation of small amounts of RNA or increasing the yield of RNA. This product is particularly suitable for the extraction of small amounts of RNA or diluted RNA solution. The RNA-Be-Down reagent can directly be added to diluted RNA solution, or be added to lysis & extraction buffer for RNA isolation. The RNA-Be-Down reagent is chemically inert, no UV absorbance at 250, 260 and 280 nm. 100ul can be used for 20 mini-preps. Store: at -20°C, stable for two years. DNA, RNA-EZ E1 (RNA-Be-Locked) Solution -tissue RNA-Be-Locked A is an aqueous, nontoxic tissue storage reagent that immediately permeates tissues to stabilize and protect RNA in fresh specimens. Samples in RNA-Be-Locked A are safe and protected for up to 1 day at 37°C, 1 week at 25°C, 1 month or more at 4°C, and long term at -20°C or -80°C. Purified RNA can be used in most downstream applications. 25ml of RNA-Be-Locked A can be used for 25 grams of tissue samples. Store: RT, valid for 2 years. DNA, RNA-EZ E2 (RNA-Be-Locked B) Solution-bacteria RNA-Be-Locked B is an aqueous, nontoxic tissue storage reagent that immediately permeates bacterial cells to stabilize and protect RNA in fresh specimens. Purified RNA can be used in most of downstream applications. 25ml of RNA-Be-Locked B can be used for 125ml of bacterial culture. Store at 4°C. Valid for 2 years. DNA, RNA-EZ J1 (Endotoxin-Be-Gone) Solution. Designed for the removal of Endotoxin from DNA and protein solutions. One treatment can remove >90% of endotoxin. After three treatments, endotoxin levels are reduced to 0.2EU/ML. Features: (1) Fast. It takes 20 minutes. (2) Simple. (3) Chemically inert. No side reactions to RNA, DNA or proteins. 5ml is sufficient for 100 mini-preps. DNAse & RNase Away Solution Easy to use and safer than traditional alternatives such as DEPC. Ideal for removing nuclease and DNA contamination from bench tops, instruments, pipettors, glass and plastic ware. Ideal for labware and surfaces that cannot be autoclaved. Ready to use. These solutions leave no residue on work surfaces when used as directed. DNA, RNA-EZ P ( EB-Be-Gone) DNA, RNA-EZ P, is designed to minimize the risk associated with the regular use of ethidium bromide (EB). DNA, RNA-EZ P may destroy > 99% of EB in solutions, gels and surface of glasswares or plasticwares. Simply mix Solution A, Solution B and water in a ratio of 1:2:30 (v/v), the mixture is ready to use and is stable within 24 hours. The kit contains 100ml of Solution A and 200ml of Solution B, 3L of ready-to-use solution can be made. The kit is stable for 1 year
25ml 100ml
SK8201 Storage: 18-25°C
RT4732 Storage: -20°C
RT4231 Storage: -20°C
RT4171 Storage: 18-25°C
RT91712 Storage: 2-8°C
DT71718 Storage: 18-25°C
DB0339 Storage: 18-25°C
EE4203 Storage: 18-25°C
100 preps 500 preps
100ul 500ul
100ul
25ml 4x25ml
25ml 4x25ml
5ml
200ml
1 pk
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
192
2015-2016 Product Catalog
RT4201 Storage: 18-25°C
PCR Related Products & DNA, RNA Modifying Enzymes
at room temperature. DNA, RNA-EZ Q2 (DNase & RNase-Be-Gone) Solution 1 X1000 Solution. Designed for removing >80% surface-RNases. Features: (1) Effectively inactivate up to 100ug surface-contaminated RNases such as RNase T1, RNase H, BAL31, S1, Mung bean nuclease etc. and DNases in 10 minutes. (2) Faster than using DEPC. (3) Non-toxic (4) Economical. (5) Simple. Simply dilute RNase-Be-Gone B solution with water in a ratio of 1:1000 (v/v) and wash surfaces of glasswares, plasticwares and instruments and keep for 10 minutes at room temperature. (6) Can be used for making RNase-free water. For making RNase-free water add 1% of RNase-Be-Gone B solution to dd-water and keep for 24 hours or longer at room temperature. Stability: stable at RT for 2 years.
50ml 5x50ml
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
193
2015-2016 Product Catalog
DNA, RNA, Protein Markers & Cloning Vectors
DNA Markers Item No.
Range
GM303
9 DNA fragments: 25, 50, 75, 100, 150, 200, 300, 400, 500bp
GM304
9 DNA fragments: 25, 50, 75, 100, 150, 200, 300, 400, 500bp
GM305
10 DNA fragments: 50, 100, 150, 200, 250, 300, 350, 400, 450, 500bp
GM331
6 DNA fragments: 100, 200, 300, 400, 500, 600bp
GM332
6 DNA fragments: 100, 200, 300, 400, 500, 600bp
GM345
13 DNA fragments: 50, 100X2, 150, 200X2 ,250, 300, 400, 500X2, 600, 700, 800, 900 and 1031bp
GM343
10 DNA fragments: 100, 200, 300, 400, 500, 600, 700, 800, 900 and 1000bp
GM333
6 DNA fragments: 100, 300, 500, 700, 900, 1200bp
GM334
6 DNA fragments: 100, 300, 500, 700, 900, 1200bp
SGM01
6 DNA fragments: 100, 250, 500, 750, 1000, 1500bp
SGM02
6 DNA fragments: 100, 250, 500, 750, 1000, 1500bp
M102O-1
9 DNA fragments: 100, 200, 300, 400, 500, 600, 800,1000 and 1500bp
M102O-2
9 DNA fragments: 100, 200, 300, 400, 500, 600, 800,1000 and 1500bp
M102R-1
9 DNA fragments: 100, 200, 300, 400, 500, 600, 800, 1000 and 1500bp
M102R-2
9 DNA fragments: 100, 200, 300, 400, 500, 600, 800, 1000 and 1500bp
M107O-1
11 DNA fragments: 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000 and 1500bp
M107O-2
11 DNA fragments: 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000 and 1500bp
M107R-1
11 DNA fragments: 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000 and 1500bp
M107R-2
11 DNA fragments: 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000 and 1500bp
M109-A
10 DNA fragments:150, 250, 350, 450, 550, 650, 750, 850, 1000, 1500bp
M109-B
10 DNA fragments:150, 250, 350, 450, 550, 650, 750, 850, 1000, 1500bp
GM335
6 DNA fragments: 100, 250, 500, 750, 1000, 2000bp
GM336
6 DNA fragments: 100, 250, 500, 750, 1000, 2000bp
GM337
6 bands: 200, 400, 600, 800, 1000, 1500bp
GM338
6 bands: 200, 400, 600, 800, 1000, 1500bp
GM339
6 DNA fragments: 200, 400, 700, 1000, 1500, 2000bp
GM340
6 DNA fragments: 200, 400, 700, 1000, 1500, 2000bp
GM401
10 DNA fragments: 200, 400, 600, 800, 1000, 1200, 1400, 1600, 1800, 2000bp
GM341
6 DNA fragments: 300, 500, 1000, 2000, 2500bp
GM342
6 DNA fragments: 300, 500, 1000, 2000, 2500bp
GM347
14 DNA fragments: 100, 200, 300, 400, 500x2, 600, 700, 800, 900 and 1000x2, 1200, 1500, 2000, 3000bp
SGM03
9 DNA fragments: 100, 250, 500,750,1000,1500,2000,3000,5000bp
SGM04
9 DNA fragments: 100, 250, 500,750,1000,1500,2000,3000,5000bp
M101O-1
9 DNA fragments: 0.5kb, 1 kb, 2kb, 3kb, 4kb, 5kb, 6kb, 8kb, and 10kb
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
194
2015-2016 Product Catalog
DNA, RNA, Protein Markers & Cloning Vectors
M101O-2
9 DNA fragments: 0.5kb, 1 kb, 2kb, 3kb, 4kb, 5kb, 6kb, 8kb, and 10kb
M101R-1
9 DNA fragments: 0.5kb, 1 kb, 2 kb, 3 kb, 4 kb, 5 kb, 6kb, 8kb, and 10kb
M101R-2
9 DNA fragments: 0.5kb, 1 kb, 2 kb, 3 kb, 4 kb, 5 kb, 6kb, 8kb, and 10kb
GM403
13 DNA fragments: 0.2kb, 0.5, 1, 1.5, 2, 2.5, 3,4, 5, 6, 8, 10, 14kb
E255
10 DNA fragments: 1,503, 10,086, 15,004, 17,053, 23,994, 24,508, 29,964, 33,498, 38,416 and 48,502bp
M103O-1
16 DNA fragments: 100, 200, 300, 400,500, 600, 800, 1000, 1500, 2kb, 3kb, 4kb, 5kb, 6kb, 8kb, and 10kb
M103O-2
16 DNA fragments: 100, 200, 300, 400,500, 600, 800, 1000, 1500, 2kb, 3kb, 4kb, 5kb, 6kb, 8kb, and 10kb
M103R-1
16 DNA fragments: 100, 200, 300, 400, 500,600, 800, 1000, 1500, 2kb, 3kb, 4kb, 5kb, 6kb, 8kb, and 10kb
M103R-2 E273
16 DNA fragments: 100, 200, 300, 400, 500,600, 800, 1000, 1500, 2kb, 3kb, 4kb, 5kb, 6kb, 8kb, and 10kb 24 DNA fragments: 100, 224, 702, 1,264, 1371,1,503, 1,929, 2,323, 3,675, 4,324, 4,827, 5,686, 6,369, 7,639, 8,454, 10,086, 15,004, 23,994, 24,508, 29,964, 33,498, 38,416, and 48,502bp
M104R-1
7 DNA fragments : 23130*, 9416, 6557, 4361*, 2322, 2027 & 564
M104R-2
7 DNA fragments : 23130*, 9416, 6557, 4361*, 2322, 2027 & 564
M105R-1
10 DNA Fragments 23130*,9416, 6557, 4361*, 2322, 2027, 1500, 1000, 564, 300bp
M105R-2
10 DNA Fragments 23130*,9416, 6557, 4361*, 2322, 2027, 1500, 1000, 564, 300bp
RNA Markers Item No.
Range
DM0818
2 bands: 1776, 3566bp
BSM1831
7 bands: 100, 200, 300, 400, 600, 800, 1000bp
BSM1833
7 bands: 100, 200, 300, 400, 600, 800, 1000bp
BSM1821
8 bands: 200, 500, 1000, 1500, 2000, 3000, 4000, 6000bp
BSM1823
8 bands: 200, 500, 1000, 1500, 2000, 3000, 4000, 6000bp
Protein Markers Item No.
Range
BM201
9 protein bands: 4.1, 6.5, 9.5, 14.4, 20, 27, 35, 45, 66kDa
BM523
5 bands: 14.4, 31, 42.7, 66.2, 97.4 kDa
BM524
6 bands: 14.4, 20, 31, 45, 66.2, 98 kDa
BSM0441
6 band: 20, 25, 35, 50, 85, 120kDa
BSM0661
14 band: 10, 15, 20, 25, 30, 40, 50, 60, 70, 85, 100, 120, 150, 200kDa
BSM0431
14 band: 14.4, 18.4, 25, 35, 45, 66.2, 116kDa
BSM0671
10-170kDa Wide Range Protein Molecular Weight Marker, Prestained
BG00363
10-175kDa Wide Range Protein Molecular Weight Marker, Prestained
BG00364
10-240kDa Wide Range 3 Color Prestained Protein Ladder
Phages, Plasmid DNA, Cloning Vectors & Related Products DNA Phages & Plasmids
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
195
2015-2016 Product Catalog
Item No.
Range
MDD22
Lambda DNA
MDD21
Lambda DNA (dam-, dcm-)
MSD14
pBR322 DNA
MSD15
pUC 18 DNA
MSD16
pUC 19 DNA
MSD17
pUC 57 DNA
BS433
pUCM-T Cloning Vector
BS434
pUCM-T Cloning Vector
BS435
pUCM-T Cloning Vector Kit
BS436
pUCM-T Cloning Vector Kit
DNA, RNA, Protein Markers & Cloning Vectors
DNA Markers 25-500bp DNA Marker, Ready-to-Use 9 DNA fragments: 25, 50, 75, 100, 150, 200, 300, 400, 500bp The intensity of the 400bp band is increased to yield an internal reference indicator. Ready-to use. The marker should be loaded on high concentration gels (3.5-5.0% agarose gel or 10% PAGE) to properly view bands of low molecular weight. Usage: 6ul /load containing 75ng of each DNA fragments and 150ng of 100bp band. Storage: -20°C Code Size GM303 20 loadings (120ul) GM304 5x20 loadings (5x120ul)
1.7% agarose
50-500bp DNA Marker 10 DNA fragments: 50, 100, 150, 200, 250, 300, 350, 400, 450, 500bp The marker should be loaded on high concentration gels (3.5-5.0% agarose gel or 10% PAGE) to properly view bands of low molecular weight. Usage: 5ul /load Storage: -20°C Code Size GM305 200 loadings (1ml) 100-600bp Low Range DNA Marker, Ready-to-Use 6 DNA fragments: 100, 200, 300, 400, 500, 600bp The intensity of the 100bp band is increased to yield an internal reference indicator. Ready-to use. The marker should be loaded on high concentration gels (3.5-5.0% agarose gel or 10% PAGE) to properly view bands of low molecular weight. Usage: 6ul /load containing 75ng of each DNA fragments and 150ng of 100bp band. Storage: -20°C
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
196
2015-2016 Product Catalog
Code GM331 GM332
DNA, RNA, Protein Markers & Cloning Vectors
Size 50 loadings (300ul) 5x50 loadings (5x300ul)
1.7% agarose
50-1000bp DNA Marker, Ready-to Use 13 DNA fragments: 50, 100X2, 150, 200X2 ,250, 300, 400, 500X2, 600, 700, 800, 900 and 1031bp The intensity of the 100, 200, and 500bp bands are increased to yield internal reference indicators. Storage Buffer: 1XTE (10mM Tris-HCl, pH8.0, 1.0mM EDTA) 6x Loading Buffer: 30% glycerol, 0.12% bromophenol blue, 0.12% xylene cyanol Usage: 6ul /load Storage -20°C Code Size GM345 50 loadings (300ul)
100-1000bp DNA Marker, Ready-to Use 10 DNA fragments: 100, 200, 300, 400, 500, 600, 700, 800, 900 and 1000bp The intensity of the 500bp band is increased to yield an internal reference indicator Concentration: 540ng/5ul Storage Buffer: 1XTE (10mM Tris-HCl, pH8.0, 1.0mM EDTA) 6x Loading Buffer: 30% Glycerol, 0.12% Bromophenol blue, 0.12% Xylene cyanol Usage: 6ul /load Storage -20°C Code Size GM343 50 loadings (300ul)
1.7% agarose
100-1200bp DNA Marker, Ready-to-Use 6 DNA fragments: 100, 300, 500, 700, 900, 1200bp The intensity of the 700bp band is increased to yield an internal reference indicator Usage: 6ul /load containing 75ng of each DNA fragments and 150ng of 700bp band. Storage: -20°C Code Size GM333 50 loadings (300ul) GM334 5x50 loadings (5x300ul)
1.7% agarose
100-1500bp DNA Marker, Ready-to-Use 6 DNA fragments: 100, 250, 500, 750, 1000, 1500bp The intensity of the 700bp band is increased to yield an internal reference indicator Usage: 6ul /load containing 75ng of each DNA fragments and 150ng of 700bp band. Storage: -20°C Code Size SGM01 50 loadings (300ul) SGM02 5x50 loadings (5x300ul)
1.7% agarose
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
197
2015-2016 Product Catalog
DNA, RNA, Protein Markers & Cloning Vectors
100-1500bp DNA Marker, Original Form 9 DNA fragments: 100, 200, 300, 400, 500, 600, 800,1000 and 1500bp Supplied with 6x loading buffer Concentration: 540ng/ 5ul Recommended loading volume: 5ul Storage Buffer: 1XTE (10mM Tris-HCl, pH8.0, 1.0mM EDTA) 6x Loading Buffer: 30% Glycerol, 0.12% Bromophenol blue, 0.12% Xylene cyanol Storage -20°C Code Size M102O-1 100 loadings (500ul) 6X Loading Buffer 200ul per pack Supplied with M102O-1 M102O-2 5x100 loadings (5x500ul) 6X Loading Buffer 5X 200ul per pack Supplied with M102O-2 100-1500bp DNA Marker, Ready to Use 9 DNA fragments: 100, 200, 300, 400, 500, 600, 800, 1000 and 1500bp Supplied with 6x loading buffer Concentration: 540ng/ 6ul Recommended loading volume: 540ng/ 6ul Storage Buffer: 10mM Tris-HCl, pH8.0, 1mM EDTA, and 1 X Loading Buffer ( 5% Glycerol, 0.02% Bromophenol blue, 0.02% Xylene cyanol) Storage -20°C Code Size M102R-1 100 loadings (600ul) M102R-2 5x100 loadings (5x600ul) 100-1500bp DNA Marker, Original Form 11 DNA fragments: 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000 and 1500bp Supplied with 6X Loading Buffer The DNA 100 bp Marker consists of 11 fragments ranging from 100-1500 base pair (BP). The intensity of 500 bp band has been increased to serve as a reference. This 100 bp Marker is specially prepared for visualizing small DNA fragments on the gel. Concentration: 500ng / 5ul Recommended loading volume: 5ul Storage Buffer: 1 X TE and 1X loading buffer ( 5% Glycerol, 0.02% Bromophenol blue, 0.02% Xylene cyanol) Storage -20°C Code Size M107O-1 100 loadings (500ul) 6X Loading Buffer 200ul per pack Supplied with M107O-1 M107O-2 5x100 loadings (5x500ul) 6X Loading Buffer 5X 200ul per pack Supplied with M107O-2
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
1.7% agarose
.
1.7% agarose
1.7% agarose
198
2015-2016 Product Catalog
DNA, RNA, Protein Markers & Cloning Vectors
100-1500bp DNA Marker, Ready-to Use 11 DNA fragments: 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000 and 1500bp Supplied with 6X Loading Buffer The DNA 100 bp Marker consists of 11 fragments ranging from 100-1500bp. The intensity of the 500bp band has been increased to serve as an internal reference. The marker is specially prepared for visualizing small DNA fragments on gels. Concentration: 500ng / 6ul Recommended loading volume: 6ul Storage Buffer: 1 X TE and 1X loading buffer ( 5% Glycerol, 0.02% Bromophenol blue, 0.02% Xylene cyanol) Storage: -20°C Code Size M107R-1 100 loadings (600ul) M107R-2 5x100 loadings (5x600ul)
1.7% agarose
100 +50bp DNA Marker, Ready-to-use 10 DNA fragments:150, 250, 350, 450, 550, 650, 750, 850, 1000, 1500bp Supplied with 6X Loading Buffer Concentration: 500ng / 6ul Recommended loading volume: 6ul Storage Buffer: 1 X TE and 1X loading buffer ( 5% Glycerol, 0.02% Bromophenol blue, 0.02% Xylene cyanol) Storage: -20°C Code Size M109-A 100 Loading (600µl) M109-B 5x100 loadings (5x600µl)
100-2000bp DNA Marker, Ready-to-Use 6 DNA fragments: 100, 250, 500, 750, 1000, 2000bp The intensity of the 750bp band is increased to yield an internal reference indicator Usage: 6ul /load containing 75ng of each DNA fragments and 150ng of 750bp band. Storage: -20°C Code Size GM335 50 loadings (300ul) GM336 5x50 loadings (5x300ul)
1.7% agarose
200-1500bp DNA Marker, Ready-to-Use 6 bands: 200, 400, 600, 800, 1000, 1500bp
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
199
2015-2016 Product Catalog
DNA, RNA, Protein Markers & Cloning Vectors
The intensity of the 1000bp band is increased to yield an internal reference indicator Usage: 6ul /load containing 75ng of each DNA fragments and 150ng of 1000bp band. Storage: -20°C Code Size GM337 50 loadings (300ul) GM338 5x50 loadings (5x300ul)
200-2000bp DNA Marker, Ready-to-Use 6 DNA fragments: 200, 400, 700, 1000, 1500, 2000bp The intensity of the 1000bp band is increased to yield an internal reference indicator Usage: 6ul /load containing 75ng of each DNA fragments and 150ng of 1000bp band. Storage: -20°C Code Size GM339 50 loadings (300ul) GM340 5x50 loadings (5x300ul)
200-2000bp DNA Marker Plus, Ready-to-Use 10 DNA fragments: 200, 400, 600, 800, 1000, 1200, 1400, 1600, 1800, 2000bp The intensity of the 1000bp band is increased to yield an internal reference indicator. Usage: 6ul /load containing 75ng of each DNA fragments and 150ng of 1000bp band. Storage: -20°C Code Size GM401
1.7% agarose
1.7% agarose
1.7% agarose
50 loadings (300ul)
300-2500bp DNA Marker, Ready-to-Use 6 DNA fragments: 300, 500, 1000, 2000, 2500bp The intensity of the 150bp band is increased to yield an internal reference indicator. Usage: 6ul /load containing 75ng of each DNA fragments and 150ng of 1500bp band. Storage: -20°C Code Size GM341 50 loadings (300ul) GM342 5x50 loadings (5x300ul)
1.7% agarose
100-3000bp Marker, Ready-to Use 14 DNA fragments: 100, 200, 300, 400, 500x2, 600, 700, 800, 900 and 1000x2, 1200, 1500, 2000, 3000bp
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
200
2015-2016 Product Catalog
DNA, RNA, Protein Markers & Cloning Vectors
The intensities of the 500 and 1000bp bands are increased to yield internal reference indicators. Concentration: 200ug/ml Recommended loading volume: 6ul Storage Buffer: 1XTE (10mM Tris-HCl, pH8.0, 1.0mM EDTA) 6x Loading Buffer: 30% Glycerol, 0.12% Bromophenol blue, 0.12% Xylene cyanol Storage -20°C Code Size GM347 50 loadings (300ul)
100-5000bp DNA Marker Plus, Ready-to-Use 9 DNA fragments: 100, 250, 500, 750, 1000, 1500, 2000, 3000, 5000bp The intensity of the 750bp band is increased to yield an internal reference indicator. Usage: 6ul /load containing 75ng of each DNA fragments and 150ng of 750bp band. Storage: -20 °C Code Size SGM03 50 loadings (300ul) SGM04 5x50 loadings (5x300ul) 1.7% agarose
500-10000bp DNA Marker, Original Form 9 DNA fragments: 0.5kb, 1 kb, 2kb, 3kb, 4kb, 5kb, 6kb, 8kb, and 10kb DNA KB Marker consists of 9 DNA fragments ranging from 0.5-10kb. The intensity of the 3kb band has been increased to yield an internal reference indicator. Concentration: 250ng / 5ul Recommended loading volume: 5ul Storage Buffer: 1XTE (10mM Tris-Hcl, pH8.0, 1mM EDTA) 6x Loading Buffer: 30% Glycerol, 0.12% Bromophenol blue, 0.12% Xylene cyanol Storage -20°C Code Size M101O-1 100 Loadings (500ul) 6X Loading Buffer 200ul per pack M101O-2 5X100 Loadings (5X500ul) 6X Loading Buffer 5X 200ul per pack
1.7% agarose
500-10000bp DNA Marker, Ready To Use 9 DNA fragments: 0.5kb, 1 kb, 2 kb, 3 kb, 4 kb, 5 kb, 6kb, 8kb, and 10kb DNA KB Marker consists of 9 DNA fragments ranging from 0.5-10kb. The intensity of the 3kb band has been increased to yield an internal reference indicator. Concentration: 250ng / 6ul Recommended loading volume: 6ul Storage Buffer: 1 X TE and 1X loading buffer (5% Glycerol, 0.02% Bromophenol blue, 0.02% Xylene cyanol) Storage -20°C
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
201
2015-2016 Product Catalog
Code M101R-1 M101R-2
DNA, RNA, Protein Markers & Cloning Vectors
Size 100 loadings (600ul) 5x100 loadings (5x600ul)
1.7% agarose
0.2 kb to 14 kb DNA Marker 13 DNA fragments: 0.2kb, 0.5, 1, 1.5, 2, 2.5, 3,4, 5, 6, 8, 10, 14kb This marker is suited for evaluating large fragments >10 kb in length. A combination of several single-cut digests, the marker possesses fragments with sizes ranging from 0.2 to 14 kb. The High-Range Marker was separated on a 0.35% agarose gel and stained with SYBR Green I Nucleic Acid Stain. For ideal separation, pulsed-field gel electrophoresis is recommended. Code Size GM403 100 loadings (500ul)
1.5 kb to 48.5 kb High Range DNA Marker 10 DNA fragments: 1,503, 10,086, 15,004, 17,053, 23,994, 24,508, 29,964, 33,498, 38,416 and 48,502bp This marker is suited for evaluating large fragments >10 kb in length. A combination of several single-cut digests, the marker possesses fragments ranging in size from 1.5 to 48.5 kb. High-Range Marker was separated on a 0.35% agarose gel and stained with SYBR Green I Nucleic Acid Stain. For ideal separation, pulsed-field gel electrophoresis is recommended. Code Size E255 150ug
100 bp-10 Kb Wide Range DNA Logical Marker, Original Form 16 DNA fragments: 100, 200, 300, 400,500, 600, 800, 1000, 1500, 2kb, 3kb, 4kb, 5kb, 6kb, 8kb, and 10kb The DNA Logic-Marker consists of 16 DNA fragments ranging from 0.1-10kb. Each band contains a ‘Logical’ amount of DNA that correlates to its size. Each marker reveals a unique pattern for both the recognition of bands on a gel, and also gives a quantitative gradient of DNA concentration. Thus, both the size and the quantity of a particular DNA fragment can be achieved at a glance. Concentration: 920ng / 5ul Recommended loading volume: 5ul Storage Buffer: 1XTE (10mM Tris-HCl, pH8.0, 1mM EDTA) 6x Loading Buffer: 30% Glycerol, 0.12% Bromophenol blue, 0.12% Xylene cyanol Storage -20°C Code Size M103O-1 100 Loadings (500ul) 6X Loading Buffer 200ul per pack M103O-2 5x100 Loadings (5X500ul) 6X Loading Buffer 5X 200ul per pack
1.7% Agarose Gel
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
202
2015-2016 Product Catalog
DNA, RNA, Protein Markers & Cloning Vectors
100 bp-10 Kb Wide Range DNA Logical Marker, Ready to use 16 DNA fragments: 100, 200, 300, 400, 500,600, 800, 1000, 1500, 2kb, 3kb, 4kb, 5kb, 6kb, 8kb, and 10kb The DNA Logic-Marker consists of 16 DNA fragments ranging from 0.1-10kb. The DNA Logic-Marker was formulated to yield such a pattern that each band contains a ‘Logical’ amount of DNA fragment, correlating to its size. The LogicMarker not only reveals a unique pattern for easy recognition of the bands on the gel, but also gives a quantitative gradient of the DNA amount. Thus, both the size and the quantity of a particular DNA fragment can be achieved at a glance. Concentration: 920ng / 6ul Recommended loading volume: 6ul Storage Buffer:1xTE and 1x loading buffer (5% Glycerol, 0.02% Bromophenol blue, 0.02% Xylene cyanol) Storage -20°C Code Size M103R-1 100 loadings (600ul) M103R-2 5x100 loadings (5x600ul)
100bp-48kb Wide Range DNA Marker 24 DNA fragments: 100, 224, 702, 1,264, 1371,1,503, 1,929, 2,323, 3,675, 4,324, 4,827, 5,686, 6,369, 7,639, 8,454, 10,086, 15,004, 23,994, 24,508, 29,964, 33,498, 38,416, and 48,502bp A combination of the Low-Range Marker I and the High-Range Marker. Possessing 24 fragments ranging from 0.1 to 48.5 kb in length, the marker provides an excellent assortment of fragment sizes suitable for many applications. Code
Size
E273
200ug
Lambda DNA / HindIII Marker, Ready to use 7 DNA fragments : 23130*, 9416, 6557, 4361*, 2322, 2027 & 564
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
203
2015-2016 Product Catalog
DNA, RNA, Protein Markers & Cloning Vectors
Lambda DNA is completely digested by HindIII, phenol extracted, ethanol precipitated and dissolved in 10 mM Tris-HCl (pH7.6) and 1mM EDTA. HindIII digest of DNA yields 7 DNA fragments. Concentration: 550ng / 6ul Recommend loading volume: 6ul Storage Buffer:10mM Tris-HCl (pH8.0) and 1mM EDTA, 0.02%, bromophenol blue, 0.02% Xylene cyanol and 5% glycerol *Note: the cohesive ends (12b cos site of bacteriophage ) of the 23130bp and 4361bp fragments may anneal to form a large band. These fragments (marked by *) can be separated by heating to 65OC for 5 min and then cooling on ice for 3 min. Code Size M104R-1 100 Loadings (600ul) M104R-2
5X100 Loadings (5X600ul)
Lambda DNA / HindIII Plus, Ready to use 10 DNA Fragments 23130*,9416, 6557, 4361*, 2322, 2027, 1500, 1000, 564, 300bp Hind III-digested Lambda DNA possesses a big gap between the 564 bp and 2027 bp bands. The Lambda DNA/Hind III Plus marker was developed to fill this gap. Three unique bands (0.3, 1, 1.5kb) have been added to the original marker, providing better visualization in this range. Concentration: 550ng / 6ul Recommended loading volume: 6ul Storage Buffer:10mM Tris-HCl (pH8.0) and 1mM EDTA, 0.02%,Bromophenol blue, 0.02% Xylene cyanol and 5% glycerol *Note: the cohesive ends (12bp cos site of bacteriophage ) of the 23130bp and 4361bp fragments may anneal to form a large band. These fragments (marked by *) can be separated by heating to 65OC for 5 min and then cooling on ice for 3 min. Code Size M105R-1 100 Loadings (600ul) M105R-2
5X100 Loadings (5X600ul)
RNA Markers 16S + 23S RNA Marker Lyophilized 500 applications Source: E. coli Ribosomal RNA Comprised of 2 bands: 1,776bp and 3,566 bp RNase: None Detected Storage: -70°C Code Size DM0818
2.5 mg
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
204
2015-2016 Product Catalog
DNA, RNA, Protein Markers & Cloning Vectors
100-1000bp Low Range RNA Molecular Weight Marker 7 bands: 100, 200, 300, 400, 600, 800, 1000bp The Low Range RNA Molecular Weight Marker is a mixture of 7 chromatographically-purified single-stranded RNA transcripts (100-1000bp). The transcripts are produced from specific templates containing both a fragment of the pTZ19R polylinker and lambda phage fragments. Quantity: tested in gel electrophoresis. RNA concentration is determined spectrophotometrically. The absence of ribonucleases is confirmed by appropriate tests. Usage: 2ul per loading Storage: -20°C Code Size BSM1831 50 loadings (100ul) BSM1833
0.2 % agarose
100 loadings (200ul)
200-6000bp High Range RNA Molecular Weight Marker 8 bands: 200, 500, 1000, 1500, 2000, 3000, 4000, 6000bp The High Range RNA Molecular Weight Marker is a mixture of 8 chromatographically-purified single-stranded RNA transcripts (200-6000bp) produced from specific templates that contain a fragment of the pTZ19R polylinker and lambda phage fragments. Quantity: tested in gel electrophoresis. RNA concentration is determined spectrophotometrically. The absence of ribonucleases is confirmed by appropriate tests. Usage: 2ul per loading Storage: -20 °C Code Size BSM1821 50 loadings (100ul) BSM1823
100 loadings (200ul)
PROTEIN MARKERS 4.1-66kDa Low Range Protein Molecular Weight Marker, Ready to use 9 protein bands: 4.1, 6.5, 9.5, 14.4, 20, 27, 35, 45, 66kDa This marker is a mixture of purified proteins with known molecular weights. The marker resolves to 6 sharp bands when analyzed by SDS-PAGE (Tris-Glycine) and stained with Coommassie Blue R-250. Quantity: sufficient for 10 & 30 loadings mini-gels (8×10cm) Usage: 3ul per loading Storage: -20°C Code Size BM201 10 loadings (30ul) BM201
30 loadings (100ul)
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
205
2015-2016 Product Catalog
DNA, RNA, Protein Markers & Cloning Vectors
14.4-97.4kDa Mid Range Protein Molecular Weight Marker, Ready to use 5 bands: 14.4, 31, 42.7, 66.2, 97.4 kDa The Marker can be applied directly onto SDS-PAGE gel. The marker resolves to 5 sharp bands when analyzed by SDS-PAGE (Tris-Glycine) and stained with Coommassie Blue R-250. Quantity: sufficient for 20 loadings mini-gels (8×10cm) Usage: 10ul per loading Storage: -20°C Code BM523
Size 20 loadings (200ul)
14.4-98kDa Mid Range Protein Molecular Weight Marker, Ready to use 6 bands: 14.4, 20, 31, 45, 66.2, 98kDa The marker is a mixture of purified proteins with known molecular weights. The marker resolves to 6 sharp bands when analyzed by SDS-PAGE (Tris-Glycine) and stained with Coomassie Blue R-250. Quantity: sufficient for up to 50 loadings mini-gels (8×10cm) Usage: 10ul per loading Storage: -20°C Code Size BM524 20 loadings (200ul)
20-120kDa Mid Range Protein Molecular Weight Marker 6 band: 20, 25, 35, 50, 85, 120kDa The marker is a mixture of purified proteins with known molecular weights. The marker resolves to 6 sharp bands when analyzed by SDS-PAGE (Tris-Glycine) and stained with Coomassie Blue R-250. Quantity: sufficient for up to100 loadings mini-gels (8×10cm) Usage: 5ul per loading for mini-gel / 10ul per loading for large gel Storage: -20°C Code Size BSM0441 2x250ul
10-200kDa Wide Range Protein Molecular Weight Marker Unstained 14 band: 10, 15, 20, 25, 30, 40, 50, 60, 70, 85, 100, 120, 150, 200kDa
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
206
2015-2016 Product Catalog
DNA, RNA, Protein Markers & Cloning Vectors
BBI Wide Range Protein Molecular Weight Unstained Marker is designed for accurate sizing of proteins in SDS-polyacrylamide gel electrophoresis, as well as on PVDF, nylon and nitrocellulose membranes. BBI Wide Range Protein Molecular Weight Unstained Marker is a mixture of 14 recombinant, highly purified, unstained proteins ranging in size from 10 kDa to 200 kDa. Quantity: sufficient for up to 100 loadings mini-gels (8×10cm) Usage: 5ul per loading for mini-gel / 10ul per loading for large gel Storage: -20°C Code Size BSM0661 2x250ul
14.4-116kDa Wide Range Protein Molecular Weight Marker, Unstained 7 band: 14.4, 18.4, 25, 35, 45, 66.2, 116kDa Unstained Protein Molecular Weight Marker is designed for accurate sizing of proteins in SDS-polyacrylamide gel electrophoresis, as well as on PVDF, nylon and nitrocellulose membranes. It is a mixture of 7 native proteins ranging in size from 14.4 kDa to 116 kDa. Quantity: sufficient for up to 400 loadings mini-gels (8×10cm) Usage: 5ul per loading for mini-gel / 10ul per loading for large gel Storage: -20°C Code
Size
BSM0431
2x1ml
10-170kDa Wide Range Protein Molecular Weight Marker, Prestained 10 band: 10, 15, 25, 35, 40, 55, 70, 100, 130, 170kDa BBI Wide Range Protein Molecular Weight Prestained Marker is designed for monitoring protein separation during SDS-polyacrylamide gel electrophoresis, verification of Western transfer efficiency on PVDF, nylon and nitrocellulose membranes and for approximate sizing of proteins. It is composed of prestained recombinant prokaryotic proteins. BBI Wide Range Protein Molecular Prestained Weight Marker is a 3-color ladder with 10 proteins covering a molecular weight range from 10 to 170 kDa. The ladder contains one orange reference band at 70 kDa and one green band at 10 kDa. Quantity: sufficient for up to 100 loadings mini-gels (8×10cm) Usage: 5ul per loading for mini-gel / 10ul per loading for large gel Storage: -20°C Code
Size
BSM0671
2x250ul
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
207
2015-2016 Product Catalog
DNA, RNA, Protein Markers & Cloning Vectors
10-175kDa Wide Range Protein Molecular Weight Marker, Prestained 11 band: 10, 15, 25, 35, 40, 55, 60, 70, 90, 120, 175kDa BG00363 Wide Range Protein Marker/Ladder consists of 11 proteins that resolve into sharp, tight bands in the range of 10-175 kDa. This unique protein ladder allows you to monitor protein separation during electrophoresis, estimate molecular weight of the protein of interest, and evaluate western blot transfer efficiency. It also includes ~10, ~40 and ~90 kDa reference bands coupled with blue dye that allow easy tracking and identification. Quantity: sufficient for up to 100 loadings mini-gels (8×10cm) Usage: 5ul per loading for mini-gel / 10ul per loading for large gel Storage: -20°C Code BG00363
Size 500ul
10-240kDa Wide Range Protein Marker, 3-Color Prestained 12 band: 10, 15, 20, 25, 35, 40, 60, 70, 100, 130, 180, 240kDa
The 10-240kDa Wide Range 3 Color Prestained Protein Ladder is a three-color protein standard with 12 pre-stained proteins covering a wide range molecular weights from 10 to 245 kDa. Proteins are covalently coupled with a blue chromophore except for two reference bands (one green and one red band at 25 kDa and 75 kDa respectively) when separated on SDS-PAGE (Tris-glycine buffer).The 10-240kDa Wide Range 3 Color Prestained Protein Ladder is designed for monitoring protein separation during SDS-polyacrylamide gel electrophoresis, verification of Western transfer efficiency on membranes (PVDF, nylon, or nitrocellulose) and for approximating the size of proteins. The ladder is supplied in gel loading buffer and is ready to use. Quantity: sufficient for up to 100 loadings mini-gels (8×10cm) Usage: 5ul per loading for mini-gel / 10ul per loading for large gel Storage: -20°C Storage: -20°C Code
Size
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
208
2015-2016 Product Catalog
BG00364
DNA, RNA, Protein Markers & Cloning Vectors
500ul
Phages, Plasmid DNA, Cloning Vectors & Related Products DNA Phages & Plasmids Item No. MDD22 Store -20 °C
MDD21 Store -20 °C
MSD14 Store -20 °C
MSD15 Store -20 °C
MSD16 Store -20 °C
MSD17 Store -20 °C
NAME Lambda DNA Used as one of the substrates in restriction enzyme research and for the analysis of restriction enzyme activity. Phage is isolated from the heat inducible lysogen E.coli W3350 (cI857 Sam7). DNA is isolated from purified phage by phenol extraction and dialyzed against 10mM Tris-HCl (pH 7.6) and 1mM EDTA. It contains 48502 bases pairs. Concentration: 0.3mg/ml. Storage Buffer: 10mM Tris-HCl (pH7.8) and 1mM Lambda DNA (dam-, dcm-) Used as one of the substrates in restriction enzyme research and for the analysis of endonuclease sensitivity to Dam or Dcm methylation activity. Phage is isolated from heat inducible lysogen E.coli GM2163 (cI857 Sam7). DNA is isolated from purified phage by phenol extraction and dialyzed against 10mM Tris-HCl (pH 7.8) and 1mM EDTA. It contains 48502 bases pairs. Concentration: 0.3mg/ml Storage Buffer: 10mM Tris-HCl (pH7.8) and 1mM EDTA. pBR322 DNA Isolated from E.coli (dam+, dcm+) and purified by ultra centrifugation. The molecule is a double-stranded circle (4361bp in length). Concentration: 0.25mg/ml Storage Buffer: 10mM Tris-HCl (pH7.8) and 1mM EDTA pUC18 DNA pUC18 DNA is isolated from E.coli strain DH5. Purified by ultra centrifugation through a cesium chloride gradient in the presence of ethidium bromide. The molecule is double-stranded, 2686 bases pairs in length. Concentration: 0.3-0.5mg/ml Storage Buffer: 10mM Tris-HCl (pH7.8) and 1mM EDTA pUC19 DNA Isolated from E.coli strain DH5. Purified by ultra centrifugation through a cesium chloride gradient in the presence of ethidium bromide. The molecule is double-stranded, 2686 bases pairs in length. Concentration: 0.2mg/ml Storage Buffer: 10mM Tris-HCl (pH7.8) and 1mM EDTA pUC57 DNA Isolated from E.coli strain DH5. Purified by ultra centrifugation through a cesium chloride gradient in the presence of ethidium bromide. The molecule is double-stranded, 2710 bases pairs in length. Concentration: 0.3-0.5mg/ml Storage Buffer: 10mM Tris-HCl (pH7.8) and 1mM EDTA
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
Size 0.1 mg
0.1 mg
50ug
50ug
50ug
50ug
209
2015-2016 Product Catalog
pUCM-T Cloning Vector Designed for the cloning of PCR products possessing overhanging 3’ A-residues produced by Taq or other DNA polymerase. The DNA sequence of the pUCM-T vector is the same as pUC19 (GenBank Accession Number M77789) except for minor differences at the multiple cloning site. The vector can also be used for the cloning of blunt-ended DNA fragments, which requires the addition of an A-residue at the 3’ end prior to cloning (the A-Tailing Kit (BS514) is suitable here). The procedure is simple & fast. 1ug of the pUCM-T Cloning Vector is used for 20 reactions. Store at -20 0C Store: -20 °C Item NAME No. BS433 pUCM-T-Cloning Vector BS434 pUCM-T-Cloning Vector BS435 pUCM-T-Cloning Vector Kit (with 100U T4 DNA Ligase, 50ul 10x Ligation Buffer, 50ul 50% PEG 4000, 1ml ddH2O) BS436 pUCM-T-Cloning Vector Kit (with 500U T4 DNA Ligase, 250ul 10x Ligation Buffer, 250ul 50% PEG 4000, 5ml ddH2O)
DNA, RNA, Protein Markers & Cloning Vectors
Size 1 ug 5 ug 20 preps
100 preps
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
210
2015-2016 Product Catalog
Recombinant Proteins & Protein Related Products
5.1 Recombinant Proteins (Cytokines; Growth Factors; Chemokines; Neurotrophins; Hormones; Enzymes) RC214-25 Store -20°C
RC214-25R Store -20°C
RC214-20 Store -20°C
RC214-15 Store -20°C
RC214-15R Store -20°C
RC312-24 Store -20°C
RC214-21 Store -20°C
RC218-24H Store -20°C
RC218-23 Store -20°C
RC238-23 Store -20°C
4-1BB Ligand (rHu4-1BBL )(Human, recombinant, produced in E.coli) Lyophilized. Molecular Weight: Approximately 19.4 kDa, a single non-glycosylated polypeptide chain containing 184 amino acids. Purity>95% by SDS-PAGE and HPLC. Endotoxin 97% by SDS-PAGE and HPLC. Endotoxin 95% by SDS-PAGE and HPLC. Endotoxin 95% by HPLC. Endotoxin 95% by HPLC. Endotoxin 97% by SDS-PAGE and HPLC. Endotoxin 98% by SDS-PAGE and HPLC. Endotoxin 90% by SDS-PAGE. Endotoxin 98% by SDS-PAGE and HPLC. Endotoxin 96% by SDS-PAGE and HPLC. Endotoxin 95% by HPLC. Endotoxin 95% by SDS-PAGE. Endotoxin 95% by SDS-PAGE. Endotoxin 97% by SDS-PAGE. Endotoxin 100U/mg. Recombinant, Lyphilized powder. Highly purified by affinity chromatography. Protein> 65%. Activity>100U/mg. Unit Definition: One unit will hydrolyze 1.0 μmole of hippuryl-L-arginine per min at pH 7.65 at 25 °C. Carboxypeptidase A, chymotrypsin & trypsin: none-detected. Carboxypeptidase B (Peptidyl-L-lysine(L-arginine) hydrolase, Protaminase) >170U/mg. Recombinant, Lyphilized powder. Highly purified by affinity chromatography. Protein >70%. Activity>170U/mg. Unit Definition: One unit will hydrolyze 1.0 μmole of hippuryl-L-arginine per min at pH 7.65 at 25 °C. Carboxypeptidase A, chymotrypsin & trypsin: none-detected. Carboxypeptidase B (Peptidyl-L-lysine(L-arginine) hydrolase, Protaminase) >250U/mg. Recombinant, Lyphilized powder. Highly purified by affinity chromatography. Activity>250U/mg. Unit Definition: One unit will hydrolyze 1.0 μmole of hippuryl-L-arginine per min at pH 7.65 at 25 °C. Carboxypeptidase A, chymotrypsin & trypsin: none-detected. CCL1 see I-309 CCL2 see MCP-1 CCL3 see MIP-1 alpha CCL4 see MIP-1 beta CCL5 see RANTES CCL7 see MCP-3 CCL8 see MCP-2 CCL11 see Eotaxin CCL13 see MCP-4 CCL14 see Hemofiltrate CC Chemokine-1 CCL15 see MIP-5 CCL16 see HCC-4 CCL17 see TARC CCL18 see MIP-4 CCL20 see MIP-3 alpha CCL21 see Exodus-2 CCL22 see Mdc CCL23 see MIP-3 CCL24 see Eotaxin-2 CCL25 see TECK CCL28 see MEC Cardiotrophin-1 (rRtCT-1) (Rat, recombinant, produced in E.coli) Lyophilized. Molecular Weight: Approximately 21.4 kDa, a single non-glycosylated polypeptide chain containing 203 amino acids. Purity>95% by SDS-PAGE, and HLPC. Endotoxin 95% by SDS-PAGE, and HLPC. Endotoxin 95% by SDS-PAGE, and HLPC. Endotoxin 95% by SDS-PAGE and HPLC. Endotoxin 95% by SDS-PAGE and HPLC. Endotoxin 96% by SDS-PAGE and HPLC. Endotoxin 97% by SDS-PAGE and HPLC. Endotoxin 95% by SDS-PAGE and HPLC. Endotoxin 95% by SDS-PAGE and HPLC. Endotoxin 97% by HPLC. Endotoxin >95% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated (1mg/ml) solution in PBS, pH 7.4. Cyclin-Dependent Kinase Inhibitor 2A, Isoform 1-TAT (rHuP16-INK4a-TAT)(Human, recombinant, produced in E.coli) Lyophilized. Molecular Weight: Approximately18.0 kDa, a single non-glycosylated polypeptide chain containing 167 amino acids. Purity>95% by SDS-PAGE and HPLC. Endotoxin Less than 1 EU/µg of rHuP16-INK4a-TAT as determined by LAL method. Formulation: Lyophilized from a 0.2 µm filtered concentrated solution in 2 × PBS, pH 7.0. Cysteine-rich Angiogenic Inducer 61 (rHuCYR61) (Human, recombinant, produced in E.coli ) Lyophilized. Molecular
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
10 ug 50 ug 1 mg 10 ug 50 ug 1 mg 10 ug 50 ug 1 mg
5 ug 25 ug 1 mg
5 ug 20 ug 1mg
5 ug 25 ug 1 mg
5 ug 25 ug 1 mg
5 ug 25 ug 1mg 10 ug 50 ug 1 mg
10 ug 50 ug 1 mg
20 ug
213
2015-2016 Product Catalog
RC220-12 Store -20°C
RC260-12 Store -20°C
RC220-13 Store -20°C
RC240-13 Store -20°C
RC260-14 Store -20°C
RC220-14 Store -20°C
RC260-15 Store -20°C
RC220-15 Store -20°C
RC332-14 Store -20°C
RC312-16 Store -20°C
RC214-23 Store -20°C
Recombinant Proteins & Protein Related Products
Weight: Approximately 39.4 kDa, a single non-glycosylated polypeptide chain containing 357 amino acids.Purity>>95% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2 µm filtered concentrated solution in citrate buffer solution, 300 mM NaCl, pH 3.0.
1 mg
beta-Defensin 1 (rHuBD-1) (Human, recombinant, produced in E.coli ) Lyophilized. Molecular Weight: Approximately 5.0 KDa, a single non-glycosylated polypeptide chain containing 47 amino acids. Purity>98% by HPLC. Endotoxin 95% by SDS-PAGE and HPLC. Endotoxin Less than 1 EU/µg of rRtBD-1 as determined by LAL method.Formulation: Lyophilized from a 0.2 µm filtered concentrated solution in 20 mM PB, 500 mM NaCl, pH 7.0. beta-Defensin 2 (rHuBD-2) (Human, recombinant, produced in E.coli ) Lyophilized. Molecular Weight: Approximately 4.3 KDa, a single non-glycosylated polypeptide chain containing 41 amino acids. Purity>98% by HPLC. Endotoxin 98% by SDS-PAGE and HPLC. Endotoxin 95% by SDS-PAGE and HPLC. Endotoxin Less than 1 EU/μg of rRtBD-3 as determined by LAL method.Formulation: Lyophilized from a 0.2 μm filtered concentrated solution in PBS, pH 7.4. beta-Defensin 3 (rHuBD-3) (Human, recombinant, produced in E.coli ) Lyophilized. Molecular Weight: Approximately 5.1 KDa, a single non-glycosylated polypeptide chain containing 45 amino acids. Purity>98% by SDS-PAGE and HPLC. Formulation: Lyophilized from a 0.2m filtered concentrated solution in 20mM PB, pH 7.4, 130mM NaCl. Beta-defensin 4 (rRtBD-4) (Rat, recombinant, produced in E.coli) Lyophilized. Molecular Weight: Approximately 4.4 kDa, a single non-glycosylated polypeptide chain containing 41 amino acids.Purity>95% by SDS-PAGE and HPLC. Endotoxin Less than 1 EU/µg of rRtBD-4 as determined by LAL method. Formulation: Lyophilized from a 0.2 µm filtered concentrated solution in 10 mM PB, pH 7.4, 500 mM NaCl. beta-Defensin 4 (rHuBD-4) (Human, recombinant, produced in E.coli ) Lyophilized. Molecular Weight: Approximately 6.0 KDa, a single non-glycosylated polypeptide chain containing 50 amino acids. Purity>98% by HPLC. Endotoxin 97% by SDS-PAGE and HPLC. Endotoxin Less than 1 EU/g of rMuDCIP-1/CXCL3 as determined by LAL method. Formulation: Lyophilized from a 0.2 m filtered concentrated solution in PBS, pH 7.4. DNase I see Biochemicals Chapter EGF see Epidermal Growth Factor EK see Enterokinase EMAP see Endothelial-Monocyte Activating Polypeptide II ENA-78 (5-78a.a.) (rHuENA-78/CXCL5) (Human, recombinant, produced in E.coli ) Lyophilized. Molecular Weight: 8.0 kDa, a single non-glycosylated polypeptide chain containing 74 amino acids. Purity>97% by SDS-PAGE and HPLC. Endotoxin 98% by HPLC. Endotoxin 98% by HPLC. Endotoxin 95% by SDS-PAGE and HPLC analyses. Endotoxin 95% by SDS-PAGE and HPLC. Endotoxin 97% by SDS-PAGE and HPLC. Endotoxin 96% by SDS-PAGE and HPLC analyses. Endotoxin 96% by SDS-PAGE and HPLC analyses. Endotoxin 95% by SDS-PAGE and HPLC. Endotoxin 95% by SDS-PAGE and HPLC. Endotoxin 95% by SDS-PAGE and HPLC analyses. Endotoxin 95% by SDS-PAGE and HPLC analyses. Endotoxin 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in PBS, pH 7.4. Fibroblast Growth Factor-21 (rMuFGF-21) (Murine, recombinant, produced in E.coli) Lyophilized. Molecular Weight: Approximately 19.9 kDa, a single non-glycosylated polypeptide chain containing 182 amino acids. Purity>97% by SDS-PAGE and HPLC. Endotoxin 95% by SDS-PAGE and HPLC. Endotoxin 95% by SDS-PAGE and HPLC analyses. Endotoxin 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in PBS, pH 7.4. Flagellin, His (rFlagellin, His) (Recombinant, produced in E.coli ) Lyophilized. Molecular Weight: Approximately 52.7 kDa, a single non-glycosylated polypeptide chain containing 503 amino acids, with Leu, Glu and 6 × His at C-terminus.Purity>95% by SDS-PAGE and HPLC analyses. Endotoxin 97% by SDS-PAGE and HPLC analyses. Endotoxin 97% by SDS-PAGE and HPLC analyses. Endotoxin 97% by SDS-PAGE and HPLC analyses. Endotoxin 97% by SDS-PAGE and HPLC analyses. Endotoxin 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in 20mM PB, pH 7.4, 50mM NaCl. Fractalkine/CX3CL1 (rRtFractalkine/CX3CL1) (Rat, recombinant, produced in E.coli) Lyophilized. Molecular Weight: Approximately 8.8 kDa, a single non-glycosylated polypeptide chain containing 76 amino acids and comprises only the chemokine domain of Human Fractalkine. Purity>95% by SDS-PAGE and HPLC. Endotoxin Less than 1 EU/µg of rRtFractalkine/CX3CL1 as determined by LAL method. Formulation: Lyophilized from a 0.2 µm filtered concentrated solution in 2× PBS, pH 7.4. G-CSF see Granulocyte Colony Stimulating Factor GM-CSF see Granulocyte Colony Stimulating Factor GH see Growth Hormone GMF-β see Glia Maturation Factor beta Glia Maturation Factor beta (rHu GMF-β) (Human, recombinant, produced in E.coli ) Lyophilized. Molecular Weight: 16.5 KDa, a single non-glycosylated polypeptide chain containing 141 amino acids. Purity>98% by HPLC analyses. Endotoxin 98% by SDS-PAGE and HPLC analyses. Endotoxin 98% by HPLC analyses. Endotoxin 98% by HPLC analyses. Endotoxin 96% by HPLC analyses. Endotoxin 95% by SDS-PAGE and HPLC analyses. Endotoxin 95% by SDS-PAGE and HPLC analyses. Endotoxin 95% by SDS-PAGE and HPLC analyses. Endotoxin 98% by HPLC analyses. Endotoxin 97% by HPLC analyses. Endotoxin 97% by SDS-PAGE and HPLC analyses. Endotoxin 97% by SDS-PAGE and HPLC analyses. Endotoxin 97% by HPLC analyses. Endotoxin 97% by HPLC analyses. Endotoxin 96% by SDS-PAGE and HPLC analyses. Endotoxin 97% by HPLC. Endotoxin 96% by HPLC analyses. Endotoxin 95% by SDS-PAGE and HPLC. Endotoxin Less than 1 EU/g of rHuHCC-1, 66a.a./CCL14 as determined by LAL method. Formulation: Lyophilized from a 0.2 m filtered concentrated solution in 2 × PBS, pH 7.4, 5 % trehalose. Heparin-binding EGF-like Growth Factor (rHuHB-EGF) (Human, recombinant, produced in E.coli ) Lyophilized. Molecular Weight: Approximately 9.7 kDa, a single non-glycosylated polypeptide chain containing 86 amino acids.Purity>97% by HPLC. Endotoxin 95% by SDS-PAGE and HPLC. Endotoxin 97% by SDS-PAGE and HPLC. Endotoxin 95% by SDS-PAGE and HPLC analyses. Endotoxin 95% by SDS-PAGE and HPLC analyses. Endotoxin 95% by SDS-PAGE and HPLC analyses. Endotoxin 95% by HPLC analyses. Endotoxin 95% by HPLC. Endotoxin >96% by HPLC analyses. Endotoxin >97% by SDS-PAGE and HPLC analyses. Endotoxin 98% by SDS-PAGE and HPLC analyses. Endotoxin 96% by SDS-PAGE and HPLC analyses. Endotoxin 97% by SDS-PAGE and HPLC analyses. Endotoxin 98% by SDS-PAGE and HPLC analyses. Endotoxin 96% by SDS-PAGE and HPLC analyses. Endotoxin 96% by SDS-PAGE and HPLC analyses. Endotoxin 96% by SDS-PAGE and HPLC analyses. Endotoxin 95% by HPLC. Endotoxin 95% by SDS-PAGE and HPLC analyses. Endotoxin 97% by SDS-PAGE and HPLC. Endotoxin Less than 1EU/µg of rMuIP-10/CXCL10 as determined by LAL method. Formulation: Lyophilized from a 0.2 µm filtered concentrated solution in 2 × PBS, pH 7.4. Interferon-γ Inducible Protein 10/CXCL10 (rRhIP-10/CXCL10) (Rhesus Macaque, recombinant, produced in E.coli) Lyophilized. Molecular Weight: Approximately 8.7 kDa, a single non-glycosylated polypeptide chain containing 77 amino acids. Purity>97% by SDS-PAGE and HPLC. Endotoxin Less than 1 EU/µg of rRhIP-10/CXCL10 as determined by LAL method. Formulation: Lyophilized from a 0.2 µm filtered concentrated solution in PBS, pH 7.4. Interferon-λ1 (rHuIFN-γ/IL-29) (Human, recombinant, produced in E.coli ) Lyophilized. Molecular Weight: 19.8 kDa, a single non-glycosylated polypeptide chain containing 178 amino acids. Purity>97% by HPLC analyses. Endotoxin 97% by SDS-PAGE and HPLC analyses. Endotoxin 95% by SDS-PAGE and HPLC analyses. Endotoxin 97% by SDS-PAGE and HPLC analyses. Endotoxin 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in PBS, pH 7.5. Interleukin-1 alpha (rMuIL-1α) (Murine, Recombinant, produced in E.coli) Lyophilized. Molecular Weight: Approximately 17.9 kDa, a single non-glycosylated polypeptide chain containing 156 amino acids. Purity>97% by SDS-PAGE and HPLC analyses. Endotoxin 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in PBS, pH 7.4. Interleukin-1 alpha (rRtIL-1α) (Rat, recombinant, produced in E.coli) Lyophilized. Molecular Weight: Approximately 17.8 kDa, a single non-glycosylated polypeptide chain containing 156 amino acids. Purity>97% by SDS-PAGE and HPLC. Endotoxin 97% by SDS-PAGE and HPLC analyses. Endotoxin 95% by SDS-PAGE and HPLC. Endotoxin 98% by SDS-PAGE and HPLC analyses. Endotoxin 98% by SDS-PAGE and HPLC analyses. Endotoxin 95% by SDS-PAGE and HPLC analyses. Endotoxin 95% by SDS-PAGE and HPLC. Endotoxin Less than 1 EU/g of rPoIL-1β as determined by LAL method. Formulation: Lyophilized from a 0.2 m filtered concentrated solution in PBS, pH 7.4, 3 % trehalose. Interleukin-1 Receptor Antagonist (rRtIL-1RA) (Rat, recombinant, produced in E.coli) Lyophilized. Molecular Weight: Approximately 17.4 kDa, a single non-glycosylated polypeptide chain containing 152 amino acids. Purity>96% by SDS-PAGE and HPLC. Endotoxin 95% by SDS-PAGE and HPLC analyses. Endotoxin 95% by SDS-PAGE and HPLC. Endotoxin 95% by SDS-PAGE and HPLC. Endotoxin 97% by SDS-PAGE and HPLC analyses. Endotoxin 95% by HPLC analyses. Endotoxin 96% by SDS-PAGE and HPLC. Endotoxin Less than 1 EU/g of rPoIL-2 as determined by LAL method. Formulation: Lyophilized from a 0.2 m filtered concentrated solution in 1 × PBS, pH 7.4. Interleukin-3 (rHuIL-3) (Human, recombinant, produced in E.coli ) Lyophilized. Molecular Weight: 15 kDa, a single non-glycosylated polypeptide chain containing 133 amino acids. Purity>97% by HPLC analyses. Endotoxin 97% by HPLC . Endotoxin 98% by HPLC. Endotoxin 97% by HPLC. Endotoxin 98% by HPLC.Endotoxin 95% by HPLC. Endotoxin 96% by HPLC analyses. Endotoxin 95% by SDS-PAGE and HPLC. Endotoxin 96% by HPLC analyses. Endotoxin 98% by HPLC analyses. Endotoxin 98% by SDS-PAGE and HPLC. Endotoxin 97% by HPLC analyses. Endotoxin 97% by HPLC.. Endotoxin 97% by HPLC . Endotoxin 97% by HPLC. Endotoxin 95% by HPLC. Endotoxin< 1EU/g of rHuIL-7 as determined by LAL method. Formulation: Lyophilized from a 0.2m filtered concentrated solution in PBS, pH 7.4. Interleukin-7 (rRtIL-7) (Rat, recombinant, produced in E.coli) Lyophilized. Molecular Weight: Approximately 14. 9 kDa, a single non-glycosylated polypeptide chain containing 129 amino acids. Purity>95% by SDS-PAGE and HPLC. Endotoxin 95% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in PBS, pH 7.4. Interleukin-8 (77a.a.) (rHuIL-8 (77a.a.)) (Human, recombinant, produced in E.coli ) Lyophilized. Molecular
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
20 ug 1 mg 5 ug 20 ug 1 mg
5 ug 20 ug 1 mg
5 ug 20 ug 1 mg
2 ug 10 ug 1 mg
2 ug 10 ug 1 mg
5 ug 20 ug 1 mg
2 ug 10 ug 1 mg
2 ug 10 ug 1 mg
2 ug 10 ug 1 mg
2 ug 10 ug 1 mg
2 ug 10 ug 1 mg
5 ug 25 ug 1 mg
5 ug 25 ug
225
2015-2016 Product Catalog
RC222-19 Store -20°C
RC282-19 Store -20°C
RC242-19 Store -20°C
RC212-20 Store -20°C
RC212-21 Store -20°C
RC232-21 Store -20°C
RC252-21 Store -20°C
RC212-22 Store -20°C
RC232-22 Store -20°C
RC212-23 Store -20°C
RC212-24 Store -20°C
RC232-24 Store -20°C
RC222-24 Store -20°C
RC212-24V
Recombinant Proteins & Protein Related Products
Weight: 8,904 Da, a single, non-glycosylated polypeptide chain containing 77 amino acids. Purity>95% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in PBS, pH 7.4. Interleukin-8/CXCL8 (rRhIL-8/CXCL8), (Rhesus Macaque, recombinant, produced in E.coli) Lyophilized. Molecular Weight: Approximately 9.14kD containing 79 amino acid residues.Purity>95% by SDS-PAGE and HPLC. Endotoxin Less than 1 EU/g of rPoIL-8/CXCL8 as determined by LAL method. Formulation: Lyophilized from a 0.2 µm filtered concentrated solution in PBS, pH 7.4. Interleukin-8/CXCL8 (rPoIL-8/CXCL8) (Porcine, recombinant, produced in E.coli) Lyophilized. Molecular Weight: Approximately 9.1 kDa, a single non-glycosylated polypeptide chain containing 78 amino acids. Purity>95% by SDS-PAGE and HPLC. Endotoxin Less than 1 EU/g of rPoIL-8/CXCL8 as determined by LAL method. Formulation: Lyophilized from a 0.2 m filtered concentrated solution in 2 × PBS, pH 7.4. Interleukin-8/CXCL8 (rCaIL-8/CXCL8) (Canine, recombinant, produced in E.coli) Lyophilized. Molecular Weight: Approximately 9.1 kDa, a single non-glycosylated polypeptide chain containing 79 amino acids. Purity>95% by SDS-PAGE and HPLC. Endotoxin 95% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in PBS, pH 7.4. Interleukin-10 (rHuIL-10) (Human, recombinant, produced in E.coli ) Lyophilized. Molecular Weight: 18.6kDa, a single non-glycosylated polypeptide chain containing 161 amino acids. Purity>95% by HPLC. Endotoxin 97% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in PBS, pH 7.4. Interleukin-10 (rRtIL-10) (Rat, Recombinant, produced in E.coli) Lyophilized. Molecular Weight: Approximately 18.7kDa, a single non-glycosylated polypeptide chain containing 161 amino acids. Purity>97% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in PBS, pH 7.4. Interleukin-11 (rHuIL-11) (Human, recombinant, produced in E.coli ) Lyophilized. Molecular Weight: 19.1 kDa, a single non-glycosylated polypeptide chain containing 178 amino acids. Purity>97% by HPLC. Endotoxin< 1EU/g of rHuIL-11 as determined by LAL method. Formulation: Lyophilized from a 0.2m filtered concentrated solution in PBS, pH 7.4. Interleukin-11 (rMuIL-11) (Murine, Recombinant, produced in E.coli) Lyophilized. Molecular Weight: 19.1 kDa, a single non-glycosylated polypeptide chain containing 179 amino acids. Purity>97% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered solution in PBS, pH 7.4. Interleukin-12 (rHuIL-12) (Human, Recombinant, produced in CHO) Lyophilized. Molecular Weight: 75 kDa, consisting of a 306 amino acid residue p40 subunit and a 197 amino acid residue p35 subunit. Purity>98% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in PBS, pH 7.4. Interleukin-13 (rHuIL-13) (Human, recombinant, produced in E.coli ) Lyophilized. Molecular Weight: 12.5 kDa, a single non-glycosylated polypeptide chain containing 114 amino acids. Purity>96% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in PBS, pH 7.4. Interleukin-13 (rMuIL-13) (Murine, Recombinant, produced in E.coli) Lyophilized. Molecular Weight: 12.3 kDa, a single non-glycosylated polypeptide chain containing 111 amino acids. Purity>97% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered solution in PBS, pH 7.4. Interleukin-13 (rRhIL-13)(Rhesus Macaque, Recombinant, produced in E.coli) Lyophilized. Molecular Weight: Approximately12.6 kDa, a single non-glycosylated polypeptide chain containing 114 amino acids.Purity>98% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered solution in PBS, pH 7.4, 3% trehalose. Interleukin-13 Variant
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
1 mg
5 ug 25 ug 1 mg
5 ug 25 ug 1 mg
5 ug 25 ug 1 mg
2 ug 10 ug 1 mg
2 ug 10 ug 1 mg
2 ug 10 ug 1 mg 2 ug 10 ug 1 mg
2 ug 10 ug 1 mg
2 ug 10 ug 1 mg 2 ug 10 ug 1 mg
2 ug 10 ug 1 mg 2 ug 10 ug 1 mg 2 ug 10 ug 1 mg
2 ug
226
2015-2016 Product Catalog Store -20°C
RC222-24 Store -20°C
RC252-24 Store -20°C
RC252-24B Store -20°C
RC212-26 Store -20°C
RC212-27 Store -20°C
RC21112-27B Store -20°C
RC222-27 Store -20°C
RC232-27 Store -20°C
RC212-28 Store -20°C
RC212-28F Store -20°C
RC212-31 Store -20°C
RC212-32 Store -20°C
RC252-32 Store -20°C
Recombinant Proteins & Protein Related Products
(rHuIL-13V) (Human, recombinant, produced in E.coli ) Lyophilized. Molecular Weight: 12.5 kDa, a single non-glycosylated polypeptide chain containing 114 amino acids, with a substitution of Q for R at position 112 compared with the wild type IL-13. Purity>95% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in PBS, pH 7.2, containing 5% trehalose. Interleukin-13 (rRhIL-13) (Rhesus Macaque, Recombinant, produced in E.coli) Lyophilized. Molecular Weight: Approximately12.6 kDa, a single non-glycosylated polypeptide chain containing 114 amino acids.Purity>98% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2 m filtered concentrated solution in PBS, pH 7.4, 3% trehalose. Interleukin-13 (rRtIL-13) (Rat, Recombinant, produced in E.coli) Lyophilized. Molecular Weight: Approximately 11.9 kDa, a single non-glycosylated polypeptide chain containing 109 amino acids. Purity>97% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in PBS, pH 7.4. Interleukin-13 (113a.a.) (rRtIL-13, 113a.a.) (Rat, recombinant, produced in E.coli) Lyophilized. Molecular Weight: Approximately 12.3 kDa, a single non-glycosylated polypeptide chain containing 113 amino acids. Purity>98% by SDS-PAGE and HPLC. Endotoxin 96% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in PBS, pH 7.4. Interleukin-16 (rHuIL-16) (Human, recombinant, produced in E.coli ) Lyophilized. Molecular Weight: Approximately 12.4 kDa, a single non-glycosylated polypeptide chain containing 121 amino acids. Purity>95% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in PBS, pH 7.4. Interleukin-16 (130a.a.) (rHuIL-16, 130 aa) (Human, recombinant, produced in E.coli ) Lyophilized. Molecular Weight: Approximately 13.4 kDa, a single non-glycosylated polypeptide chain containing 130amino acids. Purity>95% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2 µm filtered concentrated solution in 20 mM Tris, 150 mM NaCl, pH 7.0. Interleukin-16 (rRhIL-16) (Rhesus Macaque, recombinant, produced in E.coli ) Lyophilized. Molecular Weight: Approximately 12.5 kDa, a single non-glycosylated polypeptide chain containing 121 amino acids. Purity>98% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in PBS, pH 7.4. Interleukin-16 (rMuIL-16) (Murine, recombinant, produced in E.coli ) Lyophilized. Molecular Weight: Approximately 12.2 kDa, a single non-glycosylated polypeptide chain containing 118 amino acids.Purity>98% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in PBS, pH 7.4. Interleukin-17 (rHuIL-17) (Human, recombinant, produced in E.coli ) Lyophilized. Molecular Weight: 31.0 kDa, disulfide-linked homodimer of two 136 amino acid polypeptide chains. Purity>96% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in PBS, pH 7.4. Interleukin-17F (rHuIL-17F) (Human, recombinant, produced in E.coli ) Lyophilized. Molecular Weight: A disulfide-linked homodimer of 30.1kDa, consisting of two 133 amino acid polypeptide chains Purity>95% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated (1mg/ml) solution in PBS, pH 7. Interleukin-20 (rHuIL-20) (Human, recombinant, produced in E.coli ) Lyophilized. Molecular Weight: 17.6 kDa, a single non-glycosylated polypeptide chain containing 153 amino acids. Purity>95% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in PBS, pH 7.4. Interleukin-21 (rHuIL-21) (Human, recombinant, produced in E.coli ) Lyophilized. Molecular Weight: 15.4 kDa, a single non-glycosylated polypeptide chain containing 132 amino acids.. Purity>97% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in PBS, pH 7.4 Interleukin-21 (rRtIL-21) (Rat, recombinant, produced in E.coli) Lyophilized. Molecular Weight: Approximately 15.2 kDa, a single non-glycosylated polypeptide chain containing 129 amino acids. Purity>96% by SDS-PAGE and HPLC. Endotoxin
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
10 ug 1 mg
2 ug 10 ug 1 mg
2 ug 10 ug 1 mg
2 ug 10 ug 1 mg
2 ug 10 ug 1 mg 2 ug 10 ug 1 mg
2 ug 10 ug 1 mg
2 ug 10 ug 1 mg
2 ug 10 ug 1 mg
5 ug 25 ug 1 mg 5 ug 25 ug 1 mg
2 ug 10 ug 1 mg 2 ug 10 ug 1 mg 2 ug 10 ug 1 mg
227
2015-2016 Product Catalog
RC212-33 Store -20°C
RC232-33 Store -20°C
RC252-33 Store -20°C
RC212-42 Store -20°C
RC212-44 Store -20°C
RC232-44 Store -20°C
RC252-44 Store -20°C
RC212-47A Store -20°C
RC212-47B Store -20°C
RC232-47A Store -20°C
RC232-47B Store -20°C
RC212-47C Store -20°C
RC232-47D Store -20°C
Recombinant Proteins & Protein Related Products
97% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in PBS, pH 5.0. Interleukin-22 (rMuIL-22) (Murine, recombinant, produced in E.coli) Lyophilized. Molecular Weight: Approximately 16.6 kDa, a single non-glycosylated polypeptide chain containing 146 amino acids. Purity>96% by SDS-PAGE and HPLC. Endotoxin 97% by SDS-PAGE and HPLC. Endotoxin 97% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in PBS. Interleukin-33 (rHuIL-33) (Human, recombinant, produced in E.coli ) Lyophilized. Molecular Weight: 17.9 kDa, a single non-glycosylated polypeptide chain containing 159 amino acids. Purity>97% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2μm filtered concentrated solution in 20mM PB, 150mM NaCl, 1mM EDTA, 2mM β-Mercaptoethanol, pH7.4. Interleukin-33 (rMuIL-33) (Murine, Recombinant, produced in E.coli) Lyophilized. Molecular Weight: 17.5 kDa protein containing 158 amino acid residues. Purity>98% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a filtered solution in PBS, EDTA and DTT. Interleukin-33 (rRtIL-33) (Rat, recombinant, produced in E.coli) Lyophilized. Molecular Weight: Approximately 17.4 kDa, a single non-glycosylated polypeptide chain containing 156 amino acids. Purity>95% by SDS-PAGE and HPLC. Endotoxin 95% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2 m filtered concentrated solution in 2 × PBS, pH 7.4. Interleukin-36Alpha (rHuIL-36α, 153a.a.) (Human, Recombinant, produced in E.coli) Lyophilized. Molecular Weight: Approximately 17.1 kDa, a single non-glycosylated polypeptide chain containing 153 amino acids.Purity>95% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2 m filtered concentrated solution in 20 mM Tris, 300 mM NaCl, pH 8.0, 0.1 % Tween 80. Interleukin-36Alpha (160a.a.) (rMuIL-36α, 160a.a.) (Murine, Recombinant, produced in E.coli) Lyophilized. Molecular Weight: Approximately 18.0 kDa, a single non-glycosylated polypeptide chain containing 160 amino acids.Purity>95% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2 m filtered concentrated solution in PBS, pH 7.4, 5 % trehalose. Interleukin-36Alpha (153a.a.) (rMuIL-36α, 153a.a.) (Murine, Recombinant, produced in E.coli) Lyophilized. Molecular Weight: Approximately 17.1kDa, a single non-glycosylated polypeptide chain containing 153 amino acids.Purity>95% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2 m filtered concentrated solution in PBS, 1 mM DTT, 3 % trehalose. Interleukin-36Beta (rHuIL-36 β, 157a.a.) (Human, Recombinant, produced in E.coli) Lyophilized. Molecular Weight: Approximately 17.7kDa, a single non-glycosylated polypeptide chain containing 157 amino acids. Purity>97% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2 m filtered concentrated solution in PBS, pH 7.4. Interleukin-36 beta (153a.a.) (rMuIL-36β, 153a.a.) (Murine, Recombinant, produced in E.coli) Lyophilized.
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
2 ug 10 ug 1 mg
2 ug 10 ug 1 mg
2 ug 10 ug 1 mg
2 ug 10 ug 1 mg 2 ug 10 ug 1 mg
2 ug 10 ug 1 mg 2 ug 10 ug 1 mg
2 ug 10 ug 1 mg
2 ug 10 ug 1 mg
2 ug 10 ug 1 mg
2 ug 10 ug 1 mg
2 ug 10 ug 1 mg
2 ug 10 ug
228
2015-2016 Product Catalog
RC232-47G Store -20°C
RC312-21 Store -20°C
RC312-22 Store -20°C
RC4A1-16 Store -20°C RC412-17 Store -20°C
RC214-18 Store -20°C
RC234-18 Store -20°C
Recombinant Proteins & Protein Related Products
Molecular Weight: Approximately 17.4 kDa, a single non-glycosylated polypeptide chain containing 153 amino acids.Purity>97% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2 µm filtered concentrated solution in PBS, pH 7.4, 5% trehalose. Interleukin-36 Receptor Antagonist Protein (rMuIL-36RA) (Murine, Recombinant, produced in E.coli) Lyophilized. Molecular Weight: Approximately 16.9 kDa, a single non-glycosylated polypeptide chain containing 154 amino acids.Purity>95% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2 µm filtered concentrated solution in PBS, pH 7.4. IP-10 (rHuIP-10/CXCL10) (Human, recombinant, produced in E.coli ) Lyophilized. Molecular Weight: 8.5 kDa, a single non-glycosylated polypeptide chain containing 77 amino acids. Purity>97% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in 20mM PB, pH 7.4, 50mM NaCl. RNase A see Biochemicals Chapter I-TAC (rHuI-TAC/CXCL11) (Human, recombinant, produced in E.coli ) Lyophilized. Molecular Weight: 8.3 kDa, a single non-glycosylated polypeptide chain containing 73 amino acids. Purity>97% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in 20mM PB, pH 7.4, 100mM NaCl. KC see GRO CXCL1 Keratinocye Growth Factor see Fibroblast Growth Factor-7 Keratinocye Growth Factor-2 see Fibrobalst Growth Factor-10 KGF-2 see Fibrobalst Growth Factor-10 KGF see Fibroblast Growth Factor-7 LEC see HCC-4 LIF see Leukemia inhibitory factor Beta-lactamase TEM-1 (rHuLIF) (Recombinant, produced in E.coli ) Lyophilized. Molecular Weight: Approximately 28.9 kDa, a single non-glycosylated polypeptide chain containing 264 amino acids.Purity>95% by SDS-PAGE HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2 µm filtered concentrated solution in 100 mM Tris, pH 7.0. Leptin (rHuLeptin) (Human, recombinant, produced in E.coli) Lyophilized. Molecular Weight: Approximately 16.0 kDa, a single non-glycosylated polypeptide chain containing 146 amino acids. Purity>97% by SDS-PAGE and HPLC. Endotoxin Less than 1 EU/g of rHuLeptin as determined by LAL method. Formulation: Lyophilized from a 0.2 m filtered concentrated solution in PBS, pH 7.4. Leukemia inhibitory factor (rHuLIF) (Human, recombinant, produced in E.coli ) Lyophilized. Molecular Weight: Approximately 19.7 kDa, a single non-glycosylated polypeptide chain containing 180 amino acids. Purity>95% by SDS-PAGE HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2μm filtered concentrated solution in 20mM PB, pH 7.4, with 0.02% TWEEN 20. Leukemia inhibitory factor (rMuLIF) (Murine, Recombinant, produced in E.coli) Lyophilized. Molecular Weight: 20 kDa, a single non-glycosylated polypeptide chain containing 181 amino acids. Purity>98% by SDS-PAGE HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2μm filtered concentrated solution in 20mM PB, pH 7.4, with 0.02% TWEEN 20.
L6881
Lipase A
Store -20°C
(Triacylglycerol acylhydrolas) >500U/g Recombinant in E.coli., as immobilized.
(9001-62-1)
1 mg
2 ug 10 ug 1 mg 5 ug 25 ug 1 mg
5 ug 20 ug 1 mg
1 mg 5 mg 100 mg 200 ug 1 mg 5 mg
2 ug 10 ug 1 mg
2 ug 10 ug 1 mg 1 g 5 g
MW: approx 45,000. Purity of protein >85%. Unit Definition: one unit will produce 1.0 μmol of p-nitrophenol from p-nitrophenyl acetate (pNPA) as a substrate per minute at 25C and pH 8.0 Option pH range: 5-10. Unstable at >50C.
L6883
Lipase A
Store -20°C
(Triacylglycerol acylhydrolas) >2000U/g Recombinant in E.coli. Lyophilized.
(9001-62-1)
MW: approx 45,000. Protein purity >70% by SDS-PAGE. Unit Definition: one unit will
100 mg 500 mg
produce 1.0 μmol of p-nitrophenol from p-nitrophenyl acetate ( pNPA) as a substrate per minute at 25C and pH 8.0 Option pH range: 5-10. Unstable at >50C. L6885
Lipase A
Store -20°C
(Triacylglycerol acylhydrolas) >3000U/g Recombinant in E.coli. Lyophilized. MW:
(9001-62-1)
approx 45,000. Protein purity >70% by SDS-PAGE.Unit Definition: one unit will
100 mg 500 mg
produce 1.0 μmol of p-nitrophenol from p-nitrophenyl acetate ( pNPA) as a substrate RC332-16 Store -20°C
per minute at 25C and pH 8.0 Option pH range: 5-10. Unstable at >50C. LIX (rMuLIX/CXCL5 (93a.a.)) (Murine, Recombinant, produced in E.coli) Lyophilized. Molecular Weight: 9.8 kDa, a single, non-glycosylated polypeptide containing 93 amino acids. Purity>97% by SDS-PAGE HPLC. Endotoxin< 1EU/g. Formulation:
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
5 ug 20 ug 1 mg
229
2015-2016 Product Catalog
RC216-14 Store -20°C
RC313-12 Store -20°C
RC213-20 Store -20°C
RC355-33 Store -20°C
RC355-15 Store -20°C
RC218-26 Store -20°C
RC315-13 Store -20°C
RC315-19 Store -20°C
RC335-19 Store -20°C
RC315-18 Store -20°C
RC315-24 Store -20°C
RC315-33 Store -20°C
RC335-33 Store -20°C
Recombinant Proteins & Protein Related Products
Lyophilized from a 0.2m filtered concentrated solution in 20mM PB, pH 7.4, 150mM NaCl. Long R3 Insulin-like Growth factor-1 (rHuLR3 IGF-I) (Human, recombinant, produced in E.coli ) Lyophilized. Molecular Weight: 9.1 kDa, a single non-glycosylated polypeptide chain containing 83 amino acids. Purity>95% by HPLC. Endotoxin 97% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in 20mM PB, pH7.4, 150mM NaCl. Macrophage Colony Stimulating Factor (rHuM-CSF) (Human, Recombinant, produced in Baculovirus infected Silkworm) Lyophilized. Molecular Weight: 42.0 kDa, a covalently linked homodimer of two 21.0 kDa polypeptide monomers (1-149 amino acid of human M-CSF). Purity>95% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered solution in 20mM PB, containing 1% HSA and 3% Mannitol. Macrophage-Derived Chemokine/CCL22 (rRtMDC/CCL22) (Rat, recombinant, produced in E.coli) Lyophilized. Molecular Weight: Approximately 7.9 kDa, a single, non-glycosylated polypeptide chain containing 68 amino acids. Purity>96% by SDS-PAGE and HPLC. Endotoxin Less than 1 EU/µg of rRtMDC/CCL22 as determined by LAL method. Formulation: Lyophilized from a 0.2 µm filtered concentrated solution in 2 × PBS, pH7.4. Macrophage Inflammatory Protein-1 beta/CCL4 (rRtMIP-1β/CCL4) (Rat, recombinant, produced in E.coli) Lyophilized. Molecular Weight: Approximately 7.8 kDa, a single non-glycosylated polypeptide chain containing 69 amino acids. Purity>95% by SDS-PAGE and HPLC. Endotoxin Less than 1EU/µg of rRtMIP-1β/CCL4 as determined by LAL method. Formulation: Lyophilized from a 0.2 µm filtered concentrated solution in 2 × PBS, pH 7.4, 3 % trehalose. Mesencephalic Astrocyte-Derived Neurotrophic Factor (rHuMANF)(Human, recombinant, produced in E.coli ) Lyophilized. Molecular Weight Approximately 18.2 kDa, single non-glycosylated polypeptide chain containing 158 amino acids. Purity>96% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in 20mM PB, pH 7.4, 100mM NaCl. MCP-1 (rHuMCP-1/MCAF/CCL2) (Human, recombinant, produced in E.coli ) Lyophilized. Molecular Weight: 8.6 kDa, a single non-glycosylated polypeptide chain containing 76 amino acids. Purity>96% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in 20mM PB, pH 7.4, 100mM NaCl. MCP-2 (rHuMCP-2/CCL8) (Human, Recombinant, produced in Baculovirus infected Silkworm) Lyophilized. Molecular Weight: 8.9 kDa, a single non-glycosylated polypeptide chain containing 76 amino acids. Purity>96% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in 20mM PB, pH 7.4. MCP-2 (rMuMCP-2/CCL8) (Murine, Recombinant, produced in E.coli) Lyophilized. Molecular Weight: 8.5 kDa, a single, non-glycosylated polypeptide chain containing 74 amino acids. Purity>97% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in 20mM PB, pH 7.4, 150mM NaCl. MCP-3 (rHuMCP-3/CCL7) (Human, Recombinant, produced in Baculovirus infected Silkworm) Lyophilized. Molecular Weight: 9.0 kDa, a single, non-glycosylated polypeptide chain containing 76 amino acids. Purity>97% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in 20mM PB, pH 7.4, 150mM NaCl. MCP-4 (rHuMCP-4/CCL13) (Human, recombinant, produced in E.coli ) Lyophilized. Molecular Weight: 8.6 kDa, a single non-glycosylated polypeptide chain containing 75 amino acids. Purity>96% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in 20mM PB, pH 7.4, 130mM NaCl. M-CSF see Macrophage Colony Stimulating Factor MDC (rHuMDC/CCL22) (Human, recombinant, produced in E.coli ) Lyophilized. Molecular Weight: 8.1 kDa, a single, non-glycosylated polypeptide chain containing 69 amino acids. Purity>97% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in 20mM PB, pH7.4, 500mM NaCl. MDC (rMuMDC/CCL22) (Murine, Recombinant, produced in E.coli) Lyophilized. Molecular
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
20 ug 500 ug 1 mg
5 ug 20 ug 1 mg
2 ug 10 ug 1 mg
5 ug 20 ug 1 mg
2 ug 10 ug 1 mg
5 ug 25 ug 1 mg
5 ug 20 ug 1 mg
2 ug 10 ug 1 mg
5 ug 20 ug 1 mg
2 ug 10 ug 1 mg
5 ug 20 ug 1 mg
5 ug 20 ug 1 mg
5 ug 20 ug
230
2015-2016 Product Catalog
RC315-39 Store -20°C
RC335-39 Store -20°C
RC712-27 Store -20°C
RC712-12 Store -20°C
RC712-13 Store -20°C
RC238-29 Store -20°C
RC312-20 Store -20°C
RC712-14 Store -20°C
RC732-14 Store -20°C
RC315-14 Store -20°C
RC315-15 Store -20°C
RC332-13 Store -20°C
RC392-13 Store -20°C
Recombinant Proteins & Protein Related Products
Weight: 7.8 kDa, a single, non-glycosylated polypeptide chain containing 68 amino acids. Purity>97% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in 20mM PB, pH 7.4, 150mM NaCl. MEC (rHuMEC/CCL28) (Human, recombinant, produced in E.coli ) Lyophilized. Molecular Weight: 12.3 kDa, a single non-glycosylated polypeptide chain containing 108 amino acids. Purity>97% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in 20mM PB, pH 7.4, 130mM NaCl. MEC (rMuMEC/CCL28) (Murine, Recombinant, produced in E.coli) Lyophilized. Molecular Weight: 12.6 kDa, a single, non-glycosylated polypeptide chain containing 111 amino acids. Purity>97% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in 20mM PB, pH 7.4, 150mM NaCl. Melanoma Inhibitor Activity Protein 2 (rHuMIA-2) (Human, recombinant, produced in E.coli ) Lyophilized. Molecular Weight: 11.5 kDa, a single non-glycosylated polypeptide chain containing 101 amino acids. Purity>97% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a filtered concentrated solution in 20mM PB, pH 7.4, 150mM NaCl. MGSA see GRO-alpha MIA-2 see Melanoma Inhibitor Activity Protein 2 MIC-A (rHuMIC-A) (Human, recombinant, produced in E.coli ) Lyophilized. Molecular Weight: 36 kDa, 320 amino acid residues containing the extracellular domain of mature human MICA (amino acid residues Ala23 – Gln308). Purity>95% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in PBS, pH 7.4. MIC-B (rHuMIC-B) (Human, recombinant, produced in E.coli ) Lyophilized. Molecular Weight: Approximately 37.0 kDa, 326 amino acid residues containing the extracellular domain of mature human MIC-B (amino acid residues Ala23 – Tyr312).Purity>95% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in PBS, pH 7.4. MIF see Migration Inhibitor Factor Midkine (rMuMidkine) (Murine, recombinant, produced in E.coli) Lyophilized. Molecular Weight: Approximately 13.2 kDa, a single non-glycosylated polypeptide chain containing 120 amino acids. Purity>96% by SDS-PAGE and HPLC. Endotoxin 97% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in 20mM PB, pH 7.4, 50mM NaCl. Migration Inhibitor Factor (rHuMIF) (Human, recombinant, produced in E.coli ) Lyophilized. Molecular Weight: 13.5 kDa, a single non-glycosylated polypeptide chain containing 123 amino acids. Purity>95% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in PBS, pH 7.4. Migration Inhibitor Factor (rMuMIF) (Murine, recombinant, produced in E.coli ) Lyophilized. Molecular Weight: Approximately 12.5 kDa, a single non-glycosylated polypeptide chain containing 115 amino acids.Purity>96% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2 µm filtered concentrated solution in PBS, pH 7.4, 1 mM DTT. MIP-1 alpha (rHuMIP-1α/CCL3) (Human, recombinant, produced in E.coli ) Lyophilized. Molecular Weight: 7.8 kDa protein containing 69 amino acid residues, including the four highly conserved cysteine residues present in CC chemokines. Purity>96% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in 20mM PB, pH 7.4, 100mM NaCl. MIP-1 beta (rHuMIP-1β/CCL4) (Human, recombinant, produced in E.coli ) Lyophilized. Molecular Weight: 7.6 kDa, a single non-glycosylated polypeptide chain containing 69 amino acids.Purity>96% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in 20mM Tris, 500mM NaCl. MIP-2 (rMuMIP-2/CXCL2) (Murine, Recombinant, produced in E.coli) Lyophilized. Molecular Weight: 7.8 kDa, a single, non-glycosylated polypeptide chain containing 73 amino acids. Purity>97% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in 20mM PB, pH 7.4, 150mM NaCl. MIP-2 (rVaMIP-2). (Viral , Recombinant, produced in E.coli) Lyophilized. Molecular Weight: Approximately 7.9 kDa, a single, non-glycosylated polypeptide chain containing 70
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
1 mg
5 ug 20 ug 1 mg 5 ug 20 ug 1 mg
5 ug 20 ug 1 mg
10 ug 50 ug 1 mg
10 ug 50 ug 1 mg
5 ug 20 ug 1 mg
5 ug 20 ug 1 mg
10 ug 50 ug 1 mg 10 ug 50 ug 1 mg 5 ug 20 ug 1 mg
5 ug 20 ug 1 mg
5 ug 20 ug 1 mg
10 ug 50 ug 1 mg
231
2015-2016 Product Catalog
RC315-34 Store -20°C
RC315-31 Store -20°C
RC315-29 Store -20°C
RC315-26 Store -20°C
RC355-18 Store -20°C
RC355-39 Store -20°C
RC312-18 Store -20°C
RC218-15 Store -20°C
RC352-18 Store -20°C
RC352-13 Store -20°C
RC219-20 Store -20°C
RC239-20 Store -20°C
RC218-21 Store -20°C
Recombinant Proteins & Protein Related Products
amino acid. Purity>97% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in 20mM PB, pH 7.4, 150mM NaCl. MIP-3 (rHuMIP-3/CCL23) (Human, recombinant, produced in E.coli ) Lyophilized. Molecular Weight: 11.3 kDa, a single, non-glycosylated polypeptide chain containing 99 amino acids. Purity>97% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in 20mM PB, pH 7.4, 150mM NaCl. MIP-3 alpha (rHuMIP-3 alpha/CCL20) (Human, recombinant, produced in E.coli ) Lyophilized. Molecular Weight: 8.0 kDa, a single non-glycosylated polypeptide chain containing 70 amino acids. Purity>97% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in 20mM PB, pH 7.4, 100mM NaCl. MIP-4 (rHuMIP-4; PARC; CCL18) (Human, recombinant, produced in E.coli ) Lyophilized. Molecular Weight: 7.8 kDa, a single non-glycosylated polypeptide chain containing 69 amino acids. Purity>97% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in 20mM PB, pH 7.4, 100mM NaCl. MIP-5 (rHuMIP-5/CCL15) (Human, recombinant, produced in E.coli ) Lyophilized. Molecular Weight: 10.1 kDa, a single non-glycosylated polypeptide chain containing 92 amino acids. Purity>97% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in 20mM PB, pH 7.4, 100mM NaCl. Monocyte Chemotactic Protein-3/CCL7 (rRtMCP-3/CCL7) (Rat, recombinant, produced in E.coli) Lyophilized. Molecular Weight: Approximately 8.5 kDa, a single non-glycosylated polypeptide chain containing 74 amino acids. Purity>95% by SDS-PAGE and HPLC. Endotoxin Less than 1 EU/µg of rRtMCP-3/CCL7 as determined by LAL method. Formulation: Lyophilized from a 0.2 µm filtered concentrated solution in 2 × PBS, pH 7.4. Mucosae-associated Epithelial Chemokine/CCL28 (rRtMEC/CCL28) (Rat, recombinant, produced in E.coli) Lyophilized. Molecular Weight: Approximately 13.1 kDa, a single non-glycosylated polypeptide chain containing 116 amino acids. Purity>96% by SDS-PAGE and HPLC. Endotoxin Less than 1 EU/µg of rRtMEC/CCL28 as determined by LAL method. Formulation: Lyophilized from a 0.2 µm filtered concentrated solution in 20 mM PB, pH 7.4, 200 mM NaCl. NAP-2 (rHuNAP-2/CXCL7) (Human, recombinant, produced in E.coli ) Lyophilized. Molecular Weight: 7.6 kDa, a single non-glycosylated polypeptide chain containing 70 amino acids. Purity>97% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in 20mM PB, pH 7.4, 50mM NaCl. NCC-4 see HCC-4 Neurotrophin-4 (rHuNT-4) (Human, recombinant, produced in E.coli ) Lyophilized. Molecular Weight: 28 kDa, a noncovalently linked homodimer of two 14.0 kDa polypeptide monomers (260 total amino acid residues). Purity>97% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a filtered concentrated solution in 20mM PB, pH 7.4, 150mM NaCl. Neutrophil Activating Peptide 2/CXCL7 (rRtNAP-2/CXCL7)(Rat, recombinant, produced in E.coli) Lyophilized. Molecular Weight: Approximately 6.8 kDa, a single non-glycosylated polypeptide chain containing 62 amino acids. Purity>97% by SDS-PAGE and HPLC. Endotoxin Less than 1 EU/µg of rRtNAP-2/CXCL7 as determined by LAL method. Formulation: Lyophilized from a 0.2 µm filtered concentrated solution in PBS, pH 7.4. Neutrophil Chemoattractant 3/CXCL2 (rRtCINC-3/CXCL2), Cytokine-induced (Rat, recombinant, produced in E.coli) Lyophilized.Molecular Weight: Approximately 7.9 kDa, a single, non-glycosylated polypeptide chain containing 73 amino acids. Purity>98% by SDS-PAGE and HPLC. Endotoxin Less than 1 EU/g of rRtCINC-3/CXCL2 as determined by LAL method. Formulation: Lyophilized from a 0.2 m filtered concentrated solution in PBS, pH 7.4. NOGGIN (rHuNOGGIN) (Human, recombinant, produced in E.coli ) Lyophilized. Molecular Weight: 46.2 kDa non-disulfide-linked homodimer consisting of two 206 amino acid polypeptide chains. Purity>95% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2μm filtered concentrated solution in 30% acetonitrile, 0.1% TFA. NOGGIN (rMuNOGGIN) (Murine, Recombinant, produced in E.coli) Lyophilized. Molecular Weight: 46.4 kDa disulfide-linked homodimer consisting of two 206 amino acid polypeptide chains. Purity>95% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2μm filtered concentrated solution in 30% acetonitrile, 0.1% TFA. NRG-1 EGF-like (Human, Recombinant, produced in E.coli) Lyophilized. Molecular Weight: 7,005 Da, a single non-glycosylated polypeptide chain containing 61 amino acids. Purity>>96%
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
5 ug 20 ug 1 mg
5 ug 20 ug 1 mg
2 ug 10 ug 1 mg
5 ug 25 ug 1 mg
2 ug 10 ug 1 mg
5 ug 20 ug 1 mg
2 ug 10 ug 1 mg
2 ug 10 ug 1 mg
2 ug 10 ug 1 mg
5 ug 25 ug 1 mg
5 ug 20 ug 1 mg 5 ug 20 ug 1 mg 10 ug 50 ug 1 mg
232
2015-2016 Product Catalog
RC214-19 Store -20°C
RC214-19T Store -20°C
RC254-19 Store -20°C
RC219-19 Store -20°C
RC712-24 Store -20°C
RC412-14 Store -20°C
RC412-15 Store -20°C
RC412-16 Store -20°C
RC213-19 Store -20°C
RC216-21 Store -20°C
RC572-14 Store -20°C
Recombinant Proteins & Protein Related Products
by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered solution (0.25mg/ml) in 20mM PB, pH 7.0, containing 0.5%HAS and 2% mannitol. NT-4 see Neurotrophin-4 Oncostatin-M (227a.a.) (rHuOncostatin-M) (Human, recombinant, produced in E.coli ) Lyophilized. Molecular Weight: 26.0 kDa, a single non-glycosylated polypeptide chain containing 227 amino acids. Purity>95% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in PBS, pH 7.4. Oncostatin-M (209a.a.) (rHuOncostatin-M) (Human, recombinant, produced in E.coli ) Lyophilized. Molecular Weight: 23.9 kDa, a single non-glycosylated polypeptide chain containing 209 amino acids. Purity>95% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2μm filtered concentrated solution in PBS, pH 7.4. Oncostatin-M (rRtOSM) (Rat, recombinant, produced in E.coli) Lyophilized. Molecular Weight: Approximately 24.3 kDa, a single non-glycosylated polypeptide chain containing 214 amino acids. Purity>96% by SDS-PAGE and HPLC. Endotoxin >90% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in PBS, pH 7.4. Otoraplin (rHuOTOR) (Human, recombinant, produced in E.coli ) Lyophilized. Molecular Weight: 12.7 kDa, a single non-glycosylated polypeptide chain containing 112 amino acids. Purity>95% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in 20mM PB, pH 7.4, 150mM NaCl. Parathyroid Hormone 1-34 (rHuPTH1-34) (Human, recombinant, produced in E.coli ) Lyophilized. Molecular Weight: 4117.8 Da, a single non-glycosylated polypeptide containing 34 amino acids. Purity>97% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in 20mM PB, pH 7.0, containing 4% mannitol. Parathyroid Hormone 7-34 (rHuPTH7-34) (Human, recombinant, produced in E.coli ) Lyophilized. Molecular Weight: 3380 Da, a single non-glycosylated polypeptide chain containing 28 amino acids. Purity>97% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in 20mM PB, pH 7.0, containing 4% mannitol. Parathyroid Hormone1-84 (rHuPTH1-84) (Human, Recombinant, produced in E.coli). Lyophilized. Molecular Weight: Approximately 10 KDa, a single non-glycosylated polypeptide containing 84 amino acids. Purity>97% by HPLC. Endotoxin95% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in 20mM PB, pH7.4, 150mM NaCl. P16-INK4a see Cyclin-dependent Kinase Inhibitor 2A Platelet-derived Growth Factor-BB (rHuPDGF-BB) (Human, recombinant, produced in E.coli ) Lyophilized. Molecular Weight: Approximately 24.8 kDa, a disulfide-linked homodimeric protein containing two 110 amino acid residues polypeptide (B chain).Purity>97% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in 20mM PB, pH7.4, 150mM NaCl. PreScission Protease (rPSP) Solution (Recombinant, produced in E.coli) . 50% glycerol solution. Supplied with 10X reaction buffer. Molecular Weight: 44.5 KDa, a single non-glycosylated polypeptide chain containing 400 amino acids. One unit will cleave ≥90% of 100 µg of a test GST-fusion protein in Cleavage Buffer (50mM Tris-HCl, 150 mM NaCl, 1 mM EDTA, 1 mM DTT, pH 7.0 at 25°C) at 5°C for 16 hours. Reaction buffer: 50mM Tris-HCl, pH7.0 (at 25°C), 150 mM NaCl, 1 mM EDTA, 1 mM dithiothreitol. Chill to 5°C
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
2 ug 10 ug 1 mg
2 ug 10 ug 1 mg 2 ug 10 ug 1 mg
10 ug 50 ug 1 mg
5 ug 20 ug 1 mg 20 ug 100 ug 1 mg 20 ug 100 ug 1 mg
20 ug 100 ug 1 mg
5 ug 20 ug 1 mg
2 ug 10 ug 1 mg
100 IU 250 IU 5000 IU
233
2015-2016 Product Catalog
Recombinant Proteins & Protein Related Products
prior to use. Storage buffer: 50mM Tris pH8.0, 150mM NaCl, 1mM EDTA, 50% Glycerol Protein Standard Solution see Biochemicals Chapter PB0789
Protein A
Store -20°C
(Recombinant, Produced in E.coli) Lyophilized powder salt-free. MW: 45,000. Purity >95% (HPLC). Binding capacity: 6-8 mg of human IgG per mg
10 mg 50 mg 250 mg 1 g
solid, binds to most mammalian immunoglobulins in their Fc binding domains. Single BSP096-5 BSP096-25 BSP096-100 Store 4°C
spot on SDS gel. Endotoxin level is < 0.05 EU/mg of Protein. Protein A Agarose Resin Slurry in 20% ethanol. Suitable for affinity purification of IgG from serum and other fluids of many species, is especially suited for polyclonal antibody purification. Capacity: approx 20mg human IgG/ml. Particle size: 45-165 um; Matrix: Highly cross-linked agarose, 4%; pH stability 3-9 (long term), 2-10 (short term). Max linear flow rate: 300cm/h, Ligand & ligand density: Protein A at 3-5mg/ml. Re-usable.
RC2114-12
Protein A/G
Store -20°C
(Recombinant, Produced in E.coli) Lyophilized powder, salt-free. MW: 50.5 kDa.. Purity >95% (HPLC). B Approximately 50.5 kDa. The recombinant
2.5ml 12.5ml 100 ml
5 mg 20 mg 1 g
Protein A/G consists of 7 IgG-binding domains EDABC-C2C3, which corresponds to the Protein A and G domains that are included in the recombinant sequence. The Protein A portion is from Staphylococcus aureus segments E, D, A, B and C. The Protein G portion is from Streptococcus segments C2 and C3. The binding capacity of recombinant Protein A/G is broader than either Protein A or Protein G alone. Endotoxin< 1EU/g. PB0451
Proteinase K
Store -20°C
Lyophilized from Tritirachium album Biotech Grade
(39450-01-6)
Protein purity >90%, Activity>30U/ mg. One unit will hydrolyze urea-denatured
50 mg 250 mg 1g
hemoglobin to produce color equivalent to 1.0 μmole of tyrosine per min at pH 7.5 at RC512-13 Store -20°C
37 °C, Soluble in water (10mg/ml), DNase, RNase & Nickase: none detected. Protein Disulfide Isomerase (rHuPDI) (Human , Recombinant, produced in E.coli) Lyophilized. Molecular Weight: 62.4 kDa, a single non-glycosylated polypeptide chain containing 503 amino acids. Purity>>95% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated (1mg/ml) solution in PBS, pH 7.0.
P6872
Protein G
Store -20°C
(Recombinant). Lyophilized powder salt-free.
RC2113-13 Store -20°C
SF022-PG Store 4°C
RC315-16 Store -20°C
RC712-20 Store -20°C
RC326-12 Store -20°C
Purity>96%. Single spot on SDS gel. Binding capacity: ~10 mg/mg. Cys-Protein G Lyophilized powder, salt-free. Purity >95% by HPLC. Cys-Protein G binds with greater affinity to most mammalian immunoglobulins including human IgG3, mouse IgG1 and rat IgG2a than Protein A. It does not bind to human IgM, IgD and IgA. Endotoxin< 1EU/g. Protein G Agarose Resin Supplied as a 20% slurry. Ideal for medium and low pressure chromatography of IgG from mouse, sheep, and rabbit, and for immunoprecipitations Capacity: approx 2mg human IgG/ml Particle size: 40-130 um; Matrix : Highly cross-linked agarose, 4%; pH stability 3-9 (long term), 2-10 (short term) Max linear flow rate: 300cm/h, Ligand: recombinant Protein G covalently coupled by cyanogen bromide to highly cross-linked 4% agarose beads PSP see PreScission Protease PTH (1-34) see Parathyroid Hormone 1-34 PTH (7-34) see Parathyroid Hormone 7-34 PTH (1-84) see Parathyroid Hormone 1-84 RANTES (rHuRANTES; CCL5)) (Human, recombinant, produced in E.coli ) Lyophilized. Molecular Weight: 7.8 kDa, a single non-glycosylated polypeptide chain containing 68 amino acids. Purity>>98% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in 20mM PB, pH 7.4, 100mM NaCl. Rb(137a.a.) see Retinoblastoma-Associated Protein Fragment(137a.a.) Retinoblastoma-Associated Protein Fragment(137a.a.) (rHuRb(137a.a.) (Human, recombinant, produced in E.coli ) Lyophilized. Molecular Weight: 16.5 kDa, a single non-glycosylated polypeptide chain containing 146 amino acids. Purity>95% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2μm filtered concentrated solution in PBS, pH 7.4. SAA1 (rRhSAA1) (Rhesus macaque, Recombinant, produced in E.coli) Lyophilized. Molecular Weight: 11.8 kDa, a single non-glycosylated polypeptide chain containing 104 amino acids. Purity>97% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
100 ug 500 ug 1 mg 5 mg 20 mg 100 mg 1 g 5 mg 20 mg 100 mg 1 g 1 ml 5 ml
5 ug 20 ug 1 mg
10 ug 50 ug 1 mg 2 ug 10 ug 1 mg
234
2015-2016 Product Catalog
RC312-23A Store -20°C
RC332-23A Store -20°C
RC352-23A Store -20°C
RC312-23B Store -20°C
RC332-23B Store -20°C
RC352-23B Store -20°C
RC232-36 Store -20°C
RC712-30 Store -20°C
RC732-30 Store -20°C
RC712-46 Store -20°C
RC712-18 Store -20°C
RC562-13 Store -20°C
Recombinant Proteins & Protein Related Products
from a 0.2m filtered concentrated solution in PBS, pH 7.4. SaK see Staphylokinase SCF see Stem Cell Factor SOY, also known as SOX see Sex Determining Region Y SDF-1 alpha (rHuSDF-1 alpha/CXCL12α) (Human ,recombinant, produced in E.coli) Lyophilized. Molecular Weight: 8.0 kDa, a single non-glycosylated polypeptide containing 68 amino acids. Purity>97% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2μm filtered concentrated solution in 20mM PB, pH 130mM NaCl. SDF-1 alpha (rMuSDF-1 alpha/CXCL12) (Murine ,recombinant, produced in E.coli) Lyophilized. Molecular Weight: Approximately 7.9 kDa, a single non-glycosylated polypeptide chain containing 68 amino acids. Purity>97% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2μm filtered concentrated solution in 20mM PB, pH 130mM NaCl. SDF-1 alpha (rRtSDF-1 alpha/CXCL12α) (Rat ,recombinant, produced in E.coli) Lyophilized. Molecular Weight: 7.9 kDa, a single non-glycosylated polypeptide chain containing 68 amino acids. Purity>97% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in 20mM PB, pH 7.4, 150mM NaCl. SDF-1 beta (rHuSDF-1 beta/CXCL12). (Human ,recombinant, produced in E.coli) Lyophilized. Molecular Weight: Approximately 8.5 kDa, a single non-glycosylated polypeptide chain containing 72 amino acids. Purity>97% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2μm filtered concentrated solution in 20mM PB, pH 130mM NaCl. SDF-1 beta (rMuSDF-1 beta/CXCL12β) (Murine ,recombinant, produced in E.coli) Lyophilized. Molecular Weight: 8.5 kDa, a single non-glycosylated polypeptide chain containing 72 amino acids. Purity>97% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in 20mM PB, pH 7.4, 150mM NaCl. SDF-1β (rRtSDF-1β/CXCL12β) (Rat ,recombinant, produced in E.coli) Lyophilized. Molecular Weight: 8.4 kDa, a single non-glycosylated polypeptide chain containing 72 amino acids. Purity>97% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in 20mM PB, pH 7.4, 150mM NaCl. SF20 (rMuSF20/IL-25) (Murine ,recombinant, produced in E.coli) Lyophilized. Molecular Weight: 15.8 kDa, a single non-glycosylated polypeptide chain containing 143 amino acids. Purity>95% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in PBS, pH 7.4. SK see Streptokinase SOD see Superoxide Dismutase Sonic Hedgehog Protein N-Terminus (rHuSHH) (Human, recombinant, produced in E.coli) Lyophilized. Molecular Weight: Approximately 19.8 kDa, a single non-glycosylated polypeptide chain containing 176 amino acids. Purity>98% by SDS-PAGE and HPLC. Endotoxin Less than 1 EU/µg of rHuSHH as determined by LAL method.7. Formulation: Lyophilized from a 0.2 µm filtered concentrated solution in 20 mM PB, pH 7.4, 150 mM NaCl. Sonic Hedgehog N-Terminus (rMuSHH)(Murine, recombinant, produced in E.coli) Lyophilized. Molecular Weight: Approximately 19.8 kDa, a single non-glycosylated polypeptide chain containing 176 amino acids. Purity>95% by SDS-PAGE and HPLC. Endotoxin Less than 1 EU/g of rMuSHH as determined by LAL method. Formulation: Lyophilized from a 0.2 m filtered concentrated solution in PBS, pH 7.4. SOX2-TAT (rHuSOX2-TAT)(Human, recombinant, produced in E.coli) Lyophilized. Molecular Weight: Approximately 36.0 kDa, a single non-glycosylated polypeptide chain containing 330 amino acids, including the 317 residues of full-length Sox2 and a 13-residue C-terminal TAT peptide (GGYGRKKRRQRRR). Purity>95% by SDS-PAGE and HPLC. Endotoxin Less than 1 EU/g of rHuSOX2-TAT as determined by LAL method. Formulation: Lyophilized from a 0.2 m filtered concentrated solution in 2 × PBS, pH 7.4, with 5% Trehalose. SPARC (rHuSPARC) (Human ,recombinant, produced in E.coli) Lyophilized. Molecular Weight: 34.0 kDa, a single non-glycosylated polypeptide chain containing 295 amino acids. Purity>95% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in 1×PBS, pH 7.4. Staphylokinase (rSaK) (Recombinant, produced in E.coli) Lyophilized. Molecular Weight: 16 kDa, a single non-glycosylated polypeptide chain containing 136 amino acids. Purity>95% by
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
2 ug 10 ug 1 mg 2 ug 10 ug 1 mg
2 ug 10 ug 1 mg
2 ug 10 ug 1 mg
2 ug 10 ug 1 mg
2 ug 10 ug 1 mg
2 ug 10 ug 1 mg
5 ug 25 ug 1 mg
5 ug 25 ug 1 mg
5 ug 25 ug 1 mg
10 ug 50 ug 1 mg
20 ug 100 ug 1 mg
235
2015-2016 Product Catalog
RC213-12 Store -20°C
RC253-12 Store -20°C
RC562-12 Store -20°C
RC512-12 Store -20°C
RC712-19 Store -20°C
RC315-28 Store -20°C
RC315-36 Store -20°C
RC213-17 Store -20°C
RC213-18 Store -20°C
RC572-13 Store -20°C
RC712-25 Store -20°C
RC712-26
Recombinant Proteins & Protein Related Products
HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrate solution in PBS, pH 7.4. Stem Cell Factor (rHuSCF) (Human ,Recombinant, produced in E.coli) Lyophilized. Molecular Weight: 18.4 kDa, a single non-glycosylated polypeptide chain containing 165 amino acids. Purity>97% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in PBS, pH 7.4. Stem Cell Factor (rRtSCF) (Rat, recombinant, produced in E.coli) Lyophilized. Molecular Weight: Approximately 18.5 kDa, a single non-glycosylated polypeptide chain containing 165 amino acids. Purity>95% by SDS-PAGE and HPLC. Endotoxin 95% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in PBS, pH 7.4. Superoxide Dismutase (rHuSOD) (Human , Recombinant, produced in E.coli) Lyophilized. Molecular Weight: 31 kDa. a homodimer, non-glycosylated polypeptide chain containing 2 x 154 amino acids. Purity>95% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in PBS, pH 7.4. Syndecan-4 (rHuSYND-4) (Human , Recombinant, produced in E.coli) Lyophilized. Molecular Weight: Approximately 15.4 kDa, a single non-glycosylated polypeptide chain containing 140 amino acids. Purity>95% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in PBS, pH 7.4. TARC (rHuTARC/CCL17) (Human ,recombinant, produced in E.coli) Lyophilized. Molecular Weight: 8.0kDa, a single non-glycosylated polypeptide chain containing 71 amino acids. Purity>97% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in 20mM PB, pH 7.4, 150mM NaCl. TECK (rHuTECK/CCL25) (Human ,recombinant, produced in E.coli) Lyophilized. Molecular Weight: 14.2 kDa, a single, non-glycosylated polypeptide chain containing 127 amino acids. Purity>97% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2µm filtered concentrated solution in 20mM PB, pH 7.4, 150mM NaCl. TEV see Tobacco Etch Virus Protease TFF1 see Trefoil Factor 1 TFF2 see Trefoil Factor 2 Thrombopoietin (rHuTPO) (Human ,recombinant, produced in CHO) Lyophilized. Molecular Weight: 80 kDa, consisting of a 332 amino acid residue with a predicted molecular mass of approximately 35 kDa. As a result of glycosylation, the recombinant protein migrates with an apparent molecular mass of 80±10 kDa in SDS-PAGE. Purity>98% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from filtered concentrated (1mg/ml) solution in PBS, pH 7.4. Thymic Stromal Lymphopoietin (rHuTSLP) (Human ,recombinant, produced in E.coli) Lyophilized. Molecular Weight: 15.0 KDa, a single non-glycosylated polypeptide chain containing 132 amino acids. Purity>98% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in 20mM PB, pH 7.4, 150mM NaCl. TNF-α see Tumor Necrosis Factor-alpha TNF-α V see Tumor Necrosis Factor-alpha Variant TNF-a-His see Tumor Necrosis Factor-alpha-His Tobacco Etch Virus Protease (rTEV) Supplied with 10TEV buffer. (Recombinant, produced in E.coli) Lyophilized. TEV Protease, Recombinant (rTEV) is a site-specific protease purified from E. coli by the affinity tag, GST tag. The protease can be used for the removal of affinity tags from fusion proteins. The seven-amino-acid recognition site for rTEV is Glu-Asn-Leu-Tyr-Phe-Gln-Gly with cleavage occurring between Gln and Gly. One unit of rTEV cleaves ≥85% of 3 μg control substrate in 1 h at 30°C. TPO see Thrombopoietin TRAP see CD40 Ligand Trefoil Factor 1 (rHuTFF1) (Human ,recombinant, produced in E.coli) Lyophilized. Molecular Weight: 13.2 kDa homodimeric protein consisting of two 60 amino acid polypeptide chains, which includes a 40-amino acid trefoil motif containing three conserved intramolecular disulfide bonds. Purity>97% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in 20mM PB, pH 7.4, 150mM NaCl. Trefoil Factor 2
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
2 ug 10 ug 1 mg 2 ug 10 ug 1 mg
100 ug 500 ug 1 mg 20 ug 100 ug 1 mg
10 ug 50 ug 1 mg
5 ug 20 ug 1 mg
5 ug 20 ug 1 mg
2 ug 10 ug 1 mg
2 ug 10 ug 1 mg
300 U 1000 U 10,000 IU
5 ug 20 ug 1 mg
5 ug
236
2015-2016
Recombinant Proteins & Protein Related Products
Product Catalog Store -20°C
(rHuTFF2) (Human ,recombinant, produced in E.coli) Lyophilized. Molecular Weight: 12.0 kDa, a single non-glycosylated polypeptide chain containing 106 amino acids. Purity>97% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2µm filtered concentrated solution in 20mM PB, pH 7.4, 130mM NaCl.
T6878
Trypsin
Store -20°C
(Recombinant in E.coli)
(9002-07-7)
purified by chromatography to remove contaminating. Protein >95% (SDS-PAGE)
>10000u U/mg
White or white like powder.
Trypsin: 10000u U/mg. Other proteases: non-detected.
Highly
20 ug 1 mg 50 mg 250 mg
Optimum pH: 7.5-8.5.
Soluble in water. Suitable for cell culture. T6882
Trypsin
Store -20°C
(Recombinant. In E.coli) >15000u U/mg
(9002-07-7)
by chromatography to remove contaminating. Protein >95% (SDS-PAGE) Trypsin:
White or white like powder.
15000u U/mg. Other proteases: non-detected.
RC214-12 Store -20°C
RC214-12V Store -20°C
RC214-12H Store -20°C
RC234-12 Store -20°C
RC254-12 Store -20°C
RC224-12 Store -20°C
RC214-26R Store -20°C
RC612-13 Store -20°C
Highly purified
50 mg 250 mg
Optimum pH: 7.5-8.5. Soluble in
water. Suitable for cell culture. TSLP see Thymic Stromal Lymphopoietin Tumor Necrosis Factor-alpha (rHuTNF-α) (Human ,recombinant, produced in E.coli) Lyophilized. Molecular Weight: 17.5 kDa. The recombinant protein preparation is a mixture of a 158 amino acid residue form containing an N-terminal methionine and a 157 amino acid residue form with the sequence of mature human TNF-α Purity>95% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in PBS, pH 7.0. Tumor Necrosis Factor- alpha Variant (rHuTNF-α V) (Human ,recombinant, produced in E.coli) Lyophilized. Molecular Weight: 16 kDa, a single non-glycosylated polypeptide chain containing 151 amino acids. Purity>95% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in PBS, pH 7.0. Tumor Necrosis Factor-alpha- His (rHuTNF-α-his) . (Human ,recombinant, produced in E.coli) Lyophilized. Molecular Weight: Approximately 17.5 kDa. The recombinant protein preparation is a mixture of a 158 amino acid residue form containing an N-terminal methionine and a 157 amino acid residue form with the sequence of mature human TNF-αwith a C-terminal 6×His tag. Purity>97% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in PBS, pH 7.0. Tumor Necrosis Factor-alpha (rMuTNF-α) (Murine ,recombinant, produced in E.coli) Lyophilized. Molecular Weight: 17.3 kDa. The recombinant murine TNF-alpha is a soluble 157 amino acid protein which corresponds to C-terminal extracellular domain of the full length transmembrane protein. Purity>97% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered solution in PBS, pH 7.2. Tumor Necrosis Factor-alpha ( Rat ,recombinant, produced in E.coli) Lyophilized. Molecular Weight: Approximately 17.3 kDa. The recombinant murine TNF-alpha is a soluble 157 amino acid protein which corresponds to C-terminal extracellular domain of the full length transmembrane protein. Purity>97% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered solution in PBS, pH 7.2. Tumor Necrosis Factor-alpha (rRhTNF-α) (Rhesus macaque ,recombinant, produced in E.coli) Lyophilized. Molecular Weight: Approximately 17.3 kDa. The recombinant murine TNF-alpha is a soluble 157 amino acid protein which corresponds to C-terminal extracellular domain of the full length transmembrane protein. Purity>97% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in PBS, pH 7.2. Tumor Necrosis Factor-alpha -Related Apoptosis-inducing Ligand Receptor-2 (rHusTRAIL-R2) (Human ,recombinant, produced in E.coli) Lyophilized. Molecular Weight: Approximately 14.8 kDa, a single non-glycosylated polypeptide chain containing 132 amino acids.Purity>97% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in PBS, pH 7.4. UBC2 see Ubiquitin Conjugating Enzyme E2B (His6-tagged) UBC5 see Ubiquitin Conjugating Enzyme E2D3 (His6-tagged) UBC7 see Ubiquitin Conjugating Enzyme 7 (His6-tagged) UBC9 see Ubiquitin Conjugating Enzyme 9 (His6-tagged) UBC10 see Ubiquitin Conjugating Enzyme 10 (His6-tagged) UBC12 see Ubiquitin Conjugating Enzyme 12 (His6-tagged) UBCh1 see Ubiquitin Conjugating Enzyme E2K (His6-tagged) UBE2K/HIP-2) UBE2K see Ubiquitin Conjugating Enzyme E2K (His6-tagged) Ubiquitin Conjugating Enzyme E2B (His6-tagged) (rHuUBC2) (Human ,recombinant, produced in E.coli) Lyophilized. Molecular Weight: Approximately 19 kDa, a single non-glycosylated polypeptide chain containing 166
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
10 ug 50 ug 1 mg
10 ug 50 ug 1 mg
10 ug 50 ug 1 mg
5 ug 20 ug 1 mg
5 ug 20 ug 1 mg
5 ug 20 ug 1 mg
10 ug 50 ug 1 mg
10 ug 50 ug 1 mg
237
2015-2016 Product Catalog
RC612-16 Store -20°C
RC612-18 Store -20°C
RC612-20 Store -20°C
RC612-21 Store -20°C
RC612-23 Store -20°C
RC612-12 Store -20°C
RC236-17 Store -20°C
RC236-18 Store -20°C
RC216-16 Store -20°C
RC256-18 Store -20°C
RC352-28 Store -20°C
Recombinant Proteins & Protein Related Products
amino acids. Purity>95% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated (solution in 1×PBS, 1mM DTT, pH 7.5. Ubiquitin Conjugating Enzyme E2D3 (His6-tagged) (rHuUBC5) (Human ,recombinant, produced in E.coli) Lyophilized. Molecular Weight: Approximately 18 kDa, a single non-glycosylated polypeptide chain containing 155 amino acids. Purity>95% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in 1×PBS, 1mM DTT, pH 7.5. Ubiquitin Conjugating Enzyme 7 (His6-tagged) (rHuUBC7) (Human ,recombinant, produced in E.coli) Lyophilized. Molecular Weight: 18.9 kDa, a single non-glycosylated polypeptide chain containing 162 amino acids. Purity>95% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2μm filtered concentrated solution in 1×PBS, 1mM DTT, pH 7.5. Ubiquitin Conjugating Enzyme 9(His6-tagged) (rHuUBC9) (Human ,recombinant, produced in E.coli) Lyophilized. Molecular Weight: 19.5 kDa, a single non-glycosylated polypeptide chain containing 171 amino acids.. Purity>95% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2μm filtered concentrated solution in 1×PBS, 1mM DTT, pH 7.5. Ubiquitin Conjugating Enzyme 10(His6-tagged) (rHuUBC10) (Human ,recombinant, produced in E.coli) Lyophilized. Molecular Weight: 21.1 kDa, a single non-glycosylated polypeptide chain containing 191 amino acids. Purity>95% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2μm filtered concentrated solution in 1×PBS, 1mM DTT, pH 7.5. Ubiquitin Conjugating Enzyme 12(His6-tagged) (rHuUBC12) (Human ,recombinant, produced in E.coli) Lyophilized. Molecular Weight: 25 kDa, a single non-glycosylated polypeptide containing 216 amino acids. Purity>95% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from filtered concentrated solution in 1×PBS, 1mM DTT, pH 7.5. Ubiquitin Conjugating Enzyme E2K (His6-tagged) (rHuUBCh1/UBE2K/HIP-2) (Human ,recombinant, produced in E.coli) Lyophilized. Molecular Weight: Approximately 23.4 KDa, a single non-glycosylated polypeptide chain containing 208 amino acids. Purity>95% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in PBS, 1mM DTT, pH 7.4. Vascular Endothelial Growth Factor 120 (rMuVEGF120) (Murine ,recombinant, produced in E.coli) Lyophilized. Molecular Weight: 28.4 kDa disulfide-linked homodimeric protein consisting of two 121 amino acid polypeptide chains. Purity>96% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered solution in PBS, pH 7.4. Vascular Endothelial Growth Factor 165 (rMuVEGF165) (Murine ,recombinant, produced in E.coli) Lyophilized. Molecular Weight: 39.0 kDa disulfide-linked homodimeric protein consisting of two 165 amino acid polypeptide chains. Purity>95% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered solution in PBS, pH 7.4. Vascular Endothelial Growth Factor 165 (rHuVEGF165) (Human ,recombinant, produced in E.coli) Lyophilized. Molecular Weight: 38.2 kDa disulfide-linked homodimeric protein consisting of two 165 amino acid polypeptide chains. Purity>95% by HPLC. Endotoxin< 1EU/g. Formulation: Lyophilized from a 0.2m filtered concentrated solution in PBS, pH 7.4. Vascular Endothelial Growth Factor 165 (rRtVEGF165) (Rat, recombinant, produced in E.coli) Lyophilized. Molecular Weight: Approximately 38.7 kDa, a disulfide-linked homodimeric protein, consisting of two 165 amino acid polypeptide chains. Purity>95% by SDS-PAGE and HPLC. Endotoxin 97% by SDS-PAGE and HPLC. Endotoxin Less than 1EU/µg of rRtVCC-1/CXCL17 as determined by LAL method. Formulation: Lyophilized from a 0.2 µm filtered concentrated solution in 2 × PBS, pH 7.4. VEGF120 see Vascular Endothelial Growth Factor 120 VEGF165 see Vascular Endothelial Growth Factor 165 XCL1 see Lymphotactin
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
10 ug 50 ug 1 mg
10 ug 50 ug 1 mg 10 ug 50 ug 1 mg 10 ug 50 ug 1 mg
10 ug 50 ug 1 mg 20 ug 100 ug 1 mg
2 ug 10 ug 1 mg
2 ug 10 ug 1 mg
2 ug 10 ug 1 mg
2 ug 10 ug 1 mg
2 ug 10 ug 1 mg
238
2015-2016
Recombinant Proteins & Protein Related Products
Product Catalog
5.2 Protein Related Products Protein Quantitation Assays SK3031
1000 Assays
Bradford Protein Assay Kit
The Bradford assay, a colorimetric protein assay, is based on an absorbance shift of the dye Coomassie Brilliant Blue G-250 in which under acidic conditions the red form of the dye is converted into its bluer form to bind to the protein being assayed. The (bound) form of the dye has an absorption spectrum maximum historically held to be at 595 nm. The cationic (unbound) forms are green or red. The binding of the dye to the protein stabilizes the blue anionic form. The increase of absorbance at 595 nm is proportional to the amount of bound dye, and thus to the amount (concentration) of protein present in the sample. Unlike other protein assays, the Bradford protein assay is less susceptible to interference by various chemicals that may be present in protein samples. An exception of note is elevated concentrations of detergent including SDS. The Bradford Assays linear range is from 10µg/ml to 150 µg/ml. Because the Bradford Assays is based on amount of arginine and hydrophobic amino acid residues, the amino acid composition can alter the concentration-absorbance curve depending on the percentage of arginine or hydrophobic amino acids in each protein. It is therefore necessary to use a standard BSA solution, as BSA closely matches the measured protein in composition, but systematic error(different amino acid composition for all proteins) should be taken into account when performing the assay. Features: (1) Accurate. (2) BSA as Standard Protein Solution is provided. (3) Competitive pricing. Transportation: at ambient temperature. Store: The kit is stable for 1 year at room temperature; BSA Solution should be kept at -20°C. SK3041
1000 Assays
Better Bradford Protein Assay Kit Features: (1) The kit contains improved formulation and additives that reduce the formation of dye-dye and dye-protein aggregates hence minimzing tendency of non-linear responses (2) More sensitive and stable than the regular Bradford Protein assay kit. . Transportation: at ambient temperature. Store: The kit is stable for 1 year at room temperature; BSA Solution should be kept at -20°C.
SK3021
BCA Protein Assay Kit ( Smith Assays)
500 Assays
BCA protein assay is the most popular method for colorimetric detection and quantitation of total protein used in many labs.
The total protein concentration is exhibited by a color
change of the sample solution from green to purple in proportion to protein concentration, which can then be measured using colorimetric techniques.Linear range: 25-500ug/ml. Transportation: at ambient temperature. Store: The kit is stable for 1 year at room temperature; BSA Solution should be kept at -20°C. SK3051
Better BCA Protein Assay Kit
500 Assays
The principle of modified BCA Assays is the same as that of BCA Assays. However, this kit reduces the effect of interefering reagents such as TBP, DTT, TECP on protein quantitation.
Features: (1) Simple and sensitive。(2) Concentration for protein assay
ranges from 25-1000µg/ml (3) Compatible with many ionic and nonionic detergents (4)
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
239
2015-2016
Recombinant Proteins & Protein Related Products
Product Catalog
Assay works if concentrations of DTT and 2-Mercaptoethanol are less than 5-10 mM. Transportation: at ambient temperature. Store: The kit is stable for 1 year at room temperature; BSA Solution should be kept at -20°C. SK3061
1250 Assays
Micro BCA Protein Assay Kit 2+
1+
The kit is based on the alkaline reduction of Cu to Cu by proteins, and the formation of a 1+
bicinchoninic acid:Cu complex which forms a purple-colored product that strongly absorbs light at a wavelength of 562 nm.The kit uses a concentrated form of the BCA Reagents that can accurately measure dilute protein solutions. Features:(1) Highly sensitivie, can accurately measure protein down to 0.5µg/mL (2µg/mL in microplate format). (2) Reduced susceptibility to detergents .(3) Linear working range for BSA is from 0.5µg/mL
to 20µg/mL
Transportation: at ambient temperature. Store: The kit is stable
for 1 year at room temperature; BSA Solution should be kept at -20°C. BCA Bicinchonnic sodium salt see Chapter Biochemicals SK3071
250 Assays
Non-Interfering Protein Concentration Determination Kit The kit provides a highly sensitive, colorimetric protein detection tool that has minimum interference from common laboratory agents present in protein solutions.
It is suitable for
protein concentration determination during protein purification, electrophoresis, cell biology, and as well as proteins from in cellular fractions, tissue, 2D lysates and chromatography fractions. Features: (1) Simple and rapid. The procudure takes 30 minutes. (2) Sensitive: only 1-50µl of protein samples is required. (3) The assay is not affected by the presence of many common laboratory agents, such as reducing agents, chelating agents, detergents, amines, sugars, chaotropes, salts, drugs, antibiotics, cobalt and other common laboratory agents (4) Linear range: 0.5µg-50µg protein. Transportation: at ambient temperature. Store: The kit is stable for 1 year at 4°C. SK4031
Lowry Protein Assay Kit
1000 Assays
The principle of Lowry Protein Assays is similar to that of BCA Assays. Both assays rely on the formation of a Cu2+-protein complex under alkaline conditions, followed by reduction of the Cu2+ to Cu1+. The product becomes reduced to molybdenum/tungsten blue and can be detected colorimetrically by absorbance at 650nm. The higher the concentration of protein, the darker the solution. Linear range: 5-100ug/ml. Note: Presence of strong acids, detergent or ammonium sulfate and/or similar nature biochemicals can interfere with the assay. Transportation: at ambient temperature. Store: The kit is stable for 1 year at room temperature; BSA Solution should be kept at -20°C. SK4051
Stable Lowry Protein Assay Kit
1000 Assays
In the tradraditional Lowry Assays, Reagent C must be made by mixing Reagent A and Reagent B before use. The Stable Lowry Protein Assay Kit provides a more convenient method by using a single and stable Reagent C to replace Reagent A and Reagent B. Features: (1) Linear response from 5-100 µg/ml for BSA (2) Stable and Convenient . Transportation: at ambient temperature. Store: The kit is stable for 1 year at room temperature; BSA Solution should be kept at -20°C. SK4041
Modified Lowry Protein Assay Kit
1000 Assays
The modified ( improved) kit combines stabilized formulation of the traditional Lowry
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
240
2015-2016 Product Catalog
Recombinant Proteins & Protein Related Products
Reagents and the essential Folin-Ciocalteu Phenol reagent into a complete kit for accurate determination of protein concentration in a variety of samples types. Although many newer protein assay methods provide greater speed and convenience, the Lowry method remains a popular, accurate and useful option for many applications. Features: (1) A good linear response: from 5-100 µg/ml for BSA. (2) Suitable for a variety of samples types. (3) Popular: widely cited in protein research literature. Transportation: at ambient temperature. Store: The kit is stable for 1 year at 4°C. BSA Solution should be kept at -20°C. BSP061
Phosphoprotein Phosphate Estimation Assay Kit
2000 Assays
The assay is based on the alkaline hydrolysis of phosphate from seryl and threonyl residues in phosphoproteins and quantification of the released phosphate with malachite green and ammonium molybdate. The kit is suitable to identify whether a purified protein contains either phospho-serine (p-Ser) or phospho-threonine (p-Thr) as well as to estimate the level of this type of phosphorylation. Features: (1) Sensitive: range of phosphate group from 7.2-72uM. (2) Specific: measures phosphoserine (p-Ser) and phosphothreonine (p-Thr) only. Not suitable for measure phosphotyrosine (p-Tyr). Transportation: at ambient temperature. Store: The kit is stable for 1 year at 4°C,phosphorylated peptide standard should be kept at -20°C BSP069
Peroxide Quantitative Assay Kit (Water-Compatible)
250 Assays
Peroxide Quantitative assay kit detects peroxide based on oxidation of ferrous to ferric ion in the presence of xylenol orange. The kit is suitable for detection and measurement of hydrogen peroxide (H2O2) levels in biological and other liquids samples. The kit, as aqueous-compatible formulation contains sorbitol which provides sensitivity enhancement. The kit is suitable under most circumstances, although some metal chelators may require use of a blank to reduce these effects. Feature: (1) Quantitative range:1-100μM 2). (2) Ready-to-use. No catalase and heat procedure are required. (3) Versatile: Quantitation by reference to a standard curve enables the method to be adapted to a variety of sample types and testing purposes or by calculation from the extinction coefficient. (4)applications fields: protein oxide degree,determining protein glycation and measuring peroxide concentraction. Transportation: at ambient temperature. Store: The kit is stable for 1 year at 4°C. BSP067
Peroxide Quantitative Assay Kit (Lipid-Compatible)
250 Assays
Peroxide Quantitative Assay Kit is a colorimetric assay that detects peroxide based on oxidation of ferrous to ferric ion in the presence of xylenol orange. This kit is suitable for H2O2 measurement in the following applications: quantitating monitoring cellular activity, and measuring peroxide accumulation in lipid. In the lipid compatible formulation, the peroxide converts the Fe2+to Fe3+ directly. In the presence of sulfuric acid solution, the Fe3+ complexes with the xylenol orange dye to yield a purple product with maximum absorbance at 560 nm, The kit does not contain sorbitol, the assay is less sensitive than the Water Compatible kit. Feature: (1) Quantitative range:1-250μM . (2) Simple and Fast. (3) Colorimetric Assays. Transportation: at ambient temperature. Store: The kit is stable for 1 year at 4°C.
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
241
2015-2016
Recombinant Proteins & Protein Related Products
Product Catalog Protein Standard Solutions. AD0069
2ml
BSA Standard Solution (Bovine Serum Albumin Standard Solution) 0.5mg/ml Protease: None detected. Contains 0.1% sodium azide Store: at -20°C
AJ642
BSA Standard Solution (Bovine Serum Albumin ) 20 mg/ml, High Purity Grade 19.0-21.0 mg/ml
O715080
Total BSA:
Protease: None detected. Contain 0.1% sodium azide. Store: at -20°C
l
2ml
Ovalbumin, Protein Standard 2.0mg/ml High Purity Grade. Total protein 1.90-2.10 mg/ml. Protease: None detected. Store: at -20°C
G542302
1 m
5X2ml
gamma-Globulin Protein Standar solution 2.0 mg/ ml High Purity Grade Total protein 1.90-2.10
2 ml
mg/ml Protease: None detected Easy to follow protein Assays overcomes interference of agents commonly present in protein solutions and shows no protein-to-protein variation. Store: at -20°C
Inclusion Body Solubilization BS686
1kit
Inclusion Body Protein Extraction Kit Designed for extraction of insoluble aggregates of the expressed proteins-Inclusion Body Proteins and the screening of E. coli clones that express recombinant proteins in inclusion bodies. The procedure is simple, rapid. The solublized proteins can be used for downstream experiments such as re-folding, SDS-PAGE Western Blots, 2-D gel electrophoresis and enzyme analysis.
The kits can be used for 10 preps ( 10 x1 gram of wet weight E.coli ) or 10
x 1 liters of E.coli culture(when OD600.=1) Store: DNase I, Lysozyme and -20°C. PL032
protease inhibitor at
The rest of buffer components are stored at 4°C.
Inclusion body Wash Buffer, 1X Strength Solution To prepare inclusion bodies from lysed E.coli cells , cell debris is separated from inclusion
10ml 5x10 ml
bodies by centrifugation, and the inclusion bodies are washed in a low concentration of denaturant in the presence of mild detergents and RNA, DNA, Lipid, lipoprotein are removed. Store: -20°C.
Protein Lysis Buffers. BSP023
Bacterial Protein Lysis Buffer. 1X Strength Solution Bacterial Protein Extraction Buffer enables mild extraction of proteins from bacteria (E.
25 ml 4x25ml
coli) without the need for mechanical disruption. The reagent may be used for soluble protein extraction and inclusion body purgation from bacterial cell lysates. The kit is supplied with lysozyme and DNase I to improve the extraction efficiency of large (> 60 kDa) molecular weight proteins and proteins expressed in inclusion bodies.furthermore, supplied with PMSF and DTT to improve protein stability and remain intact. Depending on the particular application, additional components, such as other protease inhibitors, salts, phosphatase inhibitor and chelating agents may be added to the buffer,souble protein is suitable for immunoprecipitation, immunoAssays, SDS-PAGE, affinity purification and so on. 25ml sufficient for 20x100mg wet weight of the sample. Transportation: at ambient temperature. Store: 4°C. Lysozyme, DNase I, DTT and PMSF are stored at -20°C.
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
242
2015-2016
Recombinant Proteins & Protein Related Products
Product Catalog BSP026
20 ml
Yeast Protein Lysis Buffer, 1X Strength Solution Yeast Protein Extraction Buffer provides simple method for extraction proteins from
5x20ml
yeast cells. Features: (1) Effective for cell lysis and protein solubilization (2) Target proteins may maintain almost of biological functions. (3) Simple procedure, no extreme mechanical disruption, or glass beads are required. Supplied with PMSF, protease inhibitors and DTT to improve protein stability and remain intact and extraction efficiency. Depending on the required downstream applications, additional agents such as phosphatase inhibitor and chelating agents may be added into the kit. 20ml is sufficient for 20x 50mg wet weight of the sample. Transportation: at ambient temperature. Store: The buffer is stable for 1 year at 4°C.
Protease inhibitors, PMSF
and DTT should be kept at -20°C. BSP022
20 ml
Animal Cells Proteins Lysis Buffer. 1X Strength Solution Animal cells Lysis Buffer
provides a mild and simple method for the extraction of
5x20ml
cytoplasmic and nuclear protein from cultured mammalian cells. Supplied with PMSF, protease inhibitors and DTT. The kit, as a non-denaturing buffer does not interfere downstream experiments such as reporter Assays (e.g., luciferase, β-galactosidase, chloramphenicol acetyltransferase), protein Assays (e.g., PKA, PKC, tyrosine kinase), immuno Assays (e.g., Western blot, ELISA, RIA) and protein purification. Depending on the downstream applications, additional agents such as, phosphatase inhibitor and 7
chelating agents may be added into the kit. 20ml is sufficient for 20x10 cells . Transportation: at ambient temperature. Store: The buffer
is stable for 1 year at 4°C.
Protease inhibitors, PMSF and DTT should be kept at -20°C. BSP006
20 ml
Tissue Proteins Lysis Buffer. 1X Strength Solution Tissue Proteins Lysis Buffer is an efficient reagent for protein extraction from mammalian tissue. Supplied with PMSF, protease inhibitors and DTT, Features: (1)
5x20ml
Simple and
versatile for protein extraction from mammalian cells. (2) Suitable for most applications including enzyme and protein purification applications, electrophoresis, Western blotting and 2D-gel analysis. (3) Gentle: Non-denaturing and does not interfere with downstream experiments. Depending on the required downstream applications, additional agents such as and chelating agents,
phosphatase inhibitor may be added into the Tissue Protein
Lysis Buffer. 20ml is sufficient for 20x100mg mammalian tissue Transportation: at ambient temperature. Store: The buffer
is stable for 1 year at 4°C.
Protease inhibitors,
PMSF and DTT should be kept at -20°C.. PL013
Lysis-EZ G Non-denaturing Cell Lysis Buffer, 1X Strength Solution Lysis-EZ G contains non-ionic detergents, phosphotase inhibitor and protease inhibitors,
10 ml 5x10 ml
suitable for cell lysis and maintains biological activities of lysed proteins which can be used for downstream experiments immunoprecipitating, Western blot SDS-PAGE and 7
others. 10ml of the Buffer is sufficient for 10x10 cells or 10x100mg of sample. Store: The buffer is stable for 1 year at -20°C PL035
Lysis-EZ H ( IP/Western Lysis Buffer), 1X Strength Solution Lysis-EZ H, as IP/Western Lysis Buffer, is optimized for cell lysate yield, purity and
10 ml 5x10 ml
compatibility with immunoprecipitation. The Buffer is a mammalian whole cell lysis reagent based on a modified RIPA buffer formulation without SDS. This Ready-made
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
243
2015-2016
Recombinant Proteins & Protein Related Products
Product Catalog
formula is effective for extracting cytoplasmic, membrane and nuclear proteins,but does not liberate genomic DNA or disrupt protein complexes like ordinary RIPA buffer and helps maintain protein complexes for co-immunoprecipitation.The Buffer is specially formulated for pull down and IP Assays protein assays, reporter Assays and other immunoAssays procedures,meantime the buffer offer additional protease inhibitor and phosphatase inhibitor buffer for keep protein intact and high biology activity.Suitable for mammalian cells and animal tissues. 10ml of
Lysis-EZ H
7
is sufficient for 10x10 cells or 10x100mg
of sample . Transportation: at ambient temperature. Store: The buffer is stable for 1 year at 4°C,protease inhibitor and phosphatase inhibitor should be kept at -20°C PL014
Lysis-EZ J Denaturing Cell Lysis Buffer,
10 ml
1X Strength Solution
Lysis-EZ J is suitable for cell lysis of the following proteins: (1) The insoluble antigen, such
5x10 ml
as cytoskeleton and membrane protein, hydrophobic proteins. (2) The proteins, epitopes of which are hiden in secondary even higher structure and some proteins were subjected to aggregate and precipitate, (3) The proteins translated in vitro, treated protein that can be used for downstream experiments such as SDS-PAGE, 1D & 2D electrophoresis,10ml 7
of the Buffer is sufficient for 10x10 cells or 10x100mg tissue sample. Store: The buffer is stable for 1 year at -20°C PL005
10 ml
RIPA Lysis & Extraction Buffer I, 1X Strength Solution RIPA Buffer I, as a common lysis & extraction buffer, suitable for strong lysis and efficient
5x10ml
release of cytoplasmic, membrane and nuclear proteins from adherent and suspension cultured mammalian cells and tissue. The RIPA I is compatible with many downstream applications including reporter assays, protein assays, immuno assays and other protein purification procedures. The lyis buffer offer proteinase inhibitor and phosphatase inhibitor. Depending on the required downstream applications, additional agents such as reducing agents and EDTA,EGTA and so on may be added into the RIPA I buffer,10ml is 7
sufficient for10x10 cells or 10x100mg. Transportation: at ambient temperature. Store: The buffer is stable for 1 year at 4°C,protease inhibitor and phosphatase inhibitor should be kept at -20°C. PL006
10 ml
RIPA Lysis & Extraction Buffer II, 1X Strength Solution RIPA Buffer II, as a middle-strong and common lysis & extraction buffer, suitable for
5x10ml
efficient release of cytoplasmic, membrane and nuclear proteins from adherent and suspension cultured mammalian cells and tissue. The RIPA II is compatible with many downstream applications including reporter assays protein assays immuno assays and other protein purification procedures.The lyis buffer offer protease inhibitor and phosphatase inhibitor. Depending on the required downstream applications, additional agents such as reducing agents and EDTA, EGTA and other reagents may be added into 7
the RIPA II buffer, 10 ml of RIPA II buffer is sufficient for 10x10 cells or 10x100mg. Transportation: at ambient temperature. Store: The buffer is stable for 1 year at 4°C,protease inhibitor and phosphatase inhibitor should be kept at -20°C. PL007
RIPA Lysis & Extraction Buffer III, 1X Strength Solution RIPA Buffer III, as a middle-strong and common lysis & extraction buffer, suitable for
10 ml 5x10ml
middle efficient release of cytoplasmic, membrane and nuclear proteins from adherent and suspension cultured mammalian cells and tissue. The RIPA III buffer containing
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
244
2015-2016
Recombinant Proteins & Protein Related Products
Product Catalog EDTA, EGTA is suitable
for nuclear protein extraction and compatible with many
downstream applications including reporter assays protein assays immuno assays and other protein purification procedures..The lyis contains protease inhibitor and phosphatase inhibitor. Depending on the required downstream applications, some of additional agents such as reducing agents may be added into the RIPA III. 50 ml of RIPA 7
III buffer is sufficient for 10x10 cells or 10x100mg Transportation: at ambient temperature. Store: The buffer is stable for 1 year at 4°C, protease inhibitor and phosphatase inhibitor should be kept at -20°C PL008
10 ml
RIPA Lysis & Extraction Buffer IV, 1X Strength Solution RIPA Buffer IV, as a mild and common lysis & extraction buffer suitable for release of
5x10ml
cytoplasmic, membrane and nuclear proteins from adherent and suspension cultured mammalian cells and tissue. The RIPA IV is compatible with many downstream applications including reporter assays protein assays immuno assays and other protein purification procedures.The RIPA Buffer IV contains protease inhibitor and phosphatase inhibitor. Depending on the required downstream applications, some of additional agents such as reducing agents and EDTA, EGTA and others may be added into the RIPA IV 7
buffer. 10 ml of RIPA IV is sufficient for 10x10 cells or 10x100mg. Transportation: at ambient temperature. Store: The buffer is stable for 1 year at 4°C. protease inhibitor and phosphatase inhibitor should be kept at -20°C
Lysis-EZ
Protein Extraction Buffers for 2D Gels
Before running 2D gels to choose the right protein solubilization buffers is important. The suitable buffers must solubilize proteins effectively without disturbing the native changes of the proteins. Urea, as a common chaotrope is widely used for solubilization and denaturation of proteins. Bio Basic Inc. has developed a range 2D Gel Extraction Buffers based on Urea,Thiourea Chaps,NDSB-201,ASB-16 and SB3-10 . Depending on the nature of the samples, you may choose one or more of the B. Transportation: at ambient temperature. Store: Buffers are stable for 1 year at 4°C. PL037
Extraction Buffers for 2D Gels I Urea powder and Nonidet P-40 diluent as major components
50 ml
PL038
Extraction Buffers for 2D Gels II Urea powder and CHAPS diluent as major components
50 ml
PL039
Extraction Buffers for 2D Gels III Urea, Thiourea powder and CHAPS diluent as major
50 ml
components PL040
Extraction Buffers for 2D Gels IV Urea, Thiourea ASB-16 powder and
CHAPS diluent as
50 ml
major components. PL041
Extraction Buffers for 2D Gels V Urea,Thiourea Sulfobetaine 3-10 powder and CHAPS diluent
50 ml
as major components. PL042
Extraction Buffers for 2D Gels VI Urea Thiourea DNSB-201powder and CHAPS diluent as
50 ml
major components PL012
Lysis-EZ K, Red Blood Cell (RBC) Lysis Buffer, 2X Strength Solution
10x10 ml
Suitable for use in isolation of Leukocytes from fresh whole blood and for use in hybridoma protocols to remove red blood cells from mouse splenocyte suspensions before fusion operation, Lysis-EZ K may selectively lyse the erythrocytes leaving the leukocytes.. Red Blood Cell Lysis Buffer has been developed. 10ml of Lysis-EZ K is sufficient for 10ml of blood sample. Store: -20°C PL015
Lysis-EZ L, White Blood Cell Lysis Buffer,
1X Strength Solution
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
10ml
245
2015-2016
Recombinant Proteins & Protein Related Products
Product Catalog
The white blood cells after removed red blood cells by Lysis-EZ
L Buffer from whole blood or by
10x10 ml
ficoll gradient ultracentrifugation and other treated white blood cells sample such as Buffy coat can be readily lysed by the lysis buffer and then isolated nucleic acid with the DNA Isolation Reagent for Genomic DNA or any other method for nucleic acid isolation from fresh whole blood. Supernatant after lysed by Lysis-EZ L can also be used for protein separation and electrophoresis 10ml of Lysis-EZ L is sufficient for 10ml of blood sample. Store: -20°C
Protein Extraction Buffers & Kits Except the Lysis-EZ series products, Bio Basic Inc. has also developed an Extract-EZ series products and offers a wide selection of Protein Extraction Kits for extraction of proteins from variable sources including bacteria, yeast, animal & plant cells and tissues. BSP003
50preps
Total Protein Extraction Kit The total Protein extraction Kit provides an optimized reagents and buffers for efficient total protein extraction from adherent and suspension cultured mammalian cells and tissue. Total protein isolated by this kit
maintain biological activity and can be used for many
downstream applications including SDS-PAGE, Western blotting, IP, Pull down, gel mobility 7
shift, protein assays. The kit is sufficient to extract proteins from 50x 10 mammalian cells or 50x200mg of tissues sample. Transportation: at ambient temperature. Store: The buffer is stable for 1 year at 4°C. BS596
Extract-EZ B, Bacterial Protein Extraction Kit, 10 X strength Solution
1 kit
Extract-EZ B, as Bacterial Protein Extraction Kit, is designed for the extraction of biologically active soluble proteins and high purity inclusion bodies from bacterial cells. It is compatible with the FLAG, poly-His and GST fusion protein affinity chromatography purification systems, the kit is also compatible with many enzyme or protein assays and protease inhibitor cocktails. The kit is sufficientt for 1 liter of cell culture (when OD600.=1) or 10x100-200mg wet weight E.coli. Store 10x Extract-EZ B buffer at 4°C; Store DNase I, RNase, Lysozyme and PMSF at -20C. Valid for 1 year. BSP013
50 preps
Extract-EZ C Yeast Protein Extraction Kit Extract-EZ C, as Yeast Protein Extraction Kit, provides an optimized reagents and buffers for efficient extraction of biologically active and soluble total protein from yeast cells. The Eztract-EZ C contains EDTA、CaCl , DTT,
protease inhibitors cocktail and a special
reagent to break cell wall. The extracted proteins maintain biological activities and suitable for many downstream applications including SDS-PAGE, Western blot, enzyme analysis, 2 D gel electrophoresis. The kit is sufficient for 50x50 mg wet yeast cells. Store: the protease inhibitor cocktail at –20°C, store the buffers at 4°C. The kit is stable for 1 year. . BSP073
50 preps
Extract-EZ E1, Total Subcellular Protein Extraction Kit Extract-EZ E1, as a Total Subcellular Protein Extraction Kit
is designed for extraction of
four subcellular protein fractions (Cytosol, nucleus, membrane/ organelle, and cytoskeletal protein) from from adherent and suspension cultured mammalian cells. The procedure is fast and simple, it takes 2 hours and no ultracentrifugation is required. All four protein fractions obtained are suitable for many downstream applications such as 1-D or 2-D gel, enzyme activity assays, gel shift Assays, and Western blotting. The kit is sufficient for 50 7
X 10 from adherent and suspension cultured mammalian cells. Store: at 4°C. BSP001
Extract-EZ G, Nuclear & Cytoplasmic Protein Extraction Kit
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
50 preps
246
2015-2016
Recombinant Proteins & Protein Related Products
Product Catalog
Extract-EZ G, as a Nuclear & Cytoplasmic Protein Extraction Kit is designed for efficient separation of nuclear and cytoplasmic fractions with little or no cross-contaminations. The extracted nuclear and cytoplasmic proteins are functional and compatible with many downstream applications such as transcriptional activity, RNA splicing, gel shift Assays, reporter assays, enzyme activity assays, and Western blotting. The kit is sufficient for 7
50X10 cells or 50x200mg tissue samples. Transportation: at ambient temperature. Store: The buffer is stable for 1 year at 4°C.. BSP009
50 preps
Nuclear Protein Fractionation Kit Nuclear Protein Fractionation Kit is designed for for effective extraction of nuclear proteins from mammalian tissues and curture cells. The nuclear proteins extracted by using Eztrac-EZ H can be used for many downstream allpications such as Western blotting, ELISA, 2D electrophoresis, IP, EMSA, Pull down, transcription regulation. Procedure is simple,
no ultracentrifugation and toxic chemicals are involved. The kit is sufficient for
7
50X10 or
50x200mg of samples. Transportation: at ambient temperature. Store: The
buffer is stable for 1 year at 4°C. BSP005
50 preps
Extract-EZ K1, Membrane and Cytoplasmic Protein Extraction Kit Extract-EZ K, as a Membrane and Cytoplasmic Protein Extraction Kit, is designed for effective extraction of membrane and cytoplasmic proteins from mammalian tissues and curture cell . The extracted proteins can be utilized in a variety of applications, such as Western blotting, 2-D gels, and enzyme analyses, SDS-PAGE, IP, EMSA, Pull down. 7
Extract-EZ K can be used for 50 sample preparations ( 50x200 mg tissue or 50x 10 culture cell per sample). Transportation: at ambient temperature. Store: The buffer is stable for 1 year at 4°C. BSP051
Extract-EZ L1, Cytosol & Mitochondria Protein Extraction Kit
50 preps
Extract-EZ L1, as a Cytosol & Mitochondria Protein Extraction Kit, is designed for effective isolation of a highly enriched mitochondrial fraction from cytosolic fraction of mammalian cells including both apoptotic and nonapoptotic cells. The enriched mitochondrial and cytosolic fractions can be used for studying apoptotic and signal transduction pathways to detect translocation of factors between the two fractions by Western blotting, ELISA, 2D electrophoresis or other applications. Procedure is simple, no ultracentrifugation and toxic 7
chemicals are involved. The kit is sufficient for 50X10 or 50x200mg of samples. Transportation: at ambient temperature. Store: The buffer is stable for 1 year at 4°C. BSP058
FFPE Protein Extraction Kit
50 preps
Because of results obtained from cell cultures may not represent the true differential protein expression patterns in vivo. formalin-fixed, paraffin-embedded tissues represent a comprehensive source of protein expression profiles associated with diseases such as cancer. These samples enable the course of disease — e.g., before and after therapy — to be examined .
FFPE Protein Extraction Kit provides optimized conditions for extracting
total protein from FFPE tissue sections. After deparaffinized in 5minutes by supplied rapid deparaffinization reagent, the sections are incubated in an optimized extraction buffer at two different temperatures in a process that reverses formalin crosslinking and untangles the protein molecules. After a centrifugation step, the supernatant containing the released proteins is precipitated, recovered and can be used for protein Assays,western blot ,
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
247
2015-2016
Recombinant Proteins & Protein Related Products
Product Catalog
SDS-PAGE, or 2D electrophoresis and other applications. The kit can perform 50 mini-preps. Transportation: at ambient temperature. Store: The buffer is stable for 1 year at 4°C. BSP002
50 preps
Membrane, Nuclear &Cytoplasmic Protein Extraction Kit Membrane, Nuclear and Cytoplasmic Protein Extraction Kit is designed for efficient separation of nuclear , membrane and cytoplasmic fractions with little or no cross-contaminations. The extracted nuclear , membrane and cytoplasmic proteins are functional and compatible with many downstream assays such as transcriptional activity, RNA splicing, gel shift Assays, reporter assays, immunoprecipitation, enzyme activity 7
assays, Western blotting, ELISA. The kit is sufficient for 50X10 cells or 50x100mg tissue samples. Store at 4°C. BSP004
20 preps
Plant Protein Extraction Kit Plant Protein Extraction Kit is designed for rapid (as few as 20 minutes) recovery of soluble proteins from plant tissue samples. The resulting protein extract is compatible with many downstream applications, including SDS-PAGE, 2-D gel electrophoresis, Western blotting, activity assays and affinity purification. The Kit includes three components: an organic solution to lyse plant cells, an aqueous buffer to gently solubilize proteins and a protein-stabilizing reagent. The Kit has been tested on leaves, roots, flowers and seeds from various species, including Arabidopsis, tobacco, spinach, peas and soybeans. Extremely fibrous tissue samples, such as woody stems, may require additional mechanical grinding by devices not included in the kit. Depending on the particular application, additional components, such as protease inhibitors,, phosphatase inhibitor and chelating agents may be added to the buffer,The kit contains sufficient reagents to extract protein from either 20 × 40 mg of fresh/frozen plant tissue or 20 × 10 mg of dried plant tissue.
Immunoprecipitation (IP) Kit Immunoprecipitation (IP) is a method by which a protein can be specifically purified from a complex mixture of proteins using a specific antibody and a matrix that binds the antibody. The matrix bound protein (via the specific antibody) can then be separated from the mixture by centrifugation. The matrices commonly used are agarose or sepharose bound Protein A or protein A/G PlUS. IP is one of the most widely used immunochemical techniques. IP followed by SDS-Polyacrylamide Gel Electrophoresis (SDS-PAGE) and immunoblotting is routinely used in a variety of applications: to measure the molecular weights of protein antigens, study protein/protein interactions, determine specific enzymatic activity, monitor protein post-translational modifications and determine the presence and quantity of proteins. The IP technique also enables the detection of rare proteins, which otherwise would be difficult to detect, since immunoprecipitation can concentrate them as much as 10,000-fold. Applications:: The Protein-A Immunoprecipitation Kit is especially designed to allow maximal recovery of immunoprecipitates. The whole process is performed in mini-spin columns, instead of in microcentrifuge tubes, which enables convenient washing of the antigen-antibody-bound beads. Features:Easy access.;Minimal loss of antigen-antibody bound beads during washing.;Minimal non-specific signals by increasing the stringency of the washing steps. Store: at 4°C.and PMSF should be stored at -20°C. Components
BS688 For 20 Reactions
BS689 For 20 Reactions
BS690 For 20 Reactions
10x Lysis buffer
10 ml
10 ml
10 ml
PMSF
0.6ml
0.6ml
0.6ml
10x IP
50 ml
50 ml
50 ml
SDS
5 ml
5 ml
5 ml
NaCl
10 ml
10 ml
10 ml
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
248
2015-2016
Recombinant Proteins & Protein Related Products
Product Catalog Protein A-Agarose
0.4 ml
/
/
Protein A/G Plus-Agarose
/
0.4 ml
/
Protein A-Sepharose
/
/
0.6 ml
20x PBS
20 ml
20 ml
20 ml
1x SDS gel-loading buffer
1 ml
1ml
1 ml
Spin columns and
20
20
20
tubes
Phosphatase Inhibitor, Protease Inhibitors, Protease Assays & Proteases PL017
1ml
Phosphatase Inhibitor Cocktail I, 100X Strength Solution As a mixture of 5 phosphatase inhibitors that target acid and alkaline phosphatases , tyrosine phosphatases.
The Cocktail I is a stabilized solution of sodium fluoride, sodium orthovanadate,
sodium molybdate,imidazole,sodium tartrate dihydrate, is compatible with common protin assays. Store at -20°C. PL019
1ml
Phosphatase Inhibitor Cocktail II, 10X Strength Solution As a mixture of 4 phosphatase inhibitors that target ser/Thr phosphatase and tyrosine phosphatase.
The Cocktail II is a stabilized solution of sodium fluoride, sodium orthovanadate,
sodium pyrophosphate and b-glycerophosphate. Store at -20°C.
Protease Inhibitors Cocktails During protein expression and isolation, endogenous enzymes such as proteases and phosphotases degrade protein samples following cell lysis or tissue disaggregation. The resulting proteolysis can drastically reduce the quality and quantity of protein samples. The best way to overcome this problem is to add protease inhibitors to the crude & complex protein solutions. By utilizing a specific combination of protease inhibitors, preparative protein samples may be protected from the most common proteases. Bio Basic Inc. offers a wide selection of Protease Inhibitor Cocktails. BS381
Bacteria Protease Inhibitor Cocktail (With EDTA), 100X Strength Solution
1 ml
Suitable for the protection of protein samples from bacteria. Inhibits bacterial serine, cysteine and other bacterial specific proteases including aminopeptidases and aspartic proteases. Bacteria Protease Inhibitor Cocktail contains EDTA, is not suitable for the protein purification using immobilized metal affinity chromatography. Store at -20°C BS380
Bacteria Protease Inhibitor Cocktail(Without EDTA), 100X Strength Solution
1 ml
Designed for the protection of protein samples from bacteria. Inhibits bacterial serine, cysteine and other bacterial specific proteases including aminopeptidases and aspartic proteases. Bacteria Protease Inhibitor Cocktail does not contains EDTA, is
suitable for the protein
purification using immobilized metal affinity chromatography. Store at -20°C BS382
Yeast& Fungal Protease Inhibitor Cocktail, 100X Strength Solution
1 ml
Designed for the protection of protein samples from Yeast& Fungal. Inhibits Yeast& Fungal serine, cysteine and other Yeast& Fungal specific proteases. Store at -20°C BS384
Plant Protease Inhibitor Cocktail 100X Strength Solution
1 ml
Designed for the protection of protein samples from plant. Inhibits plant serine, cysteine and other plant specific proteases including aminopeptidases, aspartic and metalloproteases. Store at -20°C
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
249
2015-2016
Recombinant Proteins & Protein Related Products
Product Catalog BS386
1 ml
Mammalian Protease Inhibitor Cocktail 100X Strength Solution Suitable for the protection of protein samples from mammalian cells. Inhibits mammalian serine, cysteine and other mammalian specific proteases including aminopeptidases, trypsin-like and aspartic proteases. This Cocktail does not contains EDTA, is suitable for the protein purification using immobilized metal affinity chromatography. Store at -20°C
Individual Protease Inhibitors AD0006 Store: 2~8°C [30827-99-7]
AEBSF [4-(2-Aminoethyl)benzenesulfonyl fluoride, hydrochloride] Ultra Pure Grade, White powder, C8H10NSO2F·HCl
MW 239
50 mg
Purity >98%, Useful as a non-toxic
alternative for PMSF. Soluble: H2O, EtOH. Working Range: 0.1-1.0mg/ml (0.4-4mM). Soluble in water and ethanol
ADJ692 Store: 2~8°C [37682-72-7]
Antipain, dihydrochloride
(N-(N-carbonyl-Arg-Val-Arg-al)-Phe)
Lyophilized powder. C27H44N10O6·2HCl Heavy metals 95%. Lose on drying 6000 units/mg, Lyophilized powder,
from bovine lung Trypsin inhibitor
C284H432N84O79S7
SDS-PAGE gel. Working Range: 0.1-0.3μM.
50 mg
MW 6511.44 Single band on
loss on drying 98%,
100 g
Benzamidine hydrochloride hydrate Grade,
Highly purified by chromatography
o
mp: 87 C, Em (230nm, in methanol): >9,500, Working concentration: 0.5-4mM., Very soluble in water , ethanol.
DJ690 Store: -15~-20°C (58970-76-6)
Bestatin
High Purity Grade White powder. C16H24N2O4
MW 308.4
A competitive
10 mg
inhibitor of aminopeptidases, aminopeptidase B, leucine aminopeptidase, and tripeptide aminopeptidase. Not an inhibitor of carboxypeptidases. Suggested Starting Concentration: 40ug/ml.
DJ695 Store: -15~-20°C (9076-44-2)
Chymostatin C31H41N7O6
5 mg
Ultra Pure Grade, MW 605.04
chymotrypsin and
A reversible serine protease inhibitor of α-,β-,γ-,δ-
papain and other cysteine proteases. Working Range: 10-100uM.
Soluble: DMSO, CH3COOH. SB8770
E-64 [trans-Epoxysuccinyl-L-leucylamido-(4-guanidino) Butane] High P{urity Grade
Store: -15~-20°C
C15H27N5O5 MW 357.40 An irreversible inhibitor of cysteine proteases like papain,
[66701-25-5]
calpain, and cathepsin B, H, L and S. Soluble: DMSO One Spot on TLC Working Range:
LDJ691
Leupeptin (Acetyl-Leu-Leu-Arginal)
5 mg
1-10uM. Store: -15~-20°C (103476-89-7) PDJ694 Store: 2~8°C (26305-03-3)
C20H38N6O4
Ultra Pure Grade. Lyophilized powder.
MW 463.0. Purity >98% (HPLC), Residue on ignition 90% An aspartic acid protease inhibitor of pepsin,
cathepsin D and HIV protease. Working Range: 1uM. Soluble in DMSO,
MeOH. PB0693 Store RT (5144-89-8)
1,10-Phenanthroline
[o-Phenanthroline]
Reagent Grade. White to yellowish
100 g
powder. C12H8N2.H2O, MW198.20
25 g
Purity >99%, Water: 8.5-10%, mp: 114-117 ºC, bp: >300 ºC,
Residue on ignition 98%. mp: 178°C. Working Range: 5-500uM.
Soluble: DMSO, MeOH, water. PB0425
PMSF [Phenylmethanesulfonyl fluoride]
Store: -15~-20°C
C6H5 CH2SO2F
MW 174.19
Purity >99%, An irreversible serine protease inhibitor of
trypsin Working Range: 0.1-1.0mM. UB0981
25 g
Soluble: in EtOH, MeOH. Unstable in water.
Urinary trypsin inhibitor fragment (UTI)
Store: -15~-20°C
5g
High Purity Grade. White crystal.
Arg-Gly-Pro-Cys-Arg-Ala-Phe-Ile Ultra
100 mg 500 mg
Pure Grade C40H66N14O9S
MW 919.1 Purity >98% HPLC Activity >2000U/mg CAS#
164859-77-2
Protein Purification Chromatography Media & Protein Affinity Chromatography Gel Filtration Media Bio Basic Inc. offers a wide selection of Sefinose gel filtration products which equal to Sepharose. SF001-4B
Sefinose 4B
100 ml
Supplied as a slurry in 20% ethanol. Equals to Sepharose 4B. Sefinose 4B is a highly gel strength
500 ml
bioagarose matrix, is widely used for gel filtration and coupling of affinity ligands for protein analysis and purification. Particle size: 45-165 µm; pH stability: 4-9; Separation range of molecular 4
7.
weight: 6 × 10 - 2 × 10 Flow specification: 70-140 cm/h, Matrix: 4% beads agarose. Store: 4°C SF002-6B
100 ml
Sefinose 6B Supplied as a slurry in 20% ethanol. Equals to Sepharose 6B Sefinose 6B
is a highly gel
500 ml
strength bioagarose matrix, is more resistant to denaturing conditions, and thus has more versatility in the choice of buffers and eluents. Sefinose 6B is widely used for gel filtration and coupling of affinity ligands for protein analysis and purification. Particle size: 45-165 µm; pH 4
6
stability: 4-9; Separation range of molecular weight: 1 × 10 - 4 × 10 Flow specification: 100-200 cm/h, Matrix: 6% beads agarose. Store: 4°C SF003-CL
100 ml
Sefinose CL-4B Supplied as a slurry in 20% ethanol. Equals to Sepharose
TM
CL-4B. Sefinose CL-4B is a highly gel
500 ml
strength bioagarose matrix, is widely used for gel filtration and coupling of affinity ligands for protein analysis and purification. Hydrophilic back-bone results in low nonspecific interactions and high recoveries of proteins. Particle size:: 45-165 µm; pH stability: 3-12; Separation range of 4
7
molecular weight: 6 × 10 - 2 × 10 Flow specification: 80-150 cm/h, Matrix: 4% beads agarose. Store: 4°C SF004-CL
100 ml
Sefinose CL-6B Supplied as a slurry in 20% ethanol. Equals to Sepharose
TM
CL-6B Sefinose CL-6B is a highly gel
500 ml
strength bioagarose matrix, is widely used for gel filtration and coupling of affinity ligands for protein analysis and purification. Hydrophilic back-bone results in low nonspecific interactions and high recoveries of proteins. Particle size: 45-165 µm; pH stability: 3-12; Separation range of 4
6
molecular weight: 1× 10 - 4 × 10 Flow specification: 100-200 cm/h, Matrix: 6% beads agarose. Store: 4°C SF005-4F
Sefinose 4 Fast Flow
100 ml
Supplied as slurry in 20% ethanol. Equals to Sepharose 4 Fast Flow Sefinose 4 Fast Flow used for preparative purification with high flow rates. Easy to scale up from laboratory scale to process
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
251
2015-2016
Recombinant Proteins & Protein Related Products
Product Catalog scale. Particle size:45-165 µm; pH stability: 4
3-13 (long term), pH 2-14 ( short term)
Separation
7
range of molecular weight: 6 × 10 - 3 × 10 Matrix: 4% beads agarose. Store: 4°C SF006-6F
100 ml
Sefinose 6 Fast Flow Supplied as slurry in 20% ethanol.
Equal to Sepharose 6 Fast Flow Sefinose 6 Fast Flow is used
for preparative purification with high flow rates. , is more resistant to denaturing conditions, and thus has more versatility in the choice of buffers and eluents. Easy to scale up from laboratory scale to process scale. Particle size:45-165 µm; pH stability: term)
4
3-13 (long term), pH 2-14 ( short 7
Separation range of molecular weight: 6× 10 - 2 × 10 Matrix: 6% beads agarose. Store:
4°C
Ion Exchange Chromatography
Bio Basic Inc. offers a wide selection of ion exchange chromatography media compatible to Sepharose
products SF007-Q
25 ml
Q Sefinose FF Supplied as a slurry in 20% ethanol. Equals to Q Sepharose F F.
Q Sefinose FF, as a strong ionic
100 ml
exchanger media with high flow rates is used for analytical, preparative fractionation and concentration of proteins and other macro biomolecules. Ionic exchanger type: Quaternary -
ammonium strong anion; Ionic capacity: 0.18-0.25 mmol (Cl )/ml ; Dynamic capacity: 120 mg HSA/ml medium ; Flow specification : 400-700 cm/h pH stability: 2-12 (long term) 1-14 (short term), Chemical stability: Stable in all common aqueous buffers: 8 M urea, 6 M guanidine HCl, 70% ethanol, 1 M NaOH*, and 1 M acetic acid. Matrix: 4% beads agarose. Store: 4°C SF011QXL
25 ml
Q Sefinose XL Supplied as a slurry in 20% ethanol. Equals to Q Sepharose XL Q Sefinose XL is similar to Q Sefinose Fast Flow media. Strong Q ion exchange groups are attached to the dextran through chemically stable ether bond XL are ion exchange adsorbents specially designed for use in packed beds to capture biomolecules. Q Sefinose XL has extremely high loading capacities, combined with high throughput, can increase the productivity of manufacturing operations. Ionic exchanger type: Quaternary ammonium strong anion; Ionic capacity: 0.18~0.26 mmol (Cl-)/ml; Dynamic capacity:
> 130 mg BSA/ml; Particle size: 45-165 µm; pH stability: 2-12 (long term) 1-14
(short term), Chemical stability: Stable in all common aqueous buffers: 8 M urea, 6 M guanidine HCl, 70% ethanol, 1 M NaOH*, and 1 M acetic acid. Matrix: 6% beads agarose. Store: 4°C SF008-DE
25 ml
DEAE Sefinose FF Supplied as a slurry in 20% ethanol.
Equals to DEAE Sepharose FF. DEAE Sefinose FF is a
100 ml
weak anion exchanger for binding and resolving of proteins of all pl values, is widely used for chromatography,
purification
and
concentration
of
proteins.
Ionic
exchanger
+
Diethylaminoethyl weak anion; Ionic capacity: 0.18-0.25 mmol (H )/ml ; Dynamic capacity:
type: > 70
mg RNase/ml medium ;Particle size:: 45-165 µm; pH stability: 4-13 (long term) 3-14 (short term), Chemical stability: Stable in all common aqueous buffers: 8 M urea, 6 M guanidine HCl, 70% ethanol, 1 M NaOH*, and 1 M acetic acid, Matrix: 6% beads agarose. Store: 4°C SF009-SP
25 ml
SP Sefinose FF Supplied as slurry in 20% ethanol & 0.02 M sodium acetate. Equals to SP Sepharose FF. SP
100 ml
Sefinose FF is a strong cation exchanger for binding and resolving of proteins of all pl values. is widely used for chromatography, purification and concentration of proteins. Ionic exchanger type: Sulfopropyl strong cation ; Ionic capacity: 0.11~0.16 mmol (Cl-)/ml; Dynamic capacity:
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
> 110 mg
252
2015-2016
Recombinant Proteins & Protein Related Products
Product Catalog
BSA/ml; Particle size:: 45-165 µm; pH stability: 2-13 (long term) 1-14 (short term), Chemical stability: Stable in all common aqueous buffers: 8 M urea, 6 M guanidine HCl, 70% ethanol, 1 M NaOH*, and 1 M acetic acid, Matrix: 6% beads agarose. Store: 4°C SF012SPX
100 ml
SP Sefinose XL Supplied as a slurry in 20% ethanol & 0.02 M sodium acetate. Equals to SP Sepharose XL. SP Sefinose XL is a strong cation adsorbents specially designed to lower the manufacturing cost of biopharmaceuticals by raising the throughput of production scale chromatography processes. SP Sefinose XL has a dynamic binding capacities up to 10 fold higher than conventional ion exchangers. Matrix: 6% beads agarose dynamic binding capacities: +
sulphopropyl group, Ionic capacity: 0.18~0.25 mmol H /ml l; Dynamic binding capacities: > 160 mg lysozyme/ml Particle size: 90 µm (45-165 µm); pH stability: 3~14 ( short term) 4~13 (long term); Chemical stability: Stable in all common aqueous buffers: 8 M urea, 6 M guanidine HCl, 70% ethanol, 1 M NaOH*, and 1 M acetic acid , not be stable in solution containing ionic detergents and oxidative agents. Store: 4°C SF014SPH
25 ml
SP Sefinose HP Supplied as a slurry in 20% ethanol & 0.02 M sodium acetate. Equals to SP Sepharose H SP Sefinose HP is a strong cation adsorbents specially designed to lower the manufacturing cost of biopharmaceuticals by raising the throughput of production scale chromatography processes. Matrix: 6% beads agarose dynamic binding capacities: sulphopropyl +
group, Ionic capacity: 0.15~0.20 mmol H /ml l; Dynamic binding capacities: > 55 mg RNase A/ml Particle size: 90 µm (45-165 µm); pH stability: 3~14 ( short term) 4~13 (long term); Chemical stability: Stable in all common aqueous buffers: 8 M urea, 6 M guanidine HCl, 70% ethanol, 1 M NaOH*, and 1 M acetic acid, not be stable in solution containing ionic detergents and oxidative agents. Store: 4°C SF010-CM
25 ml
CM Sefinose FF Supplied as a slurry in 20% ethanol. Equals to CM Sepharose FF CM Sefinose FF is a weak anion
100 ml
exchanger for binding and resolving of proteins of all pl values., is widely used for chromatography, purification and concentration of proteins. Ionic exchanger type: Carboxymethyl +
weak cation; Ionic capacity: 0.09-0.13 mmol (H )/ml ; Dynamic capacity:
> 50 mg RNase/ml
medium ;Particle size:: 45-165 µm; pH stability: 4-13 (long term) 2-14 (short term), Chemical stability: Stable in all common aqueous buffers: 8 M urea, 6 M guanidine HCl, 70% ethanol, 1 M NaOH*, and 1 M acetic acid. Store: 4°C
Protein Hydrophobic Chromatography SF015-BU
Butyl Sefinose 4 Fast Flow
100 ml
Supplied as slurry in 20% ethanol. Equals to Sepharose 4 Fast Flow. Butyl Sefinose 4 F F a hydrophobic interaction chromatography media made of highly gel strength bioagarose matrix derivatized via uncharged, chemically stable ether linkages, is a, is widely used for gel filtration and coupling of affinity ligands for protein analysis and purification. Butyl content: Binding capacity: 7 mg IgG/ml medium; 40 µmol/ml medium Particle size: 45-165 µm; pH stability: 3-13 (long term) 2-14 (short term); Chemical stability: Stable in common buffers, chaotropic agents, detergents, and polar organic solvents. Matrix: 4% beads agarose. Store: 4°C SF016PH
Phenyl Sefinose 6 Fast Flow (LS)
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
100 ml
253
2015-2016
Recombinant Proteins & Protein Related Products
Product Catalog
Supplied as a slurry in 20% ethanol. Phenyl Sefinose 6 Fast Flow (LS-low substitution) is a separation medium for hydrophobic interaction chromatography (HIC). Substances are separated on the basis of their different hydrophobic. It has no charged groups, making true hydrophobic interaction chromatography possible without interfering ionic effects. Matrix activation : epichlorohydrin. Matrix attachment : ether; Matrix spacer: 3 atoms; Binding capacity : 10 mg IgG/ml or 24 mg/ml HAS; Max Pressure : 43 psi; Highly cross-linked agarose, 6% ; Particle size range: 45-165um; pH stability: 4-12 ( long term), 3-13 ( short term) Storage: 20% ethanol. Store: 4°C SF017PH
25 ml
Phenyl Sefinose 6 Fast Flow (HS) Supplied as a slurry in 20% ethanol. Phenyl Sefinose 6 Fast Flow (HS High substitution) is a separation medium for hydrophobic interaction chromatography (HIC). Substances are separated on the basis of their different hydrophobic. It has no charged groups, making true hydrophobic interaction chromatography possible without interfering ionic effects. Matrix activation : epichlorohydrin. Matrix attachment : ether; Matrix spacer: 3 atoms; Binding capacity : 30 mg IgG/ml 36 mg/ml HAS; Max Pressure : 43 psi; Highly cross-linked agarose, 6% ; Particle size range: 45-165um; pH stability: 4-12 ( long term), 3-13 ( short term) Storage: 20% ethanol. Store: 4°C
Protein Affinity Chromatography Ni-IDA-Sefinose Supplied as a slurry in 20% ethanol Immobilized metal affinity chromatography (IMAC) agarose resin is a powerful tool for protein 2+
purification. Ni- Sefinose utilizing nickel (Ni ) for purification of 6x histidine tagged proteins. Features: (1) One-step purification from crude lysate (2) High purity of proteins. By gravity-flow chromatography and using this Ni-Agarose resin, the purity of proteins can be >95%% (3) Suitable for protein purification under native or denaturing conditions. (4) High binding affinity. (5) Easy to scale up (6) Re-usable for 3-5 times. (7) Very competitive price. Technique information of Ni- IDA-Sefinose Capacity: approx 10mg histidine
tagged protein/ml resin; 20
2+
µmol Ni /ml Particle size: 45-165 um; Matrix : Highly cross-linked agarose, 6%; pH stability 3-12. His-Binding/Wash Buffer ( Code BSP030-3 ) 10mM imidazole, 300mM NaCl, 50mM Sodium Phosphate Buffer (pH 8.0) and Elution Buffer( Code BSP030-4 ) Imidazole 300mM NaCl 50mM Sodium Phosphate Buffer (pH 8.0) BSP029
250mM
are separately ordered. Store: 4°C
Ni-IDA-Sefinose Resin (settled) 10ml
10ml 10x10ml
BSP081-1
Column Ni-IDA- Sefinose Resin
1ml in the prepacked gravity-flow column
5X1ml
BSP081-2
Column Ni-IDA- Sefinose Resin
1ml in the prepacked gravity-flow column
10X1ml
BSP081-3
Column Ni-IDA- Sefinose Resin
5ml in the prepacked gravity-flow column
5x5ml
BSP081-4
Column Ni-IDA- Sefinose Resin
5ml in the prepacked gravity-flow column
10x5ml
BSP030-3
Column Ni-IDA-Sefinose Resin Binding/Wash Buffer (pH 8.0)
500ml
BSP030-4
Column Ni-IDA-Sefinose Resin Elution Buffer (pH 8.0)
500ml
SD6605
3 ml Empty Spin Column Set
Store RT
One set includes 1 column, 2 filter frits and 1 top cap and 1 bottom stopper. Designed for
50 sets
packaging 0.5 ml -1.5ml of affinity resins or other materials. The packaged Ni-Agarose column can be used for Spin-purification & gravity-flow purification of proteins. SD6606
6 ml Empty Spin Column Set
Store RT
One set includes 1 column, 2 filter frits and 1 top cap and 1 bottom stopper. Designed for
50 sets
packaging 1.5 ml-3 ml of affinity resins or other materials. The packaged affinity column can be
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
254
2015-2016
Recombinant Proteins & Protein Related Products
Product Catalog
used for gravity-flow protein purification and other applications SD6607
10 ml Empty Column Set
50 sets
Store RT
One set includes 1 column, 2 filter frits and 1 top cap and 1 bottom stopper. Designed for packaging 2 ml-5 ml of affinity resins or other materials. The packaged affinity column can be used for gravity-flow protein purification and other applications
SD6608
30 ml Empty Column Set
10 sets
Store RT
One set includes 1 column, 2 filter frits and 1 top cap and 1 bottom stopper. Designed for packaging 10 ml-15 ml of affinity resins or other materials. The packaged affinity column can be used for gravity-flow protein purification and other applications
SD6609
50 ml Empty Column Set
10 sets
Store RT
One set includes 1 column, 2 filter frits and 1 top cap and 1 bottom stopper. Designed for packaging 15 ml-25 ml of affinity resins or other materials. The packaged affinity column can be used for gravity-flow protein purification and other applications
Ni-NTA Sefinose Supplied as a slurry in 20% ethanol. Compared with Ni-IDA Sefinose , Ni-NTA- Sefinose is more stable and has lower non-specific binding. 2+
It can be reused for 5-10 times if it is stored properly. Capacity: approx 10mg histidine tagged protein/ml resin; 15 µmol Ni /ml Particle T
size: 45-165 um; Matrix: Highly cross-linked agarose, 6%; pH stability 3-12. Note: The products Ni-NTA- Sefinose Resin are not available in the North America, Europe and Japan. Store: 4°C BSP033
10ml
Ni-NTA Sefinose Resin (settled) 10ml
10x10ml BSP079-1
Column Ni-NTA Sefinose 1ml in the prepacked gravity-flow column
BSP079-2
Column Ni-NTA Sefinose
BSP079-3
Column Ni-NTA Sefinose Resin
5ml in the prepacked gravity-flow column
5x5ml
BSP079-4
Column Ni-NTA Sefinose Resin
5ml in the prepacked gravity-flow column
10x5ml
BSP030-3
Column Ni-NTA Sefinose Resin Binding/Wash Buffer (pH 8.0)
500ml
BSP030-4
Column Ni-NTA Sefinose Resin Elution Buffer (pH 8.0)
500ml
SF018-BL
Blue Sefinose 6 Fast Flow
100 m
5X1ml 10X1ml
1ml in the prepacked gravity-flow column
Supplied as a slurry in 20% ethanol. Blue Sefinose 6 Fast Flow has a broad spectrum affinity, is used to separate and purify a wide variety of proteins and NAD/NADP-requiring enzymes. It is specifically used for removal of albumin from serum. Ligand : Cibacron Blue 3G; Ligand coupling method : Triazine coupling; Binding capacity : > 18 mg HSA/ml; Ligand density : 7 µmol Cibacron blue/ml; Matrix : Highly cross-linked agarose, 6% ; Particle size range: 45-165um; MW exclusion 6
limit: 4x10 pH stability: 4-12 ( long term), 3-13 ( short term) Storage: 20% ethanol, 0.1 M 0
potassium phosphate buffer, pH 8.0 coupling conditions: pH 9-10, Temperature 4-25 C Time: 2-16 h. Store: 4°C
T
Protein A Sefinose Resin Supplied as a slurry in 20% ethanol Suitable for affinity purification of IgG from serum and other fluids of many species, is especially suited for polyclonal antibody purification because it binds the broadest range of antibody species and subclasses. Features (1) High antibody binding capacity. (2) Leak-resistant and minimal nonspecific binding (3) Re-usable for multiple times when stored properly. Technique information: Capacity: approx 20mg human IgG/ml Particle size: 45-165 um; Matrix: Highly cross-linked agarose, 4%; pH stability 3-9 (long
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
255
2015-2016
Recombinant Proteins & Protein Related Products
Product Catalog
term), 2-10 (short term) Max linear flow rate: 300cm/h, Ligand & ligand density: Protein A at 3-5mg/ml. To order Protein A & Protein G see Chapter Biochemicals Store: 4°C. T
BSP095-7
Protein A Sefinose Resin
BSP095-8
Protein A Agarose Resin
(settled) (settled)
1ml
1ml
5ml
5ml
T
Protein G Sefinose Resin Supplied as a slurry in 20% ethanol. Ideal for medium and low pressure chromatography of IgG from mouse, sheep, and rabit, and for immunoprecipitations Protein Technique information: Capacity: approx 2mg human IgG/ml Particle size: 40-130 um; Matrix : Highly cross-linked agarose, 4%; pH stability 3-9 (long
term), 2-10 (short term) Max linear flow rate: 300cm/h, Ligand: recombinant Protein G
covalently coupled by cyanogen bromide to highly cross-linked 4% agarose beads. To order Protein G & Protein A see Chapter Biochemicals. Store: 4°C SF022-PG
T
Protein G Sefinose Resin
(settled) 1ml
Store: 4°C
1 ml 5 ml
BSP031
GST Sefinose 4 Fast Flow
BSP031-1
Supplied as a slurry in 20% ethanol Used to purify GST-tagged recombinant and other glutathione
5 ml 25 ml
binding proteins proteins. Features (1) High binding capacity. Its capacity is >10 mg recombinant GST/ml medium (2) Low nonspecific binding (3) Simple procedure. Technique information: Capacity: 10 mg recombinant GST/ml Particle size: 45-165 um; Matrix : Highly cross-linked agarose, 4%; pH stability 3-11. Store: 4°C.
Heparin-Sefinose Resin Supplied as a slurry in 20% ethanol Ideal for affinity purification of coagulation factors such as antithrombin III, DNA binding proteins, restriction endonucleases, lipases, growth factors, lipoproteins and steroid receptors. Affinity matrix with immobilized heparin (from porcine) by CNBr activation coupling method. The Heparin Sefinose Resin is reusable for multiple times. Technique information: Capacity: > 0.5 mg/mL binding capacity (thrombin) Particle size: 40-130 um; Matrix : Highly cross-linked agarose, 6%; pH stability 3-9 (long
term), 2-10 (short term) The resin has a 15 carbon spacer arm Store: 4°C
BSP094-1
Heparin-Sefinose Resin ( settled)
5ml
BSP094-2
Heparin-Sefinose Resin ( settled)
25ml
BSP093-2
Heparin-Sefinose Resin Column ( Gravity column) 10X1ml
10
BSP093-4
Heparin-Sefinose Resin Column ( Gravity column) 10x5ml
10
BSP093-6
Heparin-Sefinose Resin Column ( Gravity column) 10x10ml
10
Protein De-salting TX0111
Economic Dialysis bag MWCO 14,000 Dalton Width 34mm
Length 2m
TX0112
Economic Dialysis bag MWCO 14,000 Width 44mm
Length 2m
TX0113
Economic Dialysis bag MWCO 14,000 Width 77mm
Length 2m
BSP089
Gravity column De-Salting
1 column
Dextran Desalting Columns are ready-to-use and disposable desalting columns. Molecules greater than 5,000 MW will emerge in the void volume, separating them from smaller molecular weight buffer salts and reagents. A buffer exchange can also be accomplished by first equilibrating a column with the desired buffer, then applying sample. Molecules greater than 5,000Da would be exchanged into the desired buffer. These columns are prepacked with cross-linked dextran. These columns display excellent chromatographic properties and have
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
256
2015-2016
Recombinant Proteins & Protein Related Products
Product Catalog
good rigidity for easy handling and good flow properties.The Dextran Gel is stable, easy to use and provides excellent sample recoveries. The gel can withstand water, salt solutions, organic solvents, alkaline and weakly acidic solutions. It is stable to heat and can be autoclaved dry or heated at 120°C in solution of neutral pH for 30 minutes without affecting its chromatographic properties. The desalting process or buffer exchange can therefore be performed in less than one hour. The column displays unique stop-flow characteristics which prevents drying of the gel and loss of precious samples. Recoveries of 90% or greater can be expected, assuming that the desalting buffer does not enhance nonspecific binding between the protein and the matrix. Characteristics Total Column volume
—
Recommended Sample Gel bed volume
—
10.0 ml —
about 0.25-0.3 ml
2.5 ml
Void Volume (~1/3 gel volume)
—
0.9 ml
Exclusion Limit (for globular proteins) Wet Bead Diameter
BSP012
—
—
5,000 daltons
50-150 microns
100preps
Universal Protein Precipitating Reagent The reagent is optimized for concentration of dilute ( >1ng/ml) protein solution. The concentration of proteins is not affected by chaotropes, detergents, inorganic & organic salts and other reagents. The concentrated proteins can be used for 1 D gel electrophoresis, protein purification and assays. the kit can be used for >10ml of protein solution. Store at RT.
BSP011
50 preps
TCA (Trcichloroacetic Acid) Precipitating Protein Kit Designed for the concentration, desalting and purification of proteins by TCA precipitation. The procedure is simple and rapid. Solubilized protein in diluents of your choice can be used for electrophoresisor any number of applications. The components contains (1) Trichloroacetic Acid 100% (6.1 N) and Deoxycholate Solution (2) Wash Solution,(3) dissolution buffer. The kits are sufficient for 50 x0.2ml sample. Store: 4°C
Protein Stains Solutions Bio Basic Inc. offers a wide selection of protein staining solutions-Protein Stain-EZ . For solid protein staining & nuclei acids staining reagents see Chaper-Biochemicals SK3011
Protein Stain-EZ A Ultra-Sensitive Coomassie Blue Stain Solution, 1XStrength Solution
10minigel
Features: (1) Compared with the regular Coomassie blue stain, this product is more sensitive. 4-8 ng protein per lane can be detected. (2) Fast. Band develops within 3-10 minutes. (3) No methanol, acetic acid and other toxic agents are used. (4) Suitable for SDS-PAGE, native PAGE, 2D gels and isoslectric focusing. Store: RT CB0038 Store: 2~8°C
Coomassie brilliant blue G-250(Acid blue 90; Brilliant blue G-250) Stain reagent, Purple to brown crystal or powder, C47H48 N3O7S2Na
MW 854.04
Purity >90%, Em (595 nm,
(6104-58-1)
H2O): >36,300,λmax: 610nm,Soluble in ethanol and hot water.
CB0037
Coomassie brilliant blue R-250 (Acid blue 83; Brilliant blue R-250)
Store RT (6104-59-2) BSP019
crystal or powder,
C45H44 N3O7S2Na
25 g 100 g
Stain reagent, Purple
5 g
MW 825.99. Purity >90%, Em (550 nm, H2O): >33,000.
25 g
Slightly soluble in ethanol and hot water. Protein Stain-EZ B, Reversible Zinc Stain Kit
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
1 kit
257
2015-2016
Recombinant Proteins & Protein Related Products
Product Catalog
Protein Stain-EZ B, as a reversible zinc stain is based on the interaction of zinc ions with polyacrylamide and proteins. Features: (1) Fast, it takes 10-15 minutes (2) Sensitive. The sensitivity is near same as silver stain. (3) Versatile: Suitable for native-PAGE and SDS-PAGE. (4) Compatible with many other applications such as protein elution, blotting, sequencing and mass spectroscopy. One kit is for 10 minigels. Store: RT BSP017
1 kit
Protein Stain-EZ C, Reversible Copper Stain Kit Protein Stain-EZ C, as reversible copper stain is based on the interaction of copper ions with polyacrylamide and proteins. Features: (1) Fast, it takes 30 minutes (2) One step staining (3) Sensitive. 0.1-0.5 ng of protein can be detected (4) Suitable for native-PAGE, SDS-PAGE (5) Compatible with many other applications such as protein elution, blotting, sequencing and mass spectroscopy (6) No destaining is necessary. One kit is for 10 minigels. Store: RT
BSP041
10
Protein Stain-EZ G Rapid Coomassie Blue Stain Solution, 1XStrength Solution
minigel
Features: (1) Compared with the regular Coomassie blue stain, this product is more sensitive. 5-10 ng protein can be detected. (2) Fast. Band develops within 20 minutes. (3) No fixation is required. Store: RT. BSP043
2x10 minigel
Protein Stain-EZ J Phosphoprotein Staining Kit Protein Stain-EZ J is suitable for detecting phosphoprotein in SDS-PAGin gels. Phosphoproteins stain in-gel as green to-green-blue bands. The sensitivity depends on phosphate contents of the phosphoprotein. Generally > 50ng of phosphoprotein per band can be detected. The kit is sufficient for 20 mini-gels. Store: 4°C.
Western Blocking & Western Blotting Agents PD0100
PBS ( Phosphate Buffered Saline) Powdered
Store: 2~8°C
pH (1% water)=7.3-7.5
Biotech Grade. White powder..
1 pk
1 x PBS solution contains 137 mM NaCl, 2.7mM KCl and 10mM
Phosphate Buffer. Each pack makes 1 L of 10 concentrated PBS or 10 liters of 1 x solution PD0435
PBS (Phosphate buffered saline)150 ml tablets
Store: 2~8°C
1 Tablet prepares 150ml of PBS, 1 x PBS solution contains: Sodium Chloride: 137mM
150ml /Tab Biotech Grade
50 T
Phosphate Buffer: 10mM. Potassium Chloride: 2.7mM. pH (1 Table/150ml Water): 7.3-7.5. SB0625 Store RT
PBS Blocking Buffer with Non-Fat Milk Premixed Powder Used for immunodetection assays
1pk
such as Western blots, dot blots and ELISA. 1 pack will make 1 liter of 1X stremgth blocking solution contain 5% Non-Fat Milk. Store: 4°C
SB0626 Store C
PBS Blocking Buffer with BSA Premixed Powder in PBS Used for immunodetection assays
1pk
such as Western blots, dot blots and ELISA. 1 pack will make 1 liter of 1X stremgth blocking solution contain 3% BSA. Store: 4°C
A0025
TBS buffer (Tris-Buffered Saline)
Store:
Each prepares 2L of 10x concentrate. Or 20 liters of 1x TBS 1XTBS A single strength contains:
2~8°C
Premix powder, Biotech Grade.
1 pk(2L)
Tris: 0.25M, NaCl: 0.14M, KCl: 0.003M pH 7.40 ( 7.25-7.55)
A0027
TBS buffer (Tris-Buffered Saline)
Store:
A single strength contains: Tris: 0.25M, NaCl: 0.14M, KCl: 0.003M
10x Solution , Biotech Grade.
4L pH 7.40 ( 7.25-7.55)
2~8°C SD8113
TBS Blocking Buffer with BSA Premixed Powder
1pk
Used for immunodetection Assays such as Western blots, dot blots and ELISA. 1 pack will make 1 liter of 1X strength blocking solution contain 3% BSA. Store: 4°C SD8104
TBS with Non-Fat Milk Premixed Powder
1pk
Used for immunodetection Assays such as Western blots, dot blots and ELISA. 1 pack will make
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
258
2015-2016
Recombinant Proteins & Protein Related Products
Product Catalog
1 liter of 1X strength blocking solution contain 5% Non-Fat Milk. Store: 4°C SD6044
Tris-Caps Transfer Buffer Solution 1x Strength Solution Two Components
1L
Anode buffer: 500ml: 60 mM Tris, Caps 40 mM, Methanol 15%, pH: 9.6. Cathode buffer: 500 ml, 60 mM Tris, Caps 40 mM, SDS 0.1%, p H 9.5 PW004
2x500ML
PBST buffer 10x Strength Solution Used for immunodetection Assays such as Western blots, dot blots and ELISA. 1 x PBST solution contains 137 mM sodium chloride, 2.7mM potassium chloride , 10mM Phosphate Buffer (pH =7.0-7.6) and 0.05% Tween-20
PW009
500ML
TBST buffer 10x Strength Solution Used for immunodetection Assays such as Western blots, dot blots and ELISA. Working solution will contain 10mM Tris, 150mM NaCl and 0.05% Tween-20 (V/V), pH 7.0-7.6.
Western Blotting Stains Bio Basic Inc. offers a wide selection of Western blotting stains & Protein Stains. The below stains are the Western Blotting Solutions. Protein Stains Solution can be seen at Protein Stains Section. For more solid protein stains see Chapter Biochemicals. A0298
Alcian blue 8GX Reagent Grade
5g
Store RT
Dark blue powder C56H68N16S4Cl14Cu MW 1298.88 Used to stain glucosaminoglycans
25 g
and other acidic polysaccharides in tissue samples. Em (610nm, water):>26,000., Soluble in water AD0027 Store: 2~8°C (1064-48-8)
Amido black 10B
Black & brown powder. Used for staining protein
C22H14N6O9S2Na2 MW 616.50, Dye content >80%, Lose on drying 99%, Water98%, mp: 240°C(dec), Residue on ignition 99%(tlc) , mp: 168-171 °C, Lose on drying 99.0% mp: 120-121°C,
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
260
2015-2016
Recombinant Proteins & Protein Related Products
Product Catalog Very soluble in ethanol, ether, chloroform. BSP025
10 blots
Protein Stain Kit for Transfer Membrane Ideal for stain for reversibly staining protein on Nitrocellulose, and PVDF membranes.Features: (1)Double stain procedure, Low background (2) Fast. The procedure takes 20 minutes (3) Sensitive 5ng of protein can be detected (4) Reversible. Destain the membrane by simply rinsing in warm water for 10 minutes. After destaining protein bands can be probed with Western blot protocols and other analysis. (5) Staining & destaining does not affect the biological properties of the protein The kit is sufficient for 10 blots. Store: 4°C
Blotting Membranes & Blotting Papers NT020S1
Nitrocellulose Membrane 0.22um
5(20x20cm)
As an unsupported nitrocellulose and is the membrane of choice for all protein or immunoblotting. High binding at nearly equal to 100`g/cm2. QL020S0
PVDF membranes 0.2um
5(20X20cm)
Suitable for Western Blotting. Membrane material:100% PVDF D0156-1
TotalBlot PVDF membranes Pore Size
D0156-2
Hydrophobic polyvinylidene fluoride membrane well suited for Western protein transfers.
D0156-2
membranes must be wetted with 100% methanol before use.
1(30cmx3m)
D0157-1
TotalBlot Nylon membranes
5(15x15cm)
D0157-2
Positively charged nylon membrane for protein and nucleic acid blotting applications. They are 10(10x10cm)
D0157-3
naturally hydrophilic nylon membranes with high binding capacity that do not require
5(15x15cm) The 10(10x10cm)
1(30cmx3m)
pre-wetting before use. The membranes are mechanically strong and resistant to tearing or cracking, making removal form agrose gels particulary easy. Blotting papers See Chapter Labwares P
Biological Detergents, Detergent Assays and Detergent-Removal Ionic, Nonionic, & Zwitterionic Detergents Bio Basic Inc. offers a wide selection of biological detergents including ionic, nonionic, & Zwitterionic detergents. For detail information and pricing of these detergents see Chapter Biochemicals B0217
Brij 35 (Polyoxyethylene (23) lauryl ether) Proteomic Grade C2H4O)nC12H26O
Store RT
bp: 100°C , Residue on ignition 100 samples within Canada/USA. If there is no distributor in your country, you may contact a distributor near your country or Bio Basic Inc. directly.
Contact Us Phone
905-474-4493 or 1-800-313-7224
Fax
905-474-5794
Email
[email protected] [email protected]
Web
www.biobasic.com
Mail
20 Konrad Cres Markham, ON L3R 8T4 Canada
Samples
Free Shipping if >100 Samples (Canada/USA only)
Universal Primers Universal Primer M13 Forward M13 Reverse pGEX 3' pGEX 5' SP6 T3 T7 (short) T7 (long) T7 terminator
Sequence GTAAAACGACGGCCAGT CAGGAAACAGCTATGAC CCGGGAGCTGCATGTGTCAGAGG GGGCTGGCAAGCCACGTTTGGTG ATTTAGGTGACACTATA ATTAACCCTCACTAAAG AATACGACTCACTATAG AATACGACTCACTATAGgg GCTAGTTATTGCTCAGCGGT
Sequencing Reports 1.Sequencing report Format
(1) (2) (3) (4)
Original ABI format of ~700bp sequencing chromatogram Text file of the DNA Sequence Summary of Report All results are sent electronically
2. View results
(1) (2) (3) (4)
Download Chromas from www.biobasic.com Double click Chromas and open ABI file from Chromas Export text file from Chromas Sequences between 60bp to 500bp are most reliable region. To obtain reliable reads, it is highly recommended to perform double stranded sequencing using reverse primers as a good laboratory practice.
3.No report
(1) Samples fail to pass incoming QC (2) Sample with no readable signal 4.Charges on sequences with structures
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
341
Standard DNA Sequencing Services
2015-2016 Product Catalog
Standard charge applies even if sequences are not “clear” due to known structures including Poly N,GC, inverted repeats direct repeats etc. 5.Charges on mixed peaks Most “mixed” peaks are results from “mixed” templates (see below Q&A). Standard charge applies. 6.Sample Storage All samples are kept at Bio Basic Inc. for 2 months. During this period, customer may request additional After 2 months, the samples are automatically destroyed without further notification.
sequencing service.
Check List Before Sending Samples Template
Requirements
Crude PCR Products
1.
PCR product > 200bp
2.
Concentration of PCR product should be >30ng/l and volume 1ug-2ug.
3.
Take 2-3ul samples, a single band of final PCR product should be detected on gel.
4.
Specific primers are to be provided by customer.
5.
To avoid cross contaminations during shipment, please make sure you use a tight-fit lid when shipping samples in 96-well format. Alternatively, samples can be delivered in 8strip PCR tubes.
Purified PCR Product
1. Dissolve final PCR product in ddH2O (Please do not use TE). 1. Concentration of PCR product should be >30ng/l and volume >10l. For PCR product >2kb, more DNA may be required for sequencing. 2. A single distinct band of final PCR product should be detected on gel. If smearing or multiple bands are seen, you may receive poor or no readable sequencing data. 3. Specific primers are to be provided by customer. 4. To avoid cross contaminations during shipment, please make sure you use a tight-fit lid when shipping samples in 96-well format. Alternatively, samples can be delivered in 8-strip PCR tubes.
Purified Plasmid DNA
1. Dissolve purified plasmid DNA in 30~50l ddH2O (Please do not use TE). 1. Concentration of plasmid should be >100-200ng/l; 2. It is recommended to use molecular biology kit to purify plasmid DNA rather than ethanol precipitation. 3. Specific primers are to be provided by customer. 4. To avoid cross contaminations during shipment, please make sure you use a tight-fit lid when shipping samples in 96-well format. Alternatively, samples can be delivered in 8-strip PCR tubes.
Bacteria
1. Please indicate antibiotic resistance for desired bacteria strain. Bio Basic Inc. offers services of DNA extraction from Amp, Kan, Tet and Chl. All other antibiotics are to be provided by customer with instruction manuals. 1. Bio Basic Inc offers DNA extraction from high copy plasmid. For low copy plasmid bacteria, please send ~10g purified DNA. 2. Please provide 1mL overnight culture or 15% glycerol stock. Please send bacterial samples in individual Eppendorft tubes with openings securely sealed. 3. For large sample size, we recommend Ecoli stab in 96-well plate. This is to avoid cross contamination between samples during shipment.
Specific Primers
1. Concentration of primers should be >5pmol/l( or 5umol/L) and volume > 20-50l. Please mark primer concentration clearly. 2. Random primers and/or primers 2kb, we recommend to first sub-clone it into a vector. The insert is more stable in a vector and sequencing results will be easier to achieve. Q:I have a mixed base pair in a position, how come I do not see the mixed base in the report? A:When preparing the report, Bio Basic Inc. assumes each sequencing sample is from a pure single population rather than mixed. Based on this assumption, the higher/stronger peak is being reported and lower/weaker peak being treated as background. If your sample contains a mixed population, please kindly notify us. Q:The bands are present and strong, but irregularly spaced, or with mixed colors. The technician may have reported "superimposed sequences" or used the phrase "peaks on peaks"? A: If you see this, you usually have two sequences superimposed on each other. There are several common causes:
The sequencing primer binds to two (or more) sites on the template. There are two (or more) templates present. This was a PCR reaction, and you didn't remove the original primers. This was a PCR reaction, and one primer generated *both* ends. This was a PCR reaction, and there is more than one amplified species present.
Here's an example of 'mixed peaks' such as might arise from two or more unrelated templates:
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
343
2015-2016 Product Catalog
Standard DNA Sequencing Services
Another example, this time with templates that might be related. Note the alignment of the peaks:
Q:Your sequence proceeds normally, then the bands abruptly become much smaller Secondary structure in the template is the most likely cause of this problem. The polymerase is presumably unable to progress through some stem-loop form. A couple possible solutions: (i) try re-sequencing by selecting 'siRNA construct' as your DNA type, (ii) try to sequence from another primer at a different position (closer or further); (iii) sequence the other strand. We maybe able to use special cycling conditions and/or special reagents that help the polymerase to push through this region. We cannot do this routinely, as it involves extensive optimizations. Here's an example of a secondary structure effect:
Q: Your sequence proceeds normally, then the bands abruptly vanish. This usually happens when the template DNA has simply stopped, for example if it was restricted at a downstream site or if the template was a PCR product. This may also be caused by an extremely stable secondary structure. Q: The sequence looks great until it hits a polyA (or polyT), and then the bands rise and fall in waves. This is called "polymerase slip". It happens when the growing strand temporarily dissociates from the template, then reassociates at a different spot - say, one nucleotide forward or back from where it started. If this happens often enough (as it will on polyA or polyT templates), every individual band becomes a family of closely-spaced peaks giving a 'roller coaster' look to the chromatogram. Try sequencing in the other direction from the opposite strand, or try another primer either closer or further from the homopolymer region.
The following is an excellent example of 'polymerase slip' on a homopolymeric tract:
Q:You offer 24hr to 48hr service, but it has been 2 days and I still have not received data?
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
344
2015-2016 Product Catalog
Standard DNA Sequencing Services
A:24hr to 48hr is AFTER we receive the samples at Bio Basic Inc. If you have more than 5 plates, longer turnaround is expected.
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
345
2015-2016 Product Catalog
Standard DNA Sequencing Services Terms and Conditions
Terms Bio Basic Inc. will send electronically DNA sequencing results to customers. All results will be kept in Bio Basic Inc.’s data base for 6 months. During this period, customer may request sequencing results. After 6 months, DNA sequencing results are automatically destroyed without further notification. DNA sequencing tests are not considered confirmed without the customer providing a P.O. number or credit card number. Bio Basic Inc. accepts credit card (Visa or MasterCard), cheque or wire for payment.
Turnaround Bio Basic Inc. will make its best effort to send DNA sequencing results within 48 hours. For Larger projects, time will vary depending on the size of the project. We try our best to accommodate special time constraints whenever possible, and projects of more than one hundred reactions may still get 24-48 hours turn around. Mail-in samples need to be received before 12.00 noon time to catch the same day run (results available the next day). If you are using FedEX, priority overnight arrives here each day at around 11:00 am.
Cancellations Buyer may not cancel any order or return any samples without Bio Basic Inc.’s consent. Cancellation and return charges may be charged. Buyer must contact Bio Basic Inc. to obtain a return material authorization number.
Warranty Bio Basic Inc. guarantees > 650bp Q20 read length and more than 90% successful rate. Bio Basic Inc. does not guarantee any downstream application(s) or usage of the DNA sequencing results. Any claims or dispute must be submitted within 2 weeks of the results being sent. At the time of shipment, Bio Basic Inc. keeps a database for unexpected incidents and/or disputes. Bio Basic Inc. reserves the right to refuse handling disputes after a period of 3 months.
Prices Bio Basic Inc. unit prices for DNA sequencing tests apply only to the specific quantity, sample purification and primer synthesis. All prices are subject to correction of errors; Bio Basic Inc. reserves the right to adjust prices on orders during production due to changes in cost of materials, transportation or wages. Any tax, customs, surcharge or duty, howsoever denominated, imposed upon the sale, importation, delivery or use of products shall be the responsibility of the Buyer.
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
346
2015-2016
Protein Purification Services
Product Catalog
CUSTOM PROTEIN SYNTHESIS Bio Basic Inc has quickly become a world leader in custom protein purification. Our team of professionals have over 20 years of experience in the biotech and pharmaceutical industry. With this experience, we have the knowledge to successfully purify almost any protein. In combination with our oligo synthesis, DNA sequencing and gene synthesis services, we can take your project from DNA sequence to the final purified product.
About Protein Purification: Recombinant proteins are used throughout a wide spectrum of biomedical research. Large quantities of purified proteins can be used to conduct many downstream experiments, such as enzyme kinetics, functional and structural studies, and interaction assays. There are two main systems for the expression of recombinant protein - prokaryotic and eukaryotic. Prokaryotic recombinant protein expression systems (E.Coli) have several advantages, including ease of culture, rapid cell growth, and relatively simple purification procedures. However, most post-translational modifications are not added by bacteria, and some proteins can form insoluble, inclusion bodies and are difficult to recover as functional proteins. Eukaryotic systems for the expression of protein include yeast, baculovirus cells, and mammalian cells. Advantages of these systems include high levels of expression, no inclusion bodies, and intact posttranslational modifications.
Project Overview:
E. coli Expression Escherichia coli (E. coli) is one of the most widely used hosts for the production of heterologous proteins. E. coli expression has been well characterized and protocols have been established for protein re-folding and purification. Bio Basic Inc. is pleased to offer 5 mg and 15 mg Guaranteed Packages, as well as the native, intact protein package. As with any of our services, packages can also be customized for each project. If you require services not listed, please feel free to contact us at anytime for a quote. Package Guaranteed Package- 5 mg Includes: Sub-cloning Expression optimization Protein amplification and purification QC by SDS-PAGE and Western Blot Guaranteed Package- 15 mg Includes: Sub-cloning Expression optimization Protein amplification and purification QC by SDS-PAGE and Western Blot Intact Native Protein Package- 5 mg Includes:
Deliverables
5 mg of purified protein from the E. coli expression system
QC results
15 mg of purified protein from the E. coli expression system
QC results
5 mg of the protein in its native form
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
346
2015-2016 Product Catalog
Protein Purification Services
Sub-cloning Expression optimization Protein amplification and purification Tag removal QC by SDS-PAGE and Western Blot
A Guarantee of no Tag, 90- 95% purity and an endotoxin level of 1:100,000 and positive dot blot results against the immunogen. Bio Basic also guarantees that at least 1 clone will work in client's own experiment system (western blot or ELISA).
Provided by Customer
1. Name, species, sequence, and NCBI Number for target protein OR 2. Protein antigen with < 60% homology to mouse isoform
Service Protocol
1. Antigen design and production or QC client's antigen 2. Immunize 3 Balb/c mice 3. Fusion and ELISA screening 4. Sub-cloning (2-4 rounds) 5. Antibody production 6. Antibody validation
Project Info Provided
For each cell line: 1. Epitope and affinity data (if available) 2. ELISA and dot blot data on immunogen
Deliverables
First shipment: The supernatant of 10 ELISA positive cell lines. Second shipment: 1 hybridoma cell line with 2 mg purified antibody.
Timeline
14-18 weeks from antigen synthesis/QC to sample delivery
Payment Policy
Client shall pay 50% of price before project initiation. Client shall pay remaining balance upon project completion. If project fails, a set up fee applies.
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
353
2015-2016 Product Catalog
Custom Antibody (Poly & Monoclonal) Services
MonoBasic Omni-Application Package (Mono-Omni-1)
Package Name
MonoBasic Omni-Application Package
Package Code
Mono-Omni-1
Guarantee
Bio Basic guarantees to generate at least 10 clones with ELISA titer > 1:100,000 and positive Dot Blot results against the immunogen. Bio Basic also guarantees that at least 1 clone will work in client's own experiment system.
Provided by Customer
1. Name, species, sequence, and NCBI Number for target protein 2. Full length cDNA plasmid
Service Protocol
1. Antigen design and production 2. Immunize 3 Balb/c mice 3. Fusion and ELISA screening 4. Sub-cloning (2-4 rounds) 5. Antibody production 6. Protein G affinity purification 7. Antibody validation
Project Info Provided
For each cell line: 1. Comprehensive validation data on over-expressed protein, including ELISA, WB, IP and IF data. 2. Epitope and affinity data (if available) 3. ELISA and dot blot data on immunogen
Deliverables
First Shipment: the supernatant of 10 ELISA positive cell lines. Second Shipment: 1 hybridoma cell line with 2 mg purified antibody.
Timeline
14-18 weeks from antigen synthesis to sample delivery
Payment Policy
Client shall pay 30% of price before project initiation. Client shall pay remaining balance upon confirmation that a qualified clone works in their experimental system. If project fails, a set up fee applies.
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
354
2015-2016 Product Catalog
Custom Antibody (Poly & Monoclonal) Services
MonoBasic Guaranteed Phospho-Specific Package (Mono-Phos-1) Package Name
MonoBasic Guaranteed Phospho-Specific Package
Package Code
Mono-Phos-1
Guarantee
Bio Basic guarantees to generate at least 1 clone that is dot blot-positive against the peptide and has an ELISA titre > 1:50,000, and a modified/unmodified titer ratio > 8.
Provided by Customer
1. Name, species, sequence, and NCBI Number for target protein; 2. Information of modification site
Service Protocol
1. Peptide design, synthesis and conjugation, including the modified peptide and unmodified control peptide (additional fee req.) 2. Immunize 3 Balb/c mice 3. Fusion and ELISA screening 4. Sub-cloning (2-4 rounds) 5. Antibody production 6. Protein G affinity purification 7. Antibody validation
Project Info Provided
ELISA and dot blot data against modified and unmodified peptides
Deliverables
First Shipment: Supernatants of ELISA-positive hybidoma clones for customer’s assay testing (50 μl each) 1 mg of modified peptide 1 mg of unmodified peptide Second Shipment: 1 hybridoma cell line with 2 mg purified antibody
Timeline
16-20 weeks from antigen synthesis to sample delivery
Payment Policy
Client shall pay 50% of price before project initiation. Client shall pay remaining balance upon confirmation that shipped antibodies work in their experimental system. If project fails, a set-up fee applies.
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
355
2015-2016 Product Catalog
Custom Antibody (Poly & Monoclonal) Services
PolyBasic Antibody Service Polyclonal antibodies (pAbs) are immunoglobulins that are obtained from different B-lymphocytes. PAbs exist as a heterogeneous mixture of antibodies with differing antigen affinities in serum. They recognize multiple epitopes on any one antigen. Due to their diverse affinities for the same immunogen, pAbs are not practical for quantification techniques such as flow cytometry, but excel for applications such as ELISA, dot blot, western blot, immunoprecipitation and ChIP assays. PAbs can also be used to detect proteins of high homology to the immunogen or target protein they were raised against in different species; this makes them fairly versatile. In addition, pAbs are less expensive to generate compared to mAbs and can be produced as quickly as 30 days after immunization depending on the nature of the antigen. Bio Basic’s Polyclonal Antibody Service is designed to supply you with custom, affinity purified pAbs that are guaranteed to detect your antigen of choice using ELISA (titer > 1:50,000) and dot blot assays. Bio Basic Inc. also provides packages which guarantee pAbs that will work in your assay of choice for the ultimate peace of mind. Our peptide-supplied and protein-supplied packages are equipped to handle any antigen; our experienced scientists will conjugate your peptide and subject your protein to rigorous quality control prior to immunization to optimize serum antibody yield. Explore Bio Basic’s custom polyclonal antibody packages today and begin a partnership that will guarantee results!
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
356
2015-2016 Product Catalog
Custom Antibody (Poly & Monoclonal) Services
PolyBasic Standard Peptide Package (Poly-Pep-Stan)
Package Name
PolyBasic Standard Peptide Package
Package Code
Poly-Pep-Stan
Guarantee
Bio Basic guarantees to generate antibodies that are dot blot-positive against the peptide and have an ELISA titre > 1:50,000.
Provided by Customer
Name, species, sequence, and NCBI Number for target protein
Service Protocol
1. Peptide design, synthesis and conjugation (additional fees required) 2. Immunize 2 New Zealand Rabbits 3. Serum collection 4. Protein A or G affinity purification 5. Antibody validation
Project Info Provided
ELISA and dot blot data against peptide
Deliverables
20-50 ml/rabbit antiserum All purified antibody (at least 2 mg) 1 mg peptide
Timeline
8-10 weeks from antigen synthesis to sample delivery
Payment Policy
Client shall provide full payment before project initiation.
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
357
Custom Antibody (Poly & Monoclonal) Services
2015-2016 Product Catalog
PolyBasic Guaranteed Peptide Package (Poly-Pep-Guar)
Package Name
PolyBasic Guaranteed Peptide Package
Package Code
Poly-Pep-Guar
Guarantee
Bio Basic guarantees to generate antibodies that are dot blot-positive against the peptide and have an ELISA titre > 1:50,000. Bio Basic also guarantees that the antibody will work in the client’s experimental system.
Provided by Customer
Name, species, sequence, and NCBI Number for target protein
Service Protocol
1. Peptide design, synthesis and conjugation (additional fees required) 2. Immunize 2 New Zealand Rabbits 3. Serum collection 4. Antigen affinity purification 5. Antibody validation
Project Info Provided
ELISA and dot blot data against peptide First Shipment: Dot blot and ELISA-positive samples (50 μl each) 1 mg peptide
Deliverables Second Shipment: All purified antibody (at least 2 mg) 20-50 ml/rabbit antiserum Timeline
8-10 weeks from antigen synthesis to sample delivery
Payment Policy
Client shall pay 50% of price before project initiation. Client shall pay remaining balance upon confirmation that shipped antibodies work in their experimental system. If project fails, a set-up fee applies.
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
358
2015-2016 Product Catalog
Custom Antibody (Poly & Monoclonal) Services
PolyBasic Standard Protein Package (Poly-Pro-Stan)
Package Name
PolyBasic Standard Protein Package
Package Code
Poly-Pro-Stan
Guarantee
Bio Basic guarantees to generate antibodies that are dot blot-positive against immunogen and have ELISA titre > 1:50,000.
Customer to Provide
Protein antigen
Service Protocol
1. QC client's antigen 2. Immunize 2 New Zealand Rabbits 3. Serum collection 4. Protein A or G affinity purification 5. Antibody validation
Project Info Provided
ELISA and dot blot data against immunogen
Deliverables
20-50 ml/rabbit antiserum All affinity purified antibody (from 30-50ml antiserum) (at least 2mg) 1 mg protein
Timeline
10-12 weeks from antigen synthesis to sample delivery
Payment Policy
Client shall provide full payment before project initiation.
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
359
2015-2016 Product Catalog
Custom Antibody (Poly & Monoclonal) Services
PolyBasic Guaranteed Protein Package (Poly-Pro-Guar)
Package Name
PolyBasic Guaranteed Protein Package
Package Code
Poly-Pro-Guar
Guarantee
Bio Basic guarantees to generate antibodies that are dot blot-positive against the peptide and have an ELISA titre > 1:50,000. Bio Basic also guarantees that the antibody will work in client’s experimental system.
Provided by Customer
Protein antigen
Service Protocol
1. QC client's antigen 2. Immunize 2 New Zealand Rabbits 3. Serum collection 4. Antigen affinity purification 5. Antibody validation
Project Info Provided
ELISA and dot blot data against immunogen First Shipment: Dot blot and ELISA-positive samples (50 μl each) 1 mg protein antigen
Deliverables Second Shipment: All purified antibody (at least 2 mg) 20-50 ml/rabbit antiserum Timeline
10-12 weeks from immunization to sample delivery
Payment Policy
Client shall pay 50% of price before project initiation. Client shall pay remaining balance upon confirmation that shipped antibodies work in their experimental system. If project fails, a set-up fee applies.
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
360
2015-2016 Product Catalog
Custom Antibody (Poly & Monoclonal) Services
PolyBasic Standard Phospho-Specific Package (Poly-Phos-Stan)
Package Name
PolyBasic Standard Phospho-Specific Package
Package Code
Poly-Phos-Stan
Guarantee
Bio Basic guarantees to generate antibodies that are dot blot-positive against the peptide and have an ELISA titre > 1:50,000, and a modified/unmodified titer ratio > 8.
Provided by Customer
1. Name, species, sequence, and NCBI Number for target protein; 2. Information of modification site
Service Protocol
1. Peptide design, synthesis and conjugation, including the modified peptide and unmodified control peptide (additional fee req.) 2. Immunize 4 New Zealand Rabbits 3. Serum collection 4. Antigen affinity purification and cross-reactivity reduction 5. Antibody validation
Project Info Provided
ELISA and dot blot data against modified and unmodified peptides
Deliverables
All purified antibody (at least 1 mg) 1 mg modified peptide 1 mg unmodified peptide
Timeline
10-12 weeks from antigen synthesis to sample delivery
Payment Policy
Client shall provide full payment before project initiation.
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
361
2015-2016 Product Catalog
Custom Antibody (Poly & Monoclonal) Services
PolyBasic Guaranteed Phospho-Specific Package (Poly-Phos-Guar)
Package Name
PolyBasic Guaranteed Phospho-Specific Package
Package Code
Poly-Phos-Guar
Guarantee
Bio Basic guarantees to generate antibodies that are dot blot-positive against the peptide and have an ELISA titre > 1:50,000, and a modified/unmodified titer ratio > 8. Bio Basic also guarantees antibody will work in client’s experimental system.
Provided by Customer
1. Name, species, sequence, and NCBI Number for target protein; 2. Information of modification site
Service Protocol
1. Peptide design, synthesis and conjugation, including the modified peptide and unmodified control peptide (additional fee req.) 2. Immunize 4 New Zealand Rabbits 3. Serum collection 4. Antigen affinity purification and cross-reactivity reduction 5. Antibody validation
Project Info Provided
ELISA and dot blot data against modified and unmodified peptides
Deliverables
First Shipment: Dot-blot and ELISA positive samples (50 μl each) 1 mg modified peptide 1 mg unmodified peptide Second Shipment: All purified antibody (at least 1 mg) Sample antiserum 20-50 ml/rabbit
Timeline
10-12 weeks from antigen synthesis to sample delivery
Payment Policy
Client shall pay 50% of price before project initiation. Client shall pay remaining balance upon confirmation that shipped antibodies work in their experimental system. If project fails, a set-up fee applies.
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
362
Custom Antibody (Poly & Monoclonal) Services
2015-2016 Product Catalog
Terms and Conditions 1. Description of Services and Fees Bio Basic Inc. agrees to provide the customer detailed materials, application guarantees, technical design information, antibody production schedules and project deliverables as specified in the Sales Order. The customer agrees to pay Bio Basic fees for the services provided according to the service packages and any additional services that may be required.
2. Materials and Information The customer will provide Bio Basic Inc. with sufficient amounts of materials such as antigens, samples, or other substances required to complete the project as outlined in the Sales Order. Additionally, the customer will provide comprehensive data or relevant information as requested by Bio Basic Inc. to aid in completion of the project. Unless otherwise requested by the customer, upon completion of the custom antibody project any material materials that were provided by the customer will be destroyed.
3. Deliverables and Payment Bio Basic Inc. will ship the agreed-upon quantity of deliverables as defined in the Sales Order to the customer. All deliverables are internally quality controlled to meet the standards as defined in the Sales Order. Final purified antibody will be shipped as a lyophilized powder. Along with the previously-agreed upon deliverables, Bio Basic Inc. will provide related quality documentation as outlined in the Sales Order. All documentation will be sent in hard copy with the final product and electronically via email. No custom antibody service project is initiated without a purchase order or credit card number. Bio Basic Inc. accepts purchase order, credit card (Visa or MasterCard), cheque or wire as payment methods. Credit card payments are subject to a 2.5% processing fee. Payment term is net 30 days. Unless stated otherwise in the Sales Order, a 50%, non-refundable, start up fee is required upon project initiation. Unless stated otherwise in the Sales Order, if the contracted products are not delivered or are found to not meet the standards set forth in the Sales Order, Bio Basic Inc. will refund the customer in full minus any applicable set-up fees.
4. Timeline Prior to the initiation of the custom antibody project, Bio Basic Inc. will provide the customer with an estimate of project milestone dates in the Sales Order. Bio Basic Inc. will make its best effort to ship the customer deliverables according to such schedule outlined in the Sales Order. However, the schedule as specified in the Sales Order is an estimate and the actual time may vary depending on the project. If an unexpected complication interrupts the service, Bio Basic Inc. will report such setbacks to the customer within 5 business days.
5. Functionality of Purified Antibody Bio Basic Inc. guarantees that their custom-generated monoclonal and polyclonal antibodies will test ELISApositive for the target antigen. Based on the custom antibody service package chosen by the customer, Bio Basic Inc. will also provide an application-specific guarantee for their custom antibodies, as laid out in the Sales Order.
6. Cancellations For any custom antibody project, the customer may cancel the order without any penalty after reaching an agreement with Bio Basic Inc. if Bio Basic Inc. has received the order but has not initiated the project. If Bio Basic Inc has initiated but has not completed the project, a cancellation fee will apply. The cancellation fee will be assessed on a case-by-case basis. If Bio Basic Inc. has completed the project, the customer may cancel the order, however, the full amount must be paid to Bio Basic Inc.
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
363
2015-2016 Product Catalog
Custom Antibody (Poly & Monoclonal) Services
7. Inspection Policy Upon receipt of shipped goods, customer shall inspect the shipment promptly for damages, shortages and correct identity of the product. Any product that is not identical to the deliverables as outlined during that stage of the Sales Order will be replaced or authorized for return and credit, at our option. Any claims must be submitted within 3 months of shipment.
8. Warranty Bio Basic Inc. guarantees each custom antibody service as outlined in the Sales Order. Any claims must be submitted within 3 months of shipment. Bio Basic Inc. reserves the right to refuse handling disputes after a period of 3 months.
9. Patents Bio Basic Inc. serves as a service provider and offers generation of custom antibodies against antigens provided by the customer (as a DNA sequence, peptide or protein). It is the sole responsibility of customer to verify whether his respective work is the result of any infringements of any patents. Bio Basic Inc. expressly disclaims any liability in this regard.
10. Usage Bio Basic Inc. products are used exclusively for scientific research purposes only. Materials will not be used for human or animal consumption.
11. Confidentiality Bio Basic Inc. and the customer agree that all confidential information including but not limited to project scope, contract terms, pricing information, product development technologies and processes, and businessrelated information shall not be disclosed to any third party and both parties receiving confidential shall only make internal use of the confidential information.
Add:20 Konrad Cres. Markham ON L3R 8T4 Canada Tel: (905)474 4493, (800)313 7224 Fax:(905)474 5794 Email:
[email protected] Web: www.biobasic.com
364