0888-8809/05/$15.00/0 Printed in U.S.A.
Molecular Endocrinology 19(5):1135–1146 Copyright © 2005 by The Endocrine Society doi: 10.1210/me.2004-0188
Peroxisome Proliferator-Activated Receptor ␣ Physically Interacts with CCAAT/Enhancer Binding Protein (C/EBP) to Inhibit C/EBP-Responsive ␣1-Acid Glycoprotein Gene Expression Audrey Mouthiers, Anita Baillet, Claudine Delome´nie, Dominique Porquet, and Najet Mejdoubi-Charef Laboratoire de Biochimie et de Biologie Cellulaire (A.M., A.B., D.P., N.M.-C.), Equipe d’Accueil de Doctorants 1595, Faculte´ de Pharmacie, Universite´ Paris XI, France; Plate-forme TranscriptomeProte´ome (C.D.), Institut National de la Sante´ et de la Recherche Me´dicale, Institut Fe´de´ratif de Recherche-75, Faculte´ de Pharmacie, Universite´ Paris XI, France Recently, the role of the peroxisome proliferatoractivated receptor ␣ (PPAR␣) in the hepatic inflammatory response has been associated to the decrease of acute phase protein transcription, although the molecular mechanisms are still to be elucidated. Here, we were interested in the regulation by Wy-14643 (PPAR␣ agonist) of ␣1-acid glycoprotein (AGP), a positive acute phase protein, after stimulation by Dexamethasone (Dex), a major modulator of the inflammatory response. In cultured rat hepatocytes, we demonstrate that PPAR␣ inhibits at the transcriptional level the Dex-induced AGP gene expression. PPAR␣ exerts this inhibitory effect by antagonizing the CCAAT/enhancer binding protein (C/EBP) transcription factor that is involved in Dex-dependent up-regulation of AGP
gene expression. Overexpression of C/EBP alleviates the repressive effect of PPAR␣, thus restoring the Dex-stimulated AGP promoter activity. Furthermore, glutathione-S-transferase GST pulldown and coimmunoprecipitation experiments evidenced, for the first time, a physical interaction between PPAR␣ and the C-terminal DNA binding region of C/EBP, thus preventing it from binding to specific sequence elements of the AGP promoter. Altogether, these results provide an additional molecular mechanism of negative regulation of acute phase protein gene expression by sequestration of the C/EBP transcription factor by PPAR␣ and reveal the high potency of the latter in controlling inflammation. (Molecular Endocrinology 19: 1135–1146, 2005)
T
genes, the products of which are involved in the metabolism of fatty acids (1). In addition to their hypolipidaemic effects, it has recently been demonstrated that PPAR␣ plays a role in the inflammatory response. Several studies have been aimed at delineating the cellular and molecular mechanisms explaining the control of the inflammatory response by PPAR␣ (4). Indeed, leukotriene B4 (LTB4), a proinflammatory eicosanoid, binds to PPAR␣ and induces the transcription of genes involved in - and -oxidation, which leads to the induction of its own catabolism (5). Thus, the duration of the inflammatory response is prolonged in PPAR␣-deficient mice in response to LTB4 (5). Furthermore, it has been shown that fibrates decrease the plasmatic concentrations of cytokines such as TNF␣ (6, 7) and IL-6 (8) and subsequently that PPAR␣ acts as a negative regulator of the vascular inflammatory gene response by antagonizing the activity of the transcription factors NF-B (nuclear factor B) and AP1 (activator protein 1) (9). Finally, it has been shown that PPAR␣ exerts its antiinflammatory activities in the liver by repressing the expression of proinflammatory genes such as acute phase proteins (APPs). Indeed, exposure of rodents to PPs leads to the down-regulation of many positive acute phase re-
HE PEROXISOME PROLIFERATOR-ACTIVATED receptors (PPARs) are ligand-activated transcription factors belonging to the nuclear receptor superfamily. The three isoforms (PPAR␣, PPAR, and PPAR␥) are characterized by their ligand specificities and tissue distributions (1, 2). The first PPAR cDNA cloned was isolated from a mouse liver library and corresponds to the PPAR␣ subtype (3), the main isoform expressed in the liver. In rodent hepatocytes, peroxisome proliferators (PPs) cause a dramatic increase in the number and size of peroxisomes, an effect associated with the parallel activation of many First Published Online January 20, 2005 Abbreviations: AGP, ␣1-Acid glycoprotein; AP1, activator protein 1; APP, acute phase protein; C/EBP, CCAAT/enhancer binding protein; CRP, C-reactive protein; Dex, dexamethasone; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GR, glucocorticoid receptor; GRIP, GR-interacting protein; GST, glutathione-S-transferase; LIP, liver-enriched inhibitory protein; NFB, nuclear factor B; PP, peroxisome proliferator; PPAR, PP-activated receptor; QPCR, quantitative PCR; TIF, transcriptional intermediary factor. Molecular Endocrinology is published monthly by The Endocrine Society (http://www.endo-society.org), the foremost professional society serving the endocrine community.
1135 The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 14 January 2017. at 16:38 For personal use only. No other uses without permission. . All rights reserved.
1136 Mol Endocrinol, May 2005, 19(5):1135–1146
sponse genes, including the fibrinogen-, ␣1-acid glycoprotein (AGP), ␣1-antitrypsin, ceruloplasmin, and serum amyloid A (10–13). In line with these observations, PPAR␣ has been shown to be involved in this PP-induced transcriptional repression because the effect is completely abolished in PPAR␣ knockout mice (12). Recently, PPAR␣ has been shown to repress human fibrinogen gene expression by interference with the CCAAT/enhancer binding protein  (C/EBP) pathway through titration of the coactivator GRIP1[glucocorticoid receptor (GR)-interacting protein]/TIF2 (transcriptional intermediary factor) (14). C/EBP is a key transcription factor involved in the induction of genes during acute phase or immune response (15). In response to extracellular stimuli, C/EBP may form heterodimers with other C/EBP family members or interact with other transcription factors such as members of the NF-B family (16), AP1 (17), Sp1 (18), p53 (19) or GR (20). In the case of the AGP gene, the maximal induction by glucocorticoids requires C/EBP binding elements located downstream and upstream of the glucocorticoid-responsive element (21) and interactions between TIF1, GR, and C/EBP (22). Moreover, the synergistic interaction between cytokines and glucocorticoids has been attributed to a protein-protein interaction between C/EBP and GR (20). In this work, we delineate the molecular mechanism of inhibition by PPAR␣ of dexamethasone (Dex)-inductive effects on AGP gene expression. We demonstrate that PPAR␣ inhibits Dex-induced AGP gene expression at a transcriptional level and that this inhibition originates from a physical interaction between PPAR␣ and C/EBP. This protein-protein interaction described here for the first time prevents C/EBP binding to AGP promoter and thus results in the repression of C/EBP-dependent transactivation of AGP gene.
RESULTS The PP Wy-14643 Down-Regulates Glucocorticoid-Inductive Effects on AGP Gene Expression at a Transcriptional Level PPs are known to inhibit inflammation by interfering with several major mediators involved in the acute phase response (4). We explored the effects of Wy14643 on the Dex-signaling pathway because the latter can directly stimulate the expression of APPs and potentiate cytokine effects. We worked on AGP, a positive APP, whose up-regulation mechanism by Dex is well characterized. We first measured by quantitative PCR the effect of Wy-14643 on the Dex-induced AGP mRNA expression in a physiological system such as cultured rat hepatocytes (Fig. 1A). As already demonstrated in vitro (10), the addition of Wy-14643 alone has no effect on basal AGP mRNA expression. However, when cells were treated with both Dex and Wy-
Mouthiers et al. • C/EBP and PPAR␣ Interact Physically
14643, AGP mRNA expression decreased by 52% (only 3.3-fold induction) compared with Dex alone (7-fold induction). Pretreatment with Wy-14643, before Dex induction, gave similar transcriptional inhibition of AGP gene expression (50%) even though Dex-induced AGP mRNA expression was slightly higher (9-fold induction). As expected from our short-term experimental conditions (less than 48 h in the presence of Wy-14643), and due to the long half-life of AGP (5 days), we could not observe any decrease of the amount of secreted AGP after a Dex and Wy-14643 treatment compared with Dex induction alone (Fig. 1B). To test whether Wy-14643 inhibits glucocorticoidinduced AGP gene expression at a transcriptional level, Sprague Dawley rat hepatocytes were transiently transfected with a luciferase expression vector driven by the 763-bp promoter fragment of AGP gene, which contains regulatory elements for basal and glucocorticoid-inducible promoter activity. Transfected cells were then treated with Wy-14643, Dex or both drugs. As shown in Fig. 1C, Wy-14643 had no effect on basal promoter activity, whereas it inhibited Dexinduced AGP promoter transcription by 39% (11-fold induction) compared with Dex alone (18-fold induction). These results indicate that the inhibition of glucocorticoid-induced AGP gene expression by Wy-14643 occurs at a transcriptional level. It is well known that glucocorticoids potentiate the action of cytokines (IL-1, IL-6, TNF␣) on the regulation of AGP gene (23, 24). Hence we investigated by quantitative PCR analysis whether Wy-14643 modulates this potentiating effect. Hepatocytes were stimulated by Wy-14643 and Dex, alone or associated, together with each of the above cytokines. As expected, cytokines used alone have no effect in our experimental conditions on AGP mRNA expression, their inductive effect being only observed in the presence of Dex, especially that of IL-6 (10-fold induction) and IL-6 in association with IL-1 (14-fold induction) (Fig. 2). Consistent with an inhibitory effect of Wy-14643 on Dexmediated stimulation of AGP gene expression, the potentiation of cytokine action by Dex was also counteracted by Wy-14643 treatment. In both Dex and IL-6 or Dex and IL-6 ⫹ IL-1 associations, the repressive effect reached 70% (Fig. 2). Altogether, these experiments demonstrate that Wy-14643 represses AGP mRNA expression specifically upon glucocorticoid-induced stimulation. Because GR, together with the transcription factor C/EBP, is involved in the glucocorticoid-mediated enhancement of AGP gene (21, 22), we further investigated the effect of Wy-14643 on GR and C/EBP mRNA transcription by quantitative PCR analysis. As already described for C/EBP (25), Dex stimulation strongly increased cell GR and C/EBP mRNA and protein content, whereas Wy-14643 treatment did not influence this induction (Fig. 3). These results show that the inhibitory effect of Wy-14643 on glucocorticoid-mediated enhancement of AGP gene expression
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 14 January 2017. at 16:38 For personal use only. No other uses without permission. . All rights reserved.
Mouthiers et al. • C/EBP and PPAR␣ Interact Physically
Mol Endocrinol, May 2005, 19(5):1135–1146 1137
is not related to mRNA and protein down-regulation of the glucocorticoid signaling partners. Wy-14643-Mediated Decrease of C/EBP and GRIP1/TIF2 Transactivating Effects on DexInduced AGP Promoter Activity Involves PPAR␣
Fig. 1. Effect of Wy-14643 on Dex-Induced AGP Gene Expression A, Rat hepatocytes were either not treated (control) or treated with 100 M Wy-14643 or 10⫺6 M Dex, alone or in association, for 48 h (1). Rat hepatocytes were either not treated (control), treated by 10⫺6 M Dex, or pretreated with 100 M Wy-14643 for 16 h followed or not by a 10⫺6 M Dex stimulation for additional 24 h (2). Total RNA was extracted and AGP mRNA was quantified by quantitative PCR. Values obtained for AGP mRNA transcripts (copy number) were normalized relative to those of GAPDH (copy number). Results are expressed as variations [mean (⫾SD) of three separate cultures] relative to control values (fold induction). B, Western blot analysis of secreted AGP in culture medium from either 100 M Wy-14643 and/or 10⫺6 M Dex-treated or untreated (control) cultured hepatocytes. The supernatant of a constant 2 ⫻ 106 cultured hepatocytes was used for each condition. C, Transient transfections into primary cultured rat hepatocytes were performed with the AGP promoter construct [pAGP(⫺763/⫹20)luc]. Transfected cells were treated with either 10⫺6 M Dex or 100 M Wy-14643 or both for 48 h. Luciferase activities are expressed relative to those of untreated cells. Each value is the mean (⫾SD) of luciferase activity measurements performed in three or four independent transfection experiments.
Because Wy-14643 is a specific PPAR␣ agonist, we tested whether PPAR␣ was actually involved in mediating the inhibitory effects we observed above. Because the overexpression of exogenous transcription factors in cultured hepatocytes usually gives low transfection efficiencies, we carried out the subsequent studies in a heterologous system such as Hela cells that are known to express the GR (23). To mimic the glucocorticoid signaling pathway of hepatocytes, an expression vector coding for C/EBP was cotransfected with the luciferase gene constructs that contained either a large 763-bp promoter fragment [(⫺763/⫺60)pGluc] or the 138-bp fragment including the AGP glucocorticoid-responsive element [(⫺138/ ⫺60)pGluc]. As described in Fig. 4A, transfection of C/EBP enhanced Dex-induced luciferase promoter activity of the (⫺763/⫺60)pGluc construct (28.8-fold induction). The overexpression of PPAR␣ resulted in a marked decrease of Dex-induced luciferase activity (⫺50%) that was enhanced in the presence of Wy14643 (⫺70%) (Fig. 4A). These results demonstrate that the glucocorticoid signaling pathway can be reproduced in Hela cells and that PPAR␣ inhibits Dexinduced activation of the AGP gene promoter in this model. As shown in Fig. 4B, cotransfection of C/EBP with the (⫺138/⫺60)pGluc remarkably increased the basal (71-fold induction) and Dex-induced (134-fold induction) luciferase activity, as previously described (22). In the absence or presence of Dex, cotransfection of a constant amount of C/EBP with increasing amounts of PPAR␣ led to a dose-dependent inhibition of AGP promoter transactivation. This effect was further amplified in the presence of Wy-14643, whereas the GR protein level did not change (Fig. 4B). It is to note that an effect of Wy-14643 alone could be observed in the absence of Dex (data not shown) by contrast to hepatocytes (Fig. 1). This discrepancy can be explained by the fact that induction of AGP gene transcription in hepatocytes by endogenous C/EBP requires an interaction of the latter with a Dex-activated GR, whereas, in Hela cells, AGP promoter transcription occurs (to a much lesser extent) even in the absence of Dex because of the high C/EBP overexpression level. Because PPAR␣ similarly regulates the luciferase activity of both (⫺763/⫺60)pGluc and (⫺138/ ⫺60)pGluc plasmids, we further pursued our investigation on the molecular mechanism of PPAR␣ action with the latter luciferase construct that was more sensitive to C/EBP and Dex treatment. The above results suggested that C/EBP could be a target of PPAR␣ inhibitory effect on Dex-induced stimulation of the AGP promoter activity. To determine
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 14 January 2017. at 16:38 For personal use only. No other uses without permission. . All rights reserved.
1138 Mol Endocrinol, May 2005, 19(5):1135–1146
Mouthiers et al. • C/EBP and PPAR␣ Interact Physically
Fig. 2. Wy-14643 Counteracts the Dex-Potentiated Cytokine Effects Rat hepatocytes were cultured for 48 h with or without Dex (10⫺6 M), Wy-14643 (100 M), IL-1 (25 ng/ml), IL-6 (25 ng/ml), or TNF␣ (25 ng/ml) or in association as indicated. Total RNA was extracted and AGP mRNA was quantified by quantitative PCR. Values obtained for AGP mRNA transcripts (copy number) were normalized relative to those of GAPDH (copy number). Results are expressed as AGP/GAPDH ratio [mean (⫾SD)] of three separate cultures.
Fig. 3. Effect of Wy-14643 on C/EBP and GR mRNA and Protein Expression A, Rat hepatocytes were either not treated (control), treated by 10⫺6 M Dex, or pretreated with 100 M Wy-14643 for 16 h followed or not by a 10⫺6 M Dex stimulation for additional 24 h. Total RNA was extracted and AGP mRNA was quantified by quantitative PCR. Values obtained for AGP mRNA transcripts (copy number) were normalized relative to those of GAPDH (copy number). Results are expressed as variations [mean (⫾SD) of three separate cultures] relative to control values (fold induction). B, The C/EBP and GR protein contents were analyzed by Western blot.
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 14 January 2017. at 16:38 For personal use only. No other uses without permission. . All rights reserved.
Mouthiers et al. • C/EBP and PPAR␣ Interact Physically
Mol Endocrinol, May 2005, 19(5):1135–1146 1139
Fig. 4. Inhibition of GRIP1- and C/EBP-Induced AGP Promoter Activity by PPAR␣ A, Hela cells were transfected with the (⫺763/⫺60)pGluc plasmid (1 g) in the presence of pSG5-PPAR␣ or CMV-C/EBP. Cells were either not stimulated (control) or stimulated with 10⫺6 M Dex and treated or not with 10 M Wy-14643. B, Hela cells were transfected with the (⫺138/⫺60)pGluc plasmid (1 g) and increasing amounts of pSG5-PPAR␣ (0.5⫻, 1⫻, and 2⫻) were added to a constant amount of CMV-C/EBP (100 ng). Cells were either not stimulated (control) or stimulated with 10⫺6 M Dex and treated or not with 10 M Wy-14643. GR protein content was analyzed by Western blot. C, Hela cells were transfected with the (⫺138/⫺60)pGluc plasmid (1 g) in the presence of PPAR␣ or GRIP1/TIF2 expression vectors and either not stimulated (control) or stimulated with 10⫺6 M Dex and treated or not with 10 M Wy-14643. The ratios of luciferase-to--galactosidase activities were measured in duplicates. The mean ratio values (⫾SD) obtained from four independent experiments are expressed relative to the pSG5 control ratio.
whether other known GR partners could be PPAR␣ targets, the (⫺138/⫺60)pGluc construct was cotransfected in Hela cells with the expression vectors coding
for TIF1 (a cofactor that interacts with GR and C/EBP) (22) or GRIP1/TIF2 (a coactivator of GR) (26). These experiments were performed with or without
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 14 January 2017. at 16:38 For personal use only. No other uses without permission. . All rights reserved.
1140 Mol Endocrinol, May 2005, 19(5):1135–1146
pSG5-PPAR␣ cotransfection and luciferase activity was analyzed. TIF1 exhibited a weak inductive effect on luciferase promoter activity with or without Dex (data not shown). Conversely, GRIP1/TIF2 cofactor strongly induced the luciferase promoter activity (Fig. 4C), but only in the presence of Dex (39-fold induction) as expected (27). Furthermore, the cotransfection of PPAR␣ totally abolished the GRIP1/TIF2 activating effect with or without Wy-14643. Taken together, these results indicate that PPAR␣ can counteract C/EBP- and GRIP1/TIF2-induced AGP transactivation. C/EBP But Not GRIP1/TIF2 Alleviates the Repressive Effect of PPAR␣ on Dex-Induced AGP Gene Transcription Because PPAR␣ decreases C/EBP and GRIP1/TIF2 transactivating effects, we addressed the question whether an excess of each factor would alleviate the inhibitory effect mediated by PPAR␣. Hela cells were cotransfected with the (⫺138/⫺60)pGluc plasmid, a constant quantity of pSG5-PPAR␣ and increasing amounts of C/EBP or GRIP1/TIF2 expression vectors before monitoring luciferase. In contrast with the results obtained by Gervois et al. (14) in the case of the fibrinogen- gene, we did not observe any abolishment of PPAR␣ inhibitory effect by an excess of
Mouthiers et al. • C/EBP and PPAR␣ Interact Physically
GRIP1/TIF2 (results not shown), indicating that, in our model, GRIP1/TIF2 is not the obvious target of PPAR␣. However, increasing amounts of C/EBP made possible the restoration of Dex-induced AGP promoter activation to the level of the control. A total abolishment of the inhibitory effect of PPAR␣ in a ligand-independent manner was achieved for a C/EBP:PPAR␣ ratio of 5:1 (Fig. 5). These results suggest that PPAR␣ represses Dex-induced AGP expression by titration of C/EBP, leading us to search for an interaction between the two proteins. Physical Interaction between C/EBP and PPAR␣ To test whether C/EBP and PPAR␣ proteins interact, we performed glutathione-S-transferase (GST) pulldown experiments. GST or GST-PPAR␣ were incubated with different amounts of [35S]methionine-labeled C/EBP in the presence or absence of Wy14643. As shown in Fig. 6A, C/EBP specifically interacts with PPAR␣ because 1) no binding could be detected in the presence of empty GST and 2) the interaction was enhanced with increasing amounts of one of the two partners. The densitometric analysis of the autoradiogram further shows that the interaction for a C/EBP:PPAR␣ ratio of 1:1 was enhanced in the presence of Wy-14643 (⫹20%), as already suggested by previous transfection experiments (see Fig. 4A).
Fig. 5. C/EBP Alleviates the PPAR␣ Inhibitory Effect on Dex-Induced AGP Gene Transcription Hela cells were cotransfected with the (⫺138/⫺60)pGluc plasmid (1 g) and either pSG5-PPAR␣ or CMV-C/EBP. Increasing amounts of CMV-C/EBP (100 ng) were added to a constant amount of pSG5-PPAR␣ (100 ng). Cells were stimulated with 10⫺6 M Dex and treated or not with 10 M Wy-14643. The ratios of luciferase-to--galactosidase activities were measured in duplicates. The mean ratio values (⫾SD) obtained from four independent experiments are expressed relative to the pSG5 control ratio. PPAR␣ and C/EBP protein levels were analyzed by Western blotting of protein extracts from Hela cells transfected with a constant amount of PPAR␣ and increasing amounts of C/EBP expression vectors.
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 14 January 2017. at 16:38 For personal use only. No other uses without permission. . All rights reserved.
Mouthiers et al. • C/EBP and PPAR␣ Interact Physically
Mol Endocrinol, May 2005, 19(5):1135–1146 1141
Fig. 6. Physical Interaction between C/EBP and PPAR␣ Radiolabeled C/EBP and LIP proteins were synthesized in vitro and then incubated with Sepharose beads covered with immobilized GST or GST-PPAR␣ proteins in the presence or absence of Wy-14643; bound C/EBP or LIP proteins were eluted, analyzed by SDS-PAGE and visualized by autoradiography as shown in panels A and B, respectively; bound C/EBP was quantified by densitometry. C, Coimmunoprecipitation was performed on total protein extract prepared from rat liver. Anti-PPAR␣ antibody was used to precipitate endogenous PPAR␣, and the immune complexes were revealed with anti-C/EBP antibody (lane 1). Immunoprecipitation of liver protein extracts with preimmune serum (PI) (lane 2) and of RIPA buffer with anti-PPAR␣ (lane 3) were included as negative controls. Total liver protein extract was used as a positive control for the CEBP detection (lane 4).
These results clearly indicate that C/EBP and PPAR␣ coexist in a complex providing a pretty good explanation of our transfection data (Figs. 4, A and B, and 5). To determine which domain of C/EBP interacts with PPAR␣, GST pull-down experiments were also performed with a truncated C/EBP isoform (also termed liver-enriched inhibitory protein or LIP) that lacks the 151 amino acids in the N-terminal transactivation region. As shown in Fig. 6B, LIP specifically interacts with PPAR␣, indicating that the C-terminal DNA binding domain of C/EBP is involved for its direct interaction with PPAR␣. To finally assess that the sequestration of C/EBP by PPAR␣ also occurs under physiological conditions, immunoprecipitations
were performed with a monoclonal anti-PPAR␣ on liver-soluble protein extracts. The presence of C/EBP in the endogenous immune complexes was detected by Western blot using a polyclonal anti-C/EBP (Fig. 6C), indicating that PPAR␣ and C/EBP coexist in a protein complex in vivo. PPAR␣ Prevents C/EBP from Binding to Its Target DNA Element To finally determine whether PPAR␣ prevents C/EBP from binding to its target DNA elements on the AGP gene or whether the PPAR␣-C/EBP interaction reduces C/EBP transactivating function, gel shift as-
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 14 January 2017. at 16:38 For personal use only. No other uses without permission. . All rights reserved.
1142 Mol Endocrinol, May 2005, 19(5):1135–1146
Fig. 7. PPAR␣ Prevents C/EBP from Binding to Its DNA Element The 32P-labeled probe was incubated without or with unprogrammed reticulocyte lysate (Ret. Lys) or in vitro-translated C/EBP. The DNA/C/EBP complex formed is indicated by an arrow. Competition analysis was performed with a 100-fold molar excess of non radiolabeled homologous probe. Supershift experiments were performed by adding anti-C/EBP antibody as described in Materials and Methods. Gel retardation assays were also performed with a constant amount of C/EBP and increasing amounts of PPAR␣.
says were performed using the specific C/EBP sequence located within the steroid-responsive unit of the AGP promoter and in vitro-translated C/EBP and PPAR␣. As shown in Fig. 7, C/EBP bound specifically to its target DNA element; the binding specificity being confirmed by antibody-mediated super-shift. Furthermore the addition of increasing amounts of in vitrotranslated PPAR␣ abolished the binding of C/EBP to DNA, confirming that PPAR␣ interacts with the DNA binding domain of C/EBP.
DISCUSSION Initially known to alter diverse liver-specific genes involved in fatty acid catabolism pathways, PPAR␣ has more recently been shown to have a direct implication in the modulation of the inflammatory response in the liver. Indeed, in rodent livers, PPAR␣ down-regulates APPs as observed in vivo for serum amyloid A, ceru-
Mouthiers et al. • C/EBP and PPAR␣ Interact Physically
loplasmin, haptoglobin, fibrinogen- and -␥, ␣2-macroglobulin and AGP (11–13). In vitro studies have been assayed to address the molecular mechanisms of inflammation control by PPAR␣ (4). It has been reported that PPAR␣ represses basal or IL-6-induced fibrinogen-␣ or - and serum amyloid A gene expression (14). Similarly, IL-1-induced C-reactive protein (CRP) is down-regulated by PPAR␣ activation (28). In this paper, we evidenced that Wy-14643, a specific agonist of PPAR␣, strongly decreases Dex-induced AGP gene expression, the only APP the plasma level of which is not only elevated during acute but also chronic inflammatory states. As observed for CRP, PPAR␣ action on AGP expression is dose dependent, occurs at the transcriptional level, and is observed only after stimulation. Increasing information is emerging on the antiinflammatory properties of PPAR␣ in the liver even though the molecular mechanisms involved in this effect are not definitively established. It has been demonstrated that PPAR␣ down-regulates the expression of the IL-6 receptor in the liver and subsequently decreases the activation of transcription factors such as signal transducer and activator of transcription 3 and c-Jun involved in the IL-6 signaling pathway (29). Moreover, PPAR␣ mediates the repressive effect of fibrates on fibrinogen- expression through sequestration of GRIP1/TIF2, a cofactor of C/EBP (14). In the case of IL-1-induced CRP expression, PPAR␣ activators also inhibit gene transcription by reducing the formation of nuclear C/EBP-p50-NF-B complexes (28). Remarkably, we evidenced a novel molecular mechanism of negative gene regulation by PPAR␣, demonstrating, for the first time, a physical, ligandindependent, interaction between PPAR␣ and the transcription factor C/EBP. Both mobility shift assays where PPAR␣ impairs the binding of C/EBP to its target DNA and GST pull-down experiments with the LIP isoform of C/EBP in which most of the transactivation domain has been truncated suggest a role for the C-terminal DNA binding domain of C/EBP to directly interact with PPAR␣. Indeed, C/EBP is known to be a basic region-leucine zipper (bZIP) protein with a leucine zipper domain at the C terminus that is essential for DNA binding and dimer formation (20). To date, an interaction between PPAR␣ and a transcription factor has only been shown for AP1 or NF-B on proinflammatory genes in extrahepatic tissues (9, 30). The titration of the transcription factor C/EBP involved in AGP stimulation by Dex treatment explains the inhibitory effect of PPAR␣ that we observed on Dex-induced AGP promoter activity. Indeed, an excess of C/EBP alleviates the repressive effect of PPAR␣ on Dex-stimulated AGP transcription. Interestingly, this PPAR␣ control of a Dex-induced APP expression through sequestration of the transcription factor C/EBP may also be relevant to other signaling pathways involving C/EBP. This novel molecular mechanism of inhibition of the C/EBP signaling pathway by PPAR␣ through a phys-
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 14 January 2017. at 16:38 For personal use only. No other uses without permission. . All rights reserved.
Mouthiers et al. • C/EBP and PPAR␣ Interact Physically
ical interaction is likely to contribute to the overall antiinflammatory properties of PPAR␣ agonists. Indeed, it can complete already known molecular mechanisms implicated in the inhibition of cytokine-induced APPs by PPAR␣. In the case of IL-6-induced fibrinogen- gene, PPAR␣ has been shown to exert its repressive effect via titration of a cofactor of C/EBP, GRIP1/TIF2 (14); in addition, from our data, one can also hypothesize that PPAR␣ might directly act through sequestration of C/EBP. Furthermore, the fact that Wy-14643 also prevents Dex-potentiated IL-1 and IL-6 action on AGP gene expression as well as on several other acute phase genes (14) suggests once again that at least part of the inhibitory effects of PPAR␣ are mediated through the sequestration of C/EBP, a common transcription factor of both IL-1 or IL-6 and Dex signaling pathways. Similarly, regarding the repression of IL-1-induced CRP, PPAR␣ could sequester the C/EBP protein, one partner of the complex p50NF-B-C/EBP, in addition to the decrease of formation of nuclear complexes by up-regulation of inhibitor B (iB) expression in vitro and strong reduction of basal C/EBP and p50NF-B protein expression levels in vivo, as described previously (28). Thus, PPAR␣ interference with the C/EBP signaling pathway would reveal the powerful potency of PPAR␣ in controlling inflammation in the liver. It has been demonstrated in hepatocytes that PPAR␣ expression is controlled in vivo and in vitro by glucocorticoids (31, 32), proinflammatory modulators that can directly stimulate or potentiate cytokine action on APP gene expression, the regulation of most of which involves the transcription factor C/EBP (33). In the case of C/EBP-responsive genes, a feedback mechanism could be envisioned in which the up-regulation of PPAR␣ expression by glucocorticoids would in turn lead to the down-regulation of Dex and Dexpotentiated cytokine action on APP gene expression through the sequestration of the transcription factor C/EBP. Such a feedback mechanism could thus provide a means for hepatic cells to control the duration of an inflammatory response. Altogether, our findings identify a novel target for negative gene regulation by PPAR␣. They also reinforce the idea that PPAR␣ is a major actor in the modulation of the inflammatory response in the liver and finally, emphasize the therapeutic potential of PPAR␣ ligands in controlling some pathological aspects of the inflammatory response.
MATERIALS AND METHODS Chemicals Dex (Soludecadron, 4 mg/ml) was from Merck Sharp & Dohme Chibret (Puy-en-Velay, France). Wy-14643 was from Calbiochem (Merck Biosciences, Fontenay-sous-bois, France). Isopropyl -D-thiogalactosyde was from Sigma (St Quentin Fallavier, France). Cytokines were from PromoKine, Bioscience Alive (Heidelberg, Germany).
Mol Endocrinol, May 2005, 19(5):1135–1146 1143
Cell Culture Hepatocytes from Sprague Dawley rats (190–250 g) were isolated by collagenase method as previously described (23). Cells (2 ⫻ 106) were plated in 3 ml of William’s E culture medium containing 10% fetal calf serum, 2 mM L-glutamine, 10 mM sodium pyruvate, 30 nM selenium, 8 M niacinamide, 100 U/ml penicillin, 100 g/ml streptomycin, and 250 ng/ml fungizone as described previously (24). The culture medium was changed daily, and chemicals (10⫺6 M Dex and/or 100 M Wy-14643) were added to the culture medium. Twentyfour hours after the last treatment, total cellular RNA was extracted for quantitative PCR. Hela cells were maintained in DMEM supplemented with 10% fetal calf serum, penicillin at 100 U/ml, streptomycin at 100 g/ml, and gentamycin sulfate at 0.25 g/ml and grown at 37 C in 5% CO2. RNA Extraction, cDNA Synthesis, and Quantitative PCR (QPCR) Total RNA was isolated from a pellet of cultured hepatocytes using the Trizol total RNA isolation reagent (Invitrogen Life Technologies, Carlsbad, CA) as previously described (24). First-strand cDNA was generated by reverse transcription of 2 g of total RNA using oligo(deoxythimidine)12–15 primer and Superscript III reverse transcriptase (Invitrogen Life Technologies) according to the manufacturer’s instructions, in a total reaction volume of 20 l. Reverse and forward oligonucleotide primers, specific to the chosen candidate and housekeeping genes, were designed using Primer3 software (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi). Table 1 lists the sequence of oligonucleotide primers that were used. Real-time PCR was performed in a LightCycler (Roche Diagnostics, Meylan, France) thermal cycler. Each cDNA was performed in a 10-l volume, using the Fast Start DNA MasterPLUS SYBR Green I master mix (Roche Diagnostics), with 300-nM final concentrations of each primer. Dissociation curves were generated after each QPCR run to ensure that a single, specific product was amplified. For establishing the calibration curves, a cDNA fragment of AGP and GR genes was amplified using conventional PCR, generating standard fragments of 448 and 870 bp in length, respectively. These fragments were purified using the High Pure PCR Product Purification Kit (Roche Diagnostics), quantified spectrophotometrically and sequenced (MWG Biotech, Courtaboeuf, France). Purified plasmid sequences were used as standards for C/EBP and glyceraldehyde-3-phosphate dehydrogenase (GAPDH). All PCR efficiencies (E), calculated from the slopes of the calibration curves according to the equation E ⫽ [10(⫺1/slope)] ⫺ 1, were above 90%. QPCR data for each gene were normalized to the GAPDH mRNA content of each cDNA. Mean values ⫾ SD from three separate experiments are presented. Expression Vectors and Plasmid DNA Constructs The pSG5 and pSV--galactosidase control vector plasmids were from Stratagene (Amsterdam, The Netherlands) and Promega (Charbonnie`res, France), respectively. The pSG5-PPAR␣ expression plasmid, which contains the complete mouse PPAR␣ coding sequence, and the pSG5TIF1 one, which encodes for the mouse TIF1, were generous gifts from Pr. N. Latruffe (Laboratoire de Biologie Mole´culaire et Cellulaire, University of Bourgogne, Dijon, France) and Dr. P. Chambon (Institut National de la Sante´ et de la Recherche Me´dicale, University Louis Pasteur, Strasbourg, France), respectively. CMV-C/EBP and CMV-LIP were gifts of Pr. U. Schibler (University of Geneva, Geneva, Switzerland) and pSG5GRIP1/TIF2 was a gift of Pr. M. R. Stallcup (University of Southern California, Los Angeles, CA).
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 14 January 2017. at 16:38 For personal use only. No other uses without permission. . All rights reserved.
Mouthiers et al. • C/EBP and PPAR␣ Interact Physically
1144 Mol Endocrinol, May 2005, 19(5):1135–1146
Table 1. Primer Sets for Quantitative Real-Time PCR Used for mRNA Quantitation Gene
GenBank
Synthesis of calibration fragments for QPCR AGP V01216 GR QPCR fragments AGP
Nucleotides
Primer Sequence (5⬘–3⬘)
Orientation
286–733
TTCAGACCACAGACGACCAG GAATCGAGGTGCACAGGAGT GACATGTGGAAGCTGCAAAG TCATGCATGGAGTCCAGAAG
Sense Antisense Sense Antisense
ATTCCAGCAGGCTGTCAAAG CCGGAGTTCAGAGAGCTGAG CAAGCTGAGCGACGAGTACA CAGCTGCTCCACCTTCTTCT TACCACAGCTCACCCCTACC ACTGCTGCAATCACTTGACG GTTACCAGGGCTGCCTTCTC GGGTTTCCCGTTGATGACC
Sense Antisense Sense Antisense Sense Antisense Sense Antisense
M14053
1433–2302
V01216
509–685
C/EPB
NM_024125
1098–1256
GR
M14053
1696–1848
GAPDH
NM_017008
895–1062
pGEX-PPAR␣ was constructed by inserting the BamHI PPAR␣ cDNA fragment from pSG5-PPAR␣ into similarly digested pGEX-4T-1 (Amersham Biosciences, Orsay, France). To generate pAGP(⫺763/⫹20)luc, the ⫺763/⫹20 fragment of the rat AGP gene promoter was excised by SmaI/XhoI from pAGPcat (33) and inserted into the corresponding sites of the pGL3 Basic vector (Promega). The ⫺763/⫺60 fragment from pAGPcat was subcloned into pGluc plasmid, which contains the minimal -globin promoter. (⫺138/⫺60)pGluc was obtained by creating a HindIII restriction site at position ⫺138 into the (⫺763/⫺60)pGluc using the QuikChange Site-Directed Mutagenesis kit (Stratagene); the HindIII/BamHI fragment thus obtained was then subcloned into the HindIII/BamHI cloning sites of pGluc. Transient Transfection and Luciferase Reporter Assay Freshly isolated hepatocytes were transfected by the electroporation method as previously described (34). After transfection, cells were incubated for 48 h with the indicated compounds (10⫺6 M Dex and/or 100 M Wy-14643) in medium containing 10% fetal calf serum. For Hela cells, transfections were carried out using FuGene 6 reagent (Roche Diagnostics). Cells were plated at a density of 2 ⫻ 105 in six-well dishes 1 d before transfection. Cotransfections were typically performed using 1 g of (⫺138,60)pGluc and different amounts of expression plasmids plus 0.5 g of internal control (pSV-gal); the total amount of DNA was maintained constant with pSG5. DNA solutions were combined at a 1:3 ratio with FuGene 6 reagent (1 g of DNA/3 l of FuGene). Cells were overloaded with this mixture in a final volume of 1 ml of medium for overnight. Wy-14643 (10 M) or/and Dex (10⫺6 M) were then added to fresh medium for 24 h. Cell extracts were prepared, and luciferase activity was measured using a MicroLumatPlus LB 96V (Berthold Technologies, Thoiry, France) and a luciferase activity kit (Promega). -Galactosidase activity was determined for 100 g of extract to normalize for transfection efficiency. Western Blotting After separation by SDS-PAGE using 9% or 12% polyacrylamide gels, proteins were electroblotted onto a polyvinylidene difluoride membrane. After blocking, membranes were probed with either anti-GR (Santa Cruz, Biotechnology), antiC/EBP (sc-150, Santa Cruz Biotechnology), anti-PPAR␣ (MA1-822, Ozyme, Saint-Quentin en Yuelines, France) or anti-AGP polyclonal antibodies. Purified goat antirabbit or goat antimouse antibodies were used to detect primary an-
tibodies. The immune complexes were visualized by an enhanced chemiluminescence assay (ECL, NEN Life Science Products Inc., Boston, MA). In Vitro Translation PPAR␣, C/EBP, [35S]methionine-labeled C/EBP, and [35S]methionine-labeled LIP proteins were transcribed and translated in vitro using the TNT T7 coupled reticulocyte lysate system (Promega) according to the manufacturer’s instructions. GST Fusion Protein Binding Assay GST or GST-PPAR␣ fusion protein were produced in BL21 Escherichia coli after induction with 0.5 mM isopropyl -Dthiogalactosyde for 2 h. Cells were harvested by centrifugation and resuspended into PBS. The bacteria were lysed by mild sonication at 4 C in PBS. Triton X-100 was added to a final concentration of 1%, followed by gentle mixing for 30 min at 4 C. The supernatant was gently mixed with PBSwashed glutathione-Sepharose 4B beads (Amersham) at room temperature for 30 min. GST proteins bound to beads were collected by centrifugation at 500 ⫻ g, followed by three successive washes with PBS. In vitro protein-protein interaction assay (GST pull-down) was carried out by incubating 10 l of GST-PPAR␣ beads with 10 or 20 l of in vitro synthesized [35S]methioninelabeled protein in the presence or not of 100 M Wy-14643 in a total volume of 150 l of incubation buffer [20 mM HEPES (pH 7.8), 100 mM KCl, 10 mM MgCl2, 10% glycerol, 0.1% Nonidet P-40, 0.1% Triton X-100, 0.1% BSA, 1 mM dithiothreitol, 1 g/ml of aprotinin, leupeptin, and pepstatin]. The mixture is gently rotated for 90 min at 4 C. After centrifugation, the beads were washed four times with incubation buffer without BSA, resuspended in 30 l of 1⫻ Laemmli buffer, boiled for 5 min, and centrifuged. The supernatant was loaded onto a SDS-PAGE. After drying the gel, bound proteins were visualized after autoradiography and subjected to densitometry after digitization on a personal computer. In Vivo Protein-Protein Interaction Assay (Coimmunoprecipitation) A freshly isolated piece of rat liver of about 1 g was homogenized in ice-cold RIPA buffer [50 mM Tris-HCl (pH 7.4), 1% Nonidet P-40, 0.25% Na-deoxycholate, 150 mM NaCl, 1 mM EDTA, 1 mM phenylmethylsulfonyl fluoride, 1 mM Na3VO4, 1 mM NaF and 1 g/ml of aprotinin, leupeptin, and pepstatin]
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 14 January 2017. at 16:38 For personal use only. No other uses without permission. . All rights reserved.
Mouthiers et al. • C/EBP and PPAR␣ Interact Physically
and centrifuged at 10,000 ⫻ g for 10 min to recover soluble proteins. Liver extracts were then incubated with 5 g of primary mouse anti-PPAR␣ antibody (MA1–822, Affinity Bioreagents) or mouse preimmune serum at 4 C for 16 h. Antigen-antibody complexes were immunoprecipitated by adding 100 l of magnetic protein A Dynabeads (Dynal, Compie`gne, France) and rotated at 4 C for 2 h. Complexes were then washed four times with 1 ml of ice-cold PBS containing 0.1% SDS. Protein samples were boiled in Laemmli electrophoresis buffer and subjected to SDS-PAGE for Western blot analysis with a rabbit polyclonal anti-C/EBP antibody (sc-150, Santa Cruz Biotechnology).
Mol Endocrinol, May 2005, 19(5):1135–1146 1145
3. 4. 5. 6.
Gel Retardation Assays The specific sequence for C/EBP corresponds to the C/EBP interaction sites within the glucocorticoid regulatory unit of the AGP promoter (⫺94 to ⫺64). The probe was prepared by annealing the sense strand oligonucleotide (5⬘-GATCCTGGTGAGATTGTGCCACAGCTCTGCA-3⬘) with the corresponding antisense strand oligonucleotide, and then 5⬘ endlabeled using T4 polynucleotide kinase and ␥ 32P ATP (3000 Ci/mmol, Amersham France SA, Les Ulis, France). In vitro-synthesized C/EBP was preincubated with or without in vitro-synthesized PPAR␣ in a total volume of 20 l of buffer [20 mM HEPES (pH 7.9), 50 mM KCl, 1 mM dithiothreitol, 1 mM EDTA, 10% glycerol] with 1 g of poly-deoxyinosine-deoxycytosine with or without 2 g of anti-C/EBP antibody for 10 min on ice. After 20 min of incubation at room temperature with 1 ng end-labeled oligonucleotide, DNAprotein complexes were separated by electrophoresis in 5% polyacrylamide gels in TBE 0.5⫻ buffer (45 mM Tris borate, 1 mM EDTA) at 4 C at 200 V for 3 h.
7.
8.
9.
10.
Acknowledgments We are grateful to Dr. P. Chambon (Institut de Ge`ne´tique et de Biologie Mole´culaire et Cellulaire-Laboratoire de Ge`ne´tique Mole´culaire des Eurcaryotes Unite´ 184, Universite´ Louis Pasteur, Strasbourg, France) and Pr. N. Latruffe (Laboratoire de Biologie Mole´culaire et Cellulaire, Universite´ de Bourgogne, Dijon, France) for providing the pSG5-TIF1 and the pGluc, pSG5 and pSG5-PPAR␣ plasmids, respectively. We also thank Pr. M. R. Stallcup (University of Southern California) and Pr. U. Schibler (University of Geneva, Geneva, Switzerland) for providing the pSG5-GRIP1/TIF2 and the CMV-C/ EBP and CMV-LIP plasmids, respectively.
11.
12.
13.
14. Received May 4, 2004. Accepted January 12, 2005. Address all correspondence and requests for reprints to: Najet Mejdoubi-Charef, Laboratoire de Biochimie et de Biologie Cellulaire, Equipe d’Accueil de Doctorants 1595, Tour D4 1ere´tage, Faculte´ de Pharmacie, 5 rue J. B. Cle´ment, 92296 Cha tenay-Malabry Cedex, France. E-mail: najet.charef@cep. u-psud.fr. This work was supported by a grant from the Institut de Recherche International Servier and by the Fondation pour la Recherche Me´dicale (to A.M.).
15. 16.
17.
REFERENCES 1. Desvergne B, Wahli W 1999 Peroxisome proliferatoractivated receptors: nuclear control of metabolism. Endocr Rev 20:649–688 2. Dreyer C, Krey G, Keller H, Givel F, Helftenbein G, Wahli W 1992 Control of the peroxisomal -oxidation pathway
18.
by a novel family of nuclear hormone receptors. Cell 68:879–887 Issemann I, Green S 1990 Activation of a member of the steroid hormone receptor superfamily by peroxisome proliferators. Nature 347:645–650 Delerive P, Fruchart JC, Staels B 2001 Peroxisome proliferator-activated receptors in inflammation control. J Endocrinol 169:453–459 Devchand PR, Keller H, Peters JM, Vazquez M, Gonzalez FJ, Wahli W 1996 The PPAR␣-leukotriene B4 pathway to inflammation control. Nature 384:39–43 Xu X, Otsuki M, Saito H, Sumitani S, Yamamoto H, Asanuma N, Kouhara H, Kasayama S 2001 PPAR␣ and GR differentially down-regulate the expression of nuclear factor-B-responsive genes in vascular endothelial cells. Endocrinology 142:3332–3339 Madej A, Okopien B, Kowalski J, Zielinski M, Wysocki J, Szygula B, Kalina Z, Herman ZS 1998 Effects of fenofibrate on plasma cytokine concentrations in patients with atherosclerosis and hyperlipoproteinemia IIb. Int J Clin Pharmacol Ther 36:345–349 Staels B, Koenig W, Habib A, Merval R, Lebret M, Torra IP, Delerive P, Fadel A, Chinetti G, Fruchart JC, Najib J, Maclouf J, Tedgui A 1998 Activation of human aortic smooth-muscle cells is inhibited by PPAR␣ but not by PPAR␥ activators. Nature 393:790–793 Delerive P, De Bosscher K, Besnard S, Vanden Berghe W, Peters JM, Gonzalez FJ, Fruchart JC, Tedgui A, Haegeman G, Staels B 1999 Peroxisome proliferator-activated receptor ␣ negatively regulates the vascular inflammatory gene response by negative cross-talk with transcription factors NF-B and AP-1. J Biol Chem 274: 32048–32054 Corton JC, Fan LQ, Brown S, Anderson SP, Bocos C, Cattley RC, Mode A, Gustafsson JA 1998 Down-regulation of cytochrome P450 2C family members and positive acute-phase response gene expression by peroxisome proliferator chemicals. Mol Pharmacol 54:463–473 Motojima K 1997 Peroxisome proliferator-activated receptor (PPAR)-dependent and -independent transcriptional modulation of several non-peroxisomal genes by peroxisome proliferators. Biochimie 79:101–106 Anderson SP, Cattley RC, Corton JC 1999 Hepatic expression of acute-phase protein genes during carcinogenesis induced by peroxisome proliferators. Mol Carcinog 26:226–238 Yamazaki K, Kuromitsu J, Tanaka I 2002 Microarray analysis of gene expression changes in mouse liver induced by peroxisome proliferator-activated receptor ␣ agonists. Biochem Biophys Res Commun 290:1114–1122 Gervois P, Vu-Dac N, Kleemann R, Kockx M, Dubois G, Laine B, Kosykh V, Fruchart JC, Kooistra T, Staels B 2001 Negative regulation of human fibrinogen gene expression by peroxisome proliferator-activated receptor ␣ agonists via inhibition of CCAAT box/enhancer-binding protein . J Biol Chem 276:33471–33477 Akira S, Kishimoto T 1992 IL-6 and NF-IL6 in acutephase response and viral infection. Immunol Rev 127: 25–50 Lee YM, Miau LH, Chang CJ, Lee SC 1996 Transcriptional induction of the ␣-1 acid glycoprotein (AGP) gene by synergistic interaction of two alternative activator forms of AGP/enhancer-binding protein (C/EBP ) and NF-B or Nopp140. Mol Cell Biol 16:4257–4263 Hsu W, Kerppola TK, Chen PL, Curran T, Chen-Kiang S 1994 Fos and Jun repress transcription activation by NF-IL6 through association at the basic zipper region. Mol Cell Biol 14:268–276 Lee YH, Williams SC, Baer M, Sterneck E, Gonzalez FJ, Johnson PF 1997 The ability of C/EBP  but not C/EBP ␣ to synergize with an Sp1 protein is specified by the leucine zipper and activation domain. Mol Cell Biol 17: 2038–2047
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 14 January 2017. at 16:38 For personal use only. No other uses without permission. . All rights reserved.
1146 Mol Endocrinol, May 2005, 19(5):1135–1146
19. Margulies L, Sehgal PB 1993 Modulation of the human interleukin-6 promoter (IL-6) and transcription factor C/EBP  (NF-IL6) activity by p53 species. J Biol Chem 268:15096–15100 20. Nishio Y, Isshiki H, Kishimoto T, Akira S 1993 A nuclear factor for interleukin-6 expression (NF-IL6) and the glucocorticoid receptor synergistically activate transcription of the rat ␣ 1-acid glycoprotein gene via direct proteinprotein interaction. Mol Cell Biol 13:1854–1862 21. Ingrassia R, Savoldi GF, Caraffini A, Tironi M, Poiesi C, Williams P, Albertini A, Di Lorenzo D 1994 Characterization of a novel transcription complex required for glucocorticoid regulation of the rat ␣-1-acid glycoprotein gene. DNA Cell Biol 13:615–627 22. Chang CJ, Chen YL, Lee SC 1998 Coactivator TIF1 interacts with transcription factor C/EBP and glucocorticoid receptor to induce ␣1-acid glycoprotein gene expression. Mol Cell Biol 18:5880–5887 23. Bertaux O, Fournier T, Chauvelot-Moachon L, Porquet D, Valencia R, Durand G 1992 Modifications of hepatic ␣-1acid glycoprotein and albumin gene expression in rats treated with phenobarbital. Eur J Biochem 203:655–661 24. Fournier T, Mejdoubi N, Monnet D, Durand G, Porquet D 1994 Phenobarbital induction of ␣ 1-acid glycoprotein in primary rat hepatocyte cultures. Hepatology 20: 1584–1588 25. Matsuno F, Chowdhury S, Gotoh T, Iwase K, Matsuzaki H, Takatsuki K, Mori M, Takiguchi M 1996 Induction of the C/EBP gene by dexamethasone and glucagon in primary-cultured rat hepatocytes. J Biochem 119: 524–532 26. Baumann CT, Ma H, Wolford R, Reyes JC, Maruvada P, Lim C, Yen PM, Stallcup MR, Hager GL 2001 The glucocorticoid receptor interacting protein 1 (GRIP1) localizes in discrete nuclear foci that associate with ND10 bodies and are enriched in components of the 26S proteasome. Mol Endocrinol 15:485–500 27. Ding XF, Anderson CM, Ma H, Hong H, Uht RM, Kushner PJ, Stallcup MR 1998 Nuclear receptor-binding sites of
Mouthiers et al. • C/EBP and PPAR␣ Interact Physically
28.
29.
30.
31.
32.
33.
34.
coactivators glucocorticoid receptor interacting protein 1 (GRIP1) and steroid receptor coactivator 1 (SRC-1): multiple motifs with different binding specificities. Mol Endocrinol 12:302–313 Kleemann R, Gervois PP, Verschuren L, Staels B, Princen HM, Kooistra T 2003 Fibrates down-regulate IL-1-stimulated C-reactive protein gene expression in hepatocytes by reducing nuclear p50-NF B-C/EBP- complex formation. Blood 101:545–551 Gervois P, Kleemann R, Pilon A, Percevault F, Koenig W, Staels B, Kooistra T 2004 Global suppression of IL-6induced acute phase response gene expression after chronic in vivo treatment with the peroxisome proliferator-activated receptor-␣ activator fenofibrate. J Biol Chem 279:16154–16160 Chinetti G, Fruchart JC, Staels B 2000 Peroxisome proliferator-activated receptors (PPARs): nuclear receptors at the crossroads between lipid metabolism and inflammation. Inflamm Res 49:497–505 Lemberger T, Staels B, Saladin R, Desvergne B, Auwerx J, Wahli W 1994 Regulation of the peroxisome proliferator-activated receptor ␣ gene by glucocorticoids. J Biol Chem 269:24527–24530 Lemberger T, Saladin R, Vazquez M, Assimacopoulos F, Staels B, Desvergne B, Wahli W, Auwerx J1996 Expression of the peroxisome proliferator-activated receptor ␣ gene is stimulated by stress and follows a diurnal rhythm. J Biol Chem 271:1764–1769 Baumann H, Richards C, Gauldie J 1987 Interaction among hepatocyte-stimulating factors, interleukin 1, and glucocorticoids for regulation of acute phase plasma proteins in human hepatoma (HepG2) cells. J Immunol 139:4122–4128 Fournier T, Mejdoubi N, Lapoumeroulie C, Hamelin J, Elion J, Durand G, Porquet D 1994 Transcriptional regulation of rat ␣ 1-acid glycoprotein gene by phenobarbital. J Biol Chem 269:27175–27178
Molecular Endocrinology is published monthly by The Endocrine Society (http://www.endo-society.org), the foremost professional society serving the endocrine community.
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 14 January 2017. at 16:38 For personal use only. No other uses without permission. . All rights reserved.
