Oncogene (1999) 18, 3979 ± 3988 ã 1999 Stockton Press All rights reserved 0950 ± 9232/99 $12.00 http://www.stockton-press.co.uk/onc

Loss of expression of the candidate tumor suppressor gene ZAC in breast cancer cell lines and primary tumors Benoit Bilanges1, Annie Varrault1, Eugenia Basyuk1, Carmen Rodriguez2, Abhijit Mazumdar1, Colette Pantaloni1, JoeÈl Bockaert1, Charles Theillet2, Dietmar Spengler1,3 and Laurent Journot*,1 1 UPR 9023 CNRS, MeÂcanismes MoleÂculaires des Communications Cellulaires, CCIPE, 141 rue de la cardonille, 34094 Montpellier Cedex 05, France; 2Equipe GeÂnome et Cancer, UMR 5535 CNRS, Centre de Recherche CRLC Val d'Aurelle/Paul Lamarque, 34098 Montpellier Cedex 05, France; 3Max Planck Institute of Psychiatry, Molecular Neurobiology, Kraepelinstrasse, 2-10, 80804 Munich, Germany

Loss of chromosome 6q21-qter is the second most frequent loss of chromosomal material in sporadic breast neoplasms suggesting the presence of at least one tumor suppressor gene on 6q. We recently isolated a cDNA encoding a new zinc ®nger protein which we named ZAC according to its functional properties, namely induction of apoptosis and control of cell cycle progression. ZAC is expressed in normal mammary gland and maps to 6q24-q25, a recognized breast cancer hot spot on 6q. In the present report, we investigated the possible inactivation of ZAC in breast cancer cell lines and primary tumors. We detected no mutation in ZAC coding region in a panel of 45 breast tumors with allelic imbalance of 6q24-q25. However, a survey of eight breast cancer cell lines showed a deeply reduced (three cell lines) or complete loss of (®ve cell lines) ZAC expression. Treatment of three of these cell lines with the methylation-interfering agent 5-azacytidine induced ZAC re-expression. In addition, Northern blot and RNase protection assay analysis of ZAC expression in 23 unselected primary breast tumors showed a reduced expression in several samples. Together with its functional properties and chromosomal localization, these ®ndings substantiate ZAC as a good candidate for the tumor suppressor gene on 6q24-q25. Keywords: ZAC; breast tumors; tumor suppressor gene; methylation; 6q25

Introduction Insight into the aetiology of hereditary breast cancer made remarkable progress with the recent discovery of several susceptibility genes (Ellisen and Haber, 1998). On the other hand, the genes involved in the initiation and progression of sporadic breast tumors, which represent 95% of all mammary neoplasms, are still largely unknown. Experimental and clinical studies clearly demonstrated a role for the oestrogen receptor and HER-2/neu oncogene in the progression of breast tumors (Henderson et al., 1988; Dhingra and Hortobagyi, 1996). A role in breast tumor formation was hypothesized for candidate tumor suppressor genes (TSGs) based on the observed high frequency of

*Correspondence: L Journot Received 2 November 1998; revised 20 April 1999; accepted 22 April 1999

inactivation through loss-of-function mutation or silencing in primary tumors or tumor cell lines (Lee et al., 1988; T'Ang et al., 1988; Hollstein et al., 1994; Zou et al., 1994; Berx et al., 1995; Gra€ et al., 1995; Huynh et al., 1995, 1996; Yoshiura et al., 1995; Hankins et al., 1996; Huang et al., 1997). Involvement of other genes with established TSG function such as PTEN/MMAC1 (Rhei et al., 1997; Teng et al., 1997; Bose et al., 1998) and BRCA1 (Dobrovic and Simpfendorfer, 1997) remains to be con®rmed or is of marginal relevance in sporadic tumors. Using an original expression cloning technique (Spengler et al., 1993), we recently reported the cloning and functional characterization of a cDNA encoding a new murine zinc ®nger protein which we named Zac1 (Spengler et al., 1997). Ectopic expression of Zac1 inhibited proliferation of cell lines as evidenced by measuring colony formation, cloning in soft agar and tumor formation in nude mice. We showed that these antiproliferative properties resulted from induction of apoptosis and G1 arrest. In addition, downregulation of the endogenous Zac1 transcripts in two murine pituitary cell lines by antisense oligonucleotides treatment resulted in increased DNA synthesis (Pagotto et al., 1999), in line with Zac's antiproliferative properties. We subsequently isolated a human homologue, ZAC, which displayed similar functional properties. We showed that, despite structural differences apart from the zinc ®nger domain, mZac1 and hZAC map to syntenic regions, are indeed orthologous and display the same functional properties (Varrault et al., 1998). Whereas mZac1 expression is restricted to pituitary gland, ovary and some brain area (Spengler et al., 1997), hZAC is more widely distributed (Varrault et al., 1998). The same human gene was independently isolated by two other groups. Abdollahi and coworkers studied rat ovary surface epithelial cells, which undergo spontaneous transformation in vitro, to identify genes whose expression is lost during transformation. They isolated a new rat zinc ®nger gene which they named Lot1 for `Lost on transformation' (Abdollahi et al., 1997a). They subsequently isolated LOT, the human orthologue of the rat gene, which is identical to hZAC (Abdollahi et al., 1997b). By performing PCR with degenerated oligonucleotides, we identi®ed additional mouse and human cDNAs encoding ZAC/LOT homologues (Bilanges et al., unpublished) which were independently reported by other groups. The ®rst cDNA, PLAG1, is a gene involved in the formation of pleiomorphic adenomas of the salivary gland (Kas et al., 1997; Voz et al., 1998;

ZAC downregulation in breast tumors B Bilanges et al

3980

AÊstroÈm et al., 1999). The same laboratory recently reported again independently the cloning of ZAC/LOT and named it PLAGL1 (Kas et al., 1998). The second cDNA, KIAA0198 which is still of unknown function, was ®rst isolated during the course of a random cDNA sequencing project (Nagase et al., 1996). We and others localized ZAC on 6q24-q25 (Abdollahi et al., 1997b; Varrault et al., 1998) which was con®rmed by mapping of corresponding ESTs on the human genomic map between D6S308 and D6S978 (2.2 cM; &1.6 ± 2.0 Mb) (Schuler et al., 1996; Deloukas et al., 1998). Interestingly, a survey of karyotypic abnormalities in 508 breast carcinomas revealed that loss of genetic material was most frequent for 1p22-36 and 6q21-qter (Mertens et al., 1997). Frequent loss at 6q was con®rmed by comparative genomic hybridization (Nishizazki et al., 1997) and allelotyping of human breast neoplasms (Devilee et al., 1991). More recent studies using a larger number of microsatellite markers suggested the presence of at least three regions of frequent allelic imbalance at 6q13, 6q24-q25 and 6q27 (Orphanos et al., 1995; Noviello et al., 1996; Sheng et al., 1996; Theille et al., 1996; Chappell et al., 1997). A study with microdissected breast cancer tissues indicated that allelic loss at 6q23-q25.2 could be observed in up to 80% of the samples (Fuji et al., 1996). The presence of at least one TSG on 6q has been further strengthened by microcell-mediated chromosome transfer experiments (Negrini et al., 1994; Theille et al., 1996). Altogether, these data indicate that chromosome 6q is likely to harbor several tumor suppressor genes and that 6q23-q25 is an important hot spot in breast cancer. However, no

candidate gene has been reported to reside in this chromosomal region so far. Because of its functional properties, its chromosomal localization on 6q24-q25 and its expression in normal breast tissue, we hypothesized that ZAC may be the tumor suppressor on 6q23-q25 and undertook analysis of ZAC status in normal and tumoral human breast samples.

Results ZAC is expressed in mammary epithelial cells Our previous study (Varrault et al., 1998) demonstrated that ZAC is widely expressed in human tissues in contrast to what we observed in mouse (Spengler et al., 1997). We evidenced the highest level of expression in the pituitary gland. Other tissues, including mammary gland, displayed easily detectable signals. These experiments however, did not formally prove that ZAC was expressed in mammary epithelial cells from which the vast majority of breast tumors originates. To evaluate ZAC expression in normal mammary epithelial cells vs stromal cells, we performed in situ hybridization on normal mammary glands with digoxigenin-labeled RNA probes. Using an antisense ZAC probe, the mammary ducts were strongly labeled (Figure 1a). The most luminal cells were the most intensively and consistently labeled (Figure 1a and c). No labeling was observed with the corresponding sense probe (Figure 1b and d). The sections were counterstained with DAPI to visualize all nucleated cells,

Figure 1 ZAC expression in normal mammary epithelial cells. In situ hybridization on normal mammary gland sections (mammoplasty reduction) was performed with digoxigenin-labeled RNA probes. The antisense probe (a and c) labeled exclusively epithelial cells, most consistently in the most luminal layer. No labeling was observed with the sense probe (b and d). Magni®cation: (a and b) 40-fold; (c and d) 100-fold

ZAC downregulation in breast tumors B Bilanges et al

including ®broblasts and adipocytes, and we con®rmed that ZAC labeling is limited to ductal cells (data not shown). ZAC is not frequently mutated in breast tumors To assess ZAC status in breast tumors, we selected a panel of 45 breast tumor samples which we showed to display LOH with microsatellite markers located in the 6q23-q25 region, D6S314, D6S310, D6S308, D6S409 and D6S311 (Table 1). Markers D6S308 and D6S978 which ¯ank ZAC locus are included in the D6S310D6S311 interval. The coding region of ZAC is entirely comprised in two exons (Varrault et al., unpublished) and was ampli®ed from the remaining allele of each tumor and from paired peripheral blood lymphocytes with eight primer pairs (Figure 2). The resulting overlapping amplicons ranged in size from 282 bp to 336 bp and were analysed for the presence of mutations by single strand conformation polymorphism (SSCP ± PCR). No mutation nor nucleotide polymorphism was detected (Figure 2 and data not shown). These results were con®rmed by sequencing the entire ZAC coding exons from four tumor samples (4178, 4534, 1627, 4057) displaying LOH with all ®ve microsatellite markers (Table 1). We also performed sequencing of ZAC coding region on genomic DNA

Table 1 Pattern of loss of heterozygosity observed using ®ve microsatellite markers at 6q23-q25 from 45 selected breast tumors used in the SSCP analysis of ZAC coding exons

isolated from eight breast cancer cell lines, namely CAL51, MDA-MB-157, MDA-MB-231, MDA-MB453, MCF-7, T47D, ZR-75-1 and SK-BR-3. Again, we detected no mutation in any of these cell lines (data not shown). These data indicate that the coding region of ZAC is not frequently mutated, neither in primary breast tumors nor in breast cancer cell lines. Because of the limitations of the SSCP ± PCR technique which routinely unveil about 80% of the existing mutations, we can however not exclude that a certain proportion of breast tumors indeed contains a mutated ZAC gene and this issue will deserve further study. ZAC expression is frequently lost or downregulated in breast tumor-derived cell lines We then evaluated the level of ZAC expression in breast cancer cell lines and tumor samples. We performed Northern blotting with poly(A+) RNA prepared from pituitary gland and total RNA prepared from normal mammary glands, mammary epithelial cells (hMEC) grown in vitro and breast tumor-derived cell lines (Figure 3a). Using a full length ZAC cDNA probe we detected several ZAC transcripts ranging in size from &3 kb to &8 kb in pituitary gland and in a pool of eight mammary glands, suggesting the presence of alternatively spliced mRNA and/or the use of di€erent promoters and/or polyadenylation sites. However, only the major &4 kb transcript was detected in the sample derived from a single mammary gland used in the right panel of Figure 3, suggesting variations in the pattern of ZAC transcripts among individuals. Interestingly, we could not detect ZAC mRNA in ®ve (MDA-MB-231, MDAMB-453, T47D, ZR-75-1, SK-BR-3) out of eight cell lines (Figure 3a). A very weak signal could be detected in MCF-7 (Figure 3a) and was more visible on longer exposure (data not shown). The two remaining cell lines (CAL51, MDA-MB-157) as well as the hMEC displayed a lower level of ZAC expression compared to normal breast tissue (Figure 3a). Using the more sensitive RNase protection assay (RPA) technique, we con®rmed the down-regulation of ZAC in CAL51 and MDA-MB-157, the very weak expression in MCF-7 and the loss of expression in the remaining ®ve cell lines (Figure 3a). To improve the sensitivity of the detection, we used the reverse transcriptase-polymerase chain reaction (RT ± PCR) technique under saturating conditions (35 cycles) with primers located in ZAC 5' untranslated and coding regions (Figure 3a). Again, the same ®ve cell lines were found negative. ZAC loss of expression may result from aberrant gene methylation

Keys: White box, not informative; light gray box, no allelic imbalance (AI); light hatched gray box, 15%5AI530%; hatched black box, AI430%; *tumors from which ZAC coding exons were sequenced

Reduced ZAC expression potentially results from at least two mechanisms, homozygous deletion or gene silencing. In the breast cancer cell lines which we used in this study, homozygous deletion was excluded, at least in the coding exons, because ZAC coding region was successfully ampli®ed and sequenced from genomic DNA (cf. supra). We therefore investigated whether ZAC loss of expression could result from gene methylation. We treated the breast cancer cell lines with the methylation interfering agent 5-azacytidine (AzaC) and compared ZAC expression in control and

3981

ZAC downregulation in breast tumors B Bilanges et al

3982

Figure 2 SSCP ± PCR analysis of ZAC in breast tumors. A panel of 45 breast tumors displaying loss of heterozygosity with markers in the 6q23-q25 region were screened for ZAC mutations using eight pairs of PCR primers. The location of the resulting amplicons relative to ZAC coding region (black box), the sequences of the primers and representative examples of SSCP gels are shown

treated cells. In MDA-MB-231 cells, ZAC expression was ®rst detected after 1 day of treatment, peaked at 3 ± 5 days and remained elevated up to 14 days when the experiment was stopped because cells displayed signs of impaired viability (Figure 4). We treated the eight breast cancer cell lines with AzaC for 5 days before total RNAs were prepared and ZAC expression assessed by RT ± PCR. Out of the ®ve ZAC negative cell lines, three cell lines (MDA-MB231, ZR-75-1 and SK-BR-3) displayed ZAC expression after AzaC treatment whereas two cell lines (MDA-MB-453 and T47D) remained negative (Figure 5). The three cell lines which were shown to express ZAC under control conditions (CAL51, MDA-MB-157 and MCF-7) displayed enhanced ZAC expression after AzaC treatment. Similar results were obtained with 5-aza-2'deoxycytidine (data not shown). The estrogen receptor was used as a control in all experiments (Figure 5) and we con®rmed that MCF-7, T47D and ZR-75-1 expressed ER whereas the other cell lines were ER negative. We also con®rmed that AzaC treatment induced ER expression in SK-BR-3 and MDA-MB231 cells. Altogether, these data indicate that ZAC is expressed in normal mammary epithelial cells and that

its expression is lost or reduced in a large proportion of cell lines derived from breast tumors, potentially by gene methylation. ZAC expression is dowregulated in primary breast tumors These ®ndings on established tumor cell lines prompted us to test whether loss of ZAC expression may be a relevant mechanism for ZAC inactivation in vivo during tumorigenesis. We performed Northern blot analysis of total RNA prepared from 23 unselected breast tumor samples. Data showed that ZAC was expressed at highly variable levels. Some samples displayed easily detectable levels of ZAC mRNA whereas it was barely detectable in others (Figure 6a and data not shown). Using the more quantitative RPA analysis, we compared the level of expression of ZAC in normal mammary gland with those observed in one tumor expressing `high levels' of ZAC (#4289) and in one tumor where ZAC mRNA was hardly detectable (#4009) (Figure 6b). To exclude that the observed di€erences may be related to individual variations rather than to an actual loss of expression, we

ZAC downregulation in breast tumors B Bilanges et al

monitored ZAC expression in a panel of six normal mammary breast samples (®ve mammoplasty reductions and a pool of four sudden death). Three independent RPA analysis of these samples indicated only slight variations of the ZAC/actin ratio: average (%) +standard deviation=100+17; range: 73 ± 143%. Using these normalized values, values for Figure 6b translate as follows: mammary gland=122%; #4009=46%; #4289=84%. Altogether, these data suggest that ZAC expression was notably reduced in several of the primary breast tumor samples analysed in this study. Discussion ZAC encodes a new zinc ®nger protein with antiproliferative properties which proceed from induction of apoptosis and control of cell cycle progression. ZAC is located on chromosome 6q24-q25, a region known to harbor a tumor suppressor gene of critical importance for the initiation and/or progression of breast and ovary tumors and melanoma. Our previous work (Varrault et al., 1998), indicated that ZAC is expressed in the mammary gland, in agreement with data published by Abdollahi and co-workers (1997b).

Figure 4 Time course of ZAC induction by 5-azacytidine treatment of MDA-MB-231 cells. MDA-MB-231 cells were treated for the indicated period of time with 2 mM 5-azacytidine (AzaC) before total RNA were prepared and subjected to RT ± PCR. ZAC expression peaked at 3 ± 5 days and remained elevated for 14 days when cells started to display signs of impaired viability

Figure 3 Analysis of ZAC expression in mammary epithelial cells grown in vitro and in breast tumor-derived cell lines. (a) 0.5 mg of pituitary gland poly(A+) RNA and 20 mg of total RNA from normal mammary glands, mammary epithelial cells grown in vitro for three or ten passages, or breast tumor-derived cell lines were subjected to Northern blot analysis with a ZAC full length probe. A pool of eight mammary glands displayed signals corresponding to multiple RNA species ranging in size from approximately 3 ± 8 kb. Another mammary gland sample displayed only one transcript indicating individual variations. Mammary epithelial cells grown in vitro as well as CAL51, MDA-MB-157 and MCF-7 breast tumor-derived cell lines displayed a reduced level of ZAC mRNA compared to normal mammary gland. ZAC expression could not be detected in the remaining cell lines (MDA-MB-231, MDA-MB-453, T47D, ZR75-1 and SK-BR-3). Equal loading is documented by ethidium

bromide staining of the RNA gel. (b) RNase protection assay of total RNA prepared from eight breast tumor-derived cell lines. Two di€erent exposures of the same gel are shown. CAL51 and MDA-MB-157 cell lines displayed a reduced ZAC expression, MCF-7 cells exhibited a weak signal upon long exposure and the remaining cell lines did not express any detectable ZAC mRNA. (c) Total RNA isolated from the same samples as above were reverse transcribed and subjected to PCR ampli®cation with primers located in ZAC 5' untranslated and coding regions. Resulting amplicons (315 bp) were electrophoresed through a 1.5% agarose gel and stained with ethidium bromide. This experiment con®rmed the absence of detectable level of ZAC mRNA in MDA-MB-231, MDA-MB-453, T47D, ZR-75-1 and SK-BR-3 cell lines. Primers speci®c for b-actin were used as a control to document equal loading of RT products. PCR was performed under saturating conditions for ZAC (35 cycles) and exponential conditions for b-actin (25 cycles)

3983

ZAC downregulation in breast tumors B Bilanges et al

3984

Figure 5 ZAC induction by 5-azacytidine treatment of breast tumor-derived cell lines. Cells were treated for 5 days with 2 mM 5-azacytidine before total RNA were prepared and subjected to RT ± PCR. ZAC expression was induced in MDA-MB-231, ZR75-1 and SK-BR-3 cell lines and enhanced in CAL51, MDA-MB157 and MCF-7 cell lines. MDA-MB-453 and T47D remained ZAC negative after 5-azacytidine treatment. Expression of the estrogen receptor (ER) and b-actin was monitored in parallel PCR reactions

Because most breast tumors originate from epithelial cells, it was of critical importance to determine which subtype of mammary cells express ZAC. Unlike what one might intuitively expect, and unlike strati®ed epithelial tissues, the majority of breast tumor cells in vivo and tumor cell lines in vitro have the phenotype of the most mature and less proliferative epithelial cells residing in the most luminal layer (Taylor-Papadimitriou et al., 1989; Rejthar and Nenutil, 1997; Malzahn et al., 1998). Our in situ hybridization experiments showed that ZAC is expressed in normal epithelial cells, most abundantly in the most luminal cells (Figure 1a and c). Because of (1) its expression in normal mammary epithelial cells (2) its chromosomal localization on 6q24-q25, a recognized breast cancer hot spot and (3) its functional properties compatible with a TSG function, we hypothesized that ZAC might be involved in breast tumor formation or progression. We therefore evaluated ZAC inactivation in human primary breast tumors and cell lines. At present, the most prevalent mechanism for inactivation of TSGs in neoplasms was proposed by Knudson for the retinoblastoma susceptibility gene (RB) in familial forms of retinoblastoma and popularized as the `twohit hypothesis' (Knudson, 1971, 1985, 1993). It was subsequently shown that the same mechanism apply to the inactivation of other TSGs in several sporadic neoplasms. According to this model, the inactivation of a TSG in cancer cells involves loss of chromosomal material harboring one allele and lossof-function mutation of the remaining allele. We selected a panel of 45 breast tumors displaying LOH around the D6S310 marker which is located in the vicinity of hZAC. We performed SSCP analysis and direct sequencing of genomic DNA isolated from these tumors. Our results indicate that ZAC is not mutated in its coding region or in the intronic regions surrounding the coding exons which indicates that it is unlikely to conform to the two-hit hypothesis. Retinoblastoma provides a paradigm for loss-offunction mutations in carcinogenesis and for relating familial and sporadic forms of cancer. However,

Figure 6 ZAC expression in primary breast tumors. (a) 20 mg of total RNA prepared from primary breast tumors were subjected to Northen blot analysis using a full length ZAC probe. Equal loading and integrity of all samples is documented by hybridization of the same membrane with a GAPDH probe. Primary breast tumors express greatly varying levels of ZAC mRNA. (b) Comparison of ZAC expression level in normal mammary gland vs two primary tumor samples. 20 mg of total RNA prepared from four pooled normal mammary glands, tumor #4009 and tumor #4289 were subjected to RPA analysis

other types of tumors appear more complex and other mechanisms of TSG inactivation have been recently proposed. This is particularly well exempli®ed for the cyclin-dependent kinase inhibitor gene P16/INK4a/CDK2/MTS1. The presence of P16 germline mutations in a large proportion of families with hereditary melanoma (Hussussian et al., 1994; Kamb et al., 1994b; Fitzgerald et al., 1996) strongly supports a TSG function for P16. However, P16 mutations are rare in sporadic tumors (Cairns et al., 1994) and P16 was found to be more prevalently inactivated by homozygous deletion (Kamb et al., 1994a) or gene silencing (Gonzalez-Zulueta et al., 1995; Herman et al., 1995; Merlo, 1995). Homozygous deletion was clearly established for recently discovered TSGs such as DPC4/SMAD4 (Hahn et

ZAC downregulation in breast tumors B Bilanges et al

al., 1996) and DMBT1 (Mollenhauer et al., 1997). Gene silencing involves methylation of a genomic region, usually in the promoter and/or in the ®rst intron. In addition to P16, such a mechanism was suggested in silencing of other established TSGs such as RB (Ohtani-Fujita et al., 1993; Stirzaker et al., 1997) and VHL (Herman et al., 1994). We therefore examined whether ZAC is inactivated by loss of expression resulting from one of the above mentioned mechanisms. Northern blot, RPA and RT ± PCR analysis of total RNA prepared from eight breast tumor cell lines revealed that ZAC mRNA could not be detected in ®ve cell lines (Figure 3). In three other cell lines, ZAC was expressed at a reduced level compared to whole mammary gland. Since we compared cancer cell lines with a heterogenous tissue where ZAC is expressed in only a subset of cells, namely the epithelial cells, we concluded that ZAC was severely downregulated in CAL51, MDA-MB-157 and MCF-7 cell lines vs normal epithelial cells from which these cell lines are derived. Altogether our data show that ZAC expression is lost or downregulated in all breast tumor cell lines examined in this study. We also showed that ZAC is downregulated in human mammary epithelial cells (hMEC) grown in vitro. These cells are derived from reduction mammoplasty tissues by growing mammary epithelial cells in a speci®c medium. They have the capacity to grow in vitro for a limited number of passages and senesce around passage 20. Interestingly, we found that hMEC display a reduced ZAC mRNA level after three or ten passages in vitro (Figure 3). This is reminiscent of the report by Abdollahi and co-workers using rat ovarian surface epithelial cells in vitro (Abdollahi et al., 1997a). In this model, they demonstrated that the rat ZAC orthologue was partially or completely lost upon spontaneous transformation and hence named it Lot1 for `Lost on transformation'. We found that ZAC downregulation is not limited to cells grown in vitro since we also showed downregulation in several primary breast tumor samples vs whole mammary tissue (Figure 6). Because of the heterogeneity of such samples which contain tumoral cells as well as an unde®ned proportion of normal epithelial cells, one can estimate that the level of ZAC mRNA detected in primary breast tumor samples is systematically overestimated with regard to ZAC expression level in tumoral cells only. Future work aimed at con®rmation of ZAC loss of expression in breast tumors will include in situ hybridization and immunohistochemical staining of primary tumor sections. As far as the mechanism responsible for the partial or complete loss of expression of ZAC is concerned, homozygous deletion of ZAC coding region could be excluded in breast tumor cell lines since we ampli®ed and sequenced the corresponding genomic region. On the other hand, treatment of the breast tumor cell lines with the methylation interfering agent AzaC reinduced ZAC expression in three out of ®ve ZAC negative cell lines and reinforced ZAC expression in three ZAC positive cell lines. This indicates that ZAC loss of expression is at least in part due to gene methylation. This may result from either a direct methylation of ZAC or from an indirect e€ect due to

the aberrant methylation of a gene controlling ZAC expression. Elucidation of this issue will require the determination of ZAC gene structure and mapping of its promoter region. Regarding the two ZAC-negative cell lines which remained negative after AzaC treatment (MDA-MB-453 and T47D), this does not necessarily indicate that ZAC gene is not aberrantly methylated in these cell lines. Herman and co-workers (1994) demonstrated that VHL expression could be reinduced by AzaC treatment in only one out of ®ve renal carcinoma cell lines for which methylation of VHL could be demonstrated. Alternatively, the absence of reinduction by AzaC may indicate that ZAC promoter is no longer functional in these cell lines, for instance as the consequence of mutation, deletion or acetylation. Mapping of ZAC promoter region will be necessary before its precise mechanism of inactivation could be tested. Because methylation of the oestrogen receptor (ER) gene has also been suggested as a mechanism involved in breast tumor formation (Ottaviano et al., 1994; Petrangeli et al., 1995), we concurrently analysed ZAC and ER expression (Figure 5). We could not establish a direct correlation between ZAC and ER expression neither under control conditions nor after AzaC treatment. This suggests that despite their relative vicinity on chromosome 6q (6q24-q25 vs 6q25.1), ZAC and ER are not methylated by a concerted mechanism in breast tumor cell lines. Altogether, our data indicate a frequent complete or partial loss of ZAC expression both in breast tumor cell lines in vitro and in primary breast tumors in vivo. What might be the relevance of these observations with respect to breast tumor formation and/or progression? Reports on P16, DPC4, DMBT1, RB and VHL inactivation in sporadic tumors by homozygous deletion or gene silencing demonstrate that complete loss of expression of certain TSGs eventually leads to tumorigenesis in vivo. The relevance of TSG hypermethylation is further illustrated by the recent demonstration that hypermethylation of p16 promoter is an early event in lung adenocarcinomas which was frequently detected in precursor lesions, adenomas and hyperplastic lesions (Belinsky et al., 1998). Furthermore, two recent reports suggest that hemizygosity at two TSG loci, resulting in haploinsuciency, is sucient to compromise control of cell proliferation and to induce tumor formation in vivo. In the ®rst report, analysis of thyroid papillary or colon adenoma from Pten+/7 mice suggested that tumorigenesis could take place in the presence of an intact Pten allele (Di Cristofano et al., 1998). In the second report (Venkatachalam et al., 1998) Venkatachalam and co-workers genotyped tumors derived from p53 +/7 mice and found that 50% of such tumors retained an intact and functional p53 allele. Data presented in the above mentioned report suggested that the gene dosage e€ect likely resulted from impaired p53s ability to control cell proliferation and survival. In this view, due to its antiproliferative properties, ZAC loss of expression in premalignant epithelial cells may similarly contribute to the initiation or progression of breast tumors. Analysis of Zac1 knock-out mice will be a valuable tool to investigate further a role for Zac1 in tumor formation and/or progression.

3985

ZAC downregulation in breast tumors B Bilanges et al

3986

Materials and methods Cell culture and AzaC treatment All culture media and sera were from Life Technologies (Cergy Pontoise, France). MDA-MB-157, MDA-MB-231, MDA-MB-453, CAL-51, MCF-7, T47D and SK-BR-3 cells were maintained in our laboratory in DMEM with 10% FCS. ZR-75-1 cells were cultured in RPMI 1640 with 5% FCS. The cells were exposed for 1 ± 14 days to either 0.5 mM 5-aza-2' deoxcytidineC or 2 mM or 5 mM 5-azacytidine (SigmaAldrich, L'Isle-d'Abeau Chesnes, France). The drugs were freshly dissolved in distilled water and cells were treated with the appropriate doses of drug every 2 days upon medium renewal. In situ hybridization Normal breast samples were obtained from surgically removed breast tissues (mammoplasty reduction), frozen in isopentane and stored at 7808C until further proceeding. In situ hybridization with digoxigenin-labeled cRNA probes was performed as previously described (Schaeren-Wiemers and Ger®n-Moser, 1993). pBS-hZAC (Varrault et al., 1998) was PCR ampli®ed with primers ghZ-5 and ghZ-6 (Table 2). The resulting amplicon was subcloned into pGEM with pGEM-T vector system I (Promega, Lyon, France), linearized and in vitro transcribed in the presence of DIG-UTP. Tumor allelotyping The primary breast tumor samples were obtained from Val d'Aurelle Cancer Center, Montpellier. Allelotyping of breast tumors was performed as previously described (Noviello et al., 1996) PCR ± SSCP analysis ZAC coding region was ampli®ed from breast tumors and peripheral blood lymphocytes genomic DNA by PCR using eight overlapping primer pairs (Figure 2). Amplicons were screened for mutation by single strand conformation polymorphism (SSCP) with a Multiphor apparatus (Pharmacia, Orsay, France) using Excelgel (Pharmacia, Orsay, France) runned at 20, 15 or 98C and Cleangel (ETC, Germany) at 20, 15 or 98C. Examples of SSCP gels are shown in Figure 2. DNA sequencing PCR products ampli®ed from genomic DNA prepared from cell lines and tumors samples were directly sequenced with the Thermosequenase radiolabeled terminator cycle sequencing Kit (Amersham, Les Ulis, France). Northern blots Total RNA were prepared from mammoplasty reduction tissues, cell lines and tumor samples as described previously (Chomczynski and Sacchi, 1987). Pituitary poly(A+) RNA and total RNA prepared from eight pooled normal mammary glands (sudden death) were from Clontech (Palo

Alto, CA, USA). Total RNA samples at 20 mg and poly(A+) RNA at 0.5 mg per lane were resolved in a formaldehyde gel and analysed according to standard Northern blot protocols using Church's hybridization bu€er (Church and Gilbert, 1984). The blot was probed with a full length ZAC cDNA probe (Varrault et al., 1998). RNase protection assay Amplicons ghZ-5/ghZ-6 from ZAC and pACT-5' (ggctacagcttcaccaccac)/pACT-3' (tccacgtcgcacttcat) from b-actin were subcloned into pGEM-T vector. The linearized vectors were in vitro transcribed with T7 RNA polymerase in the presence of [a-32P]UTP. In case of actin probe, unlabeled UTP was added to decrease speci®c activity of the corresponding probe. Total RNA from breast tumor-derived cell lines (50 mg), primary breast tumors (20 mg) or normal mammary tissue (20 mg) were hybridized overnight at 428C with 2 fmol of gel-puri®ed antisense probes (ZAC 380 bp; bactin 256 bp). Hybrids were digested with RNase A and RNase T1 according to the instructions of the manufacturer (RPAII Kit, Ambion, Inc., Austin, Texas, USA). The protected fragment (ZAC 304 bp; b-actin 190 bp) were analysed by PAGE through a 5% acrylamide/8 M urea gel. RT ± PCR One mg of total RNA was reverse transcribed using random hexamers, dNTP and the MoMuLV-RT according to the manufacturer's instructions (Life Technologies, Cergy Pontoise, France) in a 20 ml reaction. Two ml RT products were ampli®ed with primers located in ZAC 5' untranslated region (ghZ-1: 5' tggcacagcatttggtca) and coding region (ghZ-2 5' gttggggtcgtgggtctgga). The cycling parameters for amplification of the cDNAs were 35 cycles at 948C for 30 s, 568C for 30 s and 728C for 30 s. The estrogen receptor cDNA was ampli®ed as previously described (Ferguson et al., 1995).

Acknowledgments We gratefully acknowledge the gifts of mammoplasty reduction tissues by Dr J-P Reynaud, total RNA from hMEC grown in vitro by Dr P Yaswen and MDA-MB-231 cell line by Dr F Vignon. We are grateful to Laurent Charvet for preparation of artwork. B Bilanges is a recipient of a predoctoral fellowship from the MinisteÁre de l'Education Nationale, de la Recherche et de la Technologie. E Basyuk is a recipient of a postdoctoral fellowship from the MinisteÁre des A€aires EtrangeÁres. A Mazumdar is a recipient of postdoctoral fellowships from la Fondation pour la Recherche MeÂdicale and l'Association pour la Recherche contre le Cancer. D Spengler was supported by grant Sp 386/3-1 from the Deutsche Forschungsgemeinschaft. This work was supported by grant ACC-SV4/9504087 from the MinisteÁre de l'Education Nationale, de la Recherche et de la Technologie, grants from the Centre Nationale de la Recherche Scienti®que, La Ligue Nationale contre le Cancer and L'Association pour la Recherche contre le Cancer.

References Abdollahi A, Godwin AK, Miller PD, Getts LA, Schultz DC, Taguchi T, Testa JR and Hamilton TC. (1997a). Cancer Res., 57, 2029 ± 2034. Abdollahi A, Roberts D, Godwin AK, Schultz DC, Sonoda G, Testa JR and Hamilton TC. (1997b). Oncogene, 14, 1973 ± 1979.

AÊstroÈm A-K, Voz ML, Kas K, RoÈijer E, Wedell B, Mandahl N, Van de Ven W, Mark J and Stenman G. (1999). Cancer Res., 59, 918 ± 923. Belinsky SA, Nikula KJ, Palmisano WA, Michels R, Saccomanno G, Gabrielson E, Baylin S and Herman JG. (1998). Proc. Natl. Acad. Sci. USA, 95, 11891 ± 11896.

ZAC downregulation in breast tumors B Bilanges et al

Berx G, Cleton-Jansen A-M, Nollet F, de Leeuw WJF, van de Vijer M, Cornelisse C and van Roy F. (1995). EMBO J., 14, 6107 ± 6115. Bose S, Wang SI, Terry MB, Hibshoosh H and Parsons R. (1998). Oncogene, 17, 123 ± 127. Cairns P, Mao L, Merlo A, Lee DJ, Schwab D, Eby Y, Tokino K, van der Riet P, Blaugrund JE and Sidransky D. (1994). Science, 265, 415 ± 416. Chappell SA, Walsh T, Walker RA and Shaw JA. (1997). Br. J. Cancer, 75, 1324 ± 1329. Chomczynski P and Sacchi N. (1987). Anal. Biochem., 162, 156 ± 159. Church GM and Gilbert W. (1984). Proc. Natl. Acad. Sci. USA, 81, 1991 ± 1995. Deloukas P, Schuler G, Gyapay G, Beasley E, Soderlund C, Rodriguez-Tome P, Hui L, Matise T, McKusick K, Beckmann J, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle A, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Bentley DR et al. (1998). Science, 242, 744 ± 746. Devilee P, van Vliet M, van Sloun P, Dijkshoorn NK, Hermans J, Pearson PL and Cornelisse CJ. (1991). Oncogene, 6, 1705 ± 1711. Dhingra K and Hortobagyi GN. (1996). Semin. Oncol., 23, 436 ± 445. Di Cristofano A, Pesce B, Cordon-Cardo C and Pandol® PP. (1998). Nature Genet., 19, 348 ± 355. Dobrovic A and Simpfendorfer D. (1997). Cancer Res., 57, 3347 ± 3350. Ellisen LW and Haber DA. (1998). Ann. Rev. Med., 49, 425 ± 436. Ferguson AT, Lapidus RG, Baylin SB and Davidson NE. (1995). Cancer Res., 55, 2279 ± 2283. Fitzgerald MG, Harkin DP, Silva-Arrieta S, MacDonald DJ, Lucchna LC, Unsal H, O'Neill E, Koh J, Finkelstein DM, Isselbacher KJ, Sober AJ and Haber DA. (1996). Proc. Natl. Acad. Sci. USA, 93, 8541 ± 8545. Fuji H, Zhou W and Gabrielson E. (1996). Gene Chrom. Cancer, 16, 35 ± 39. Gonzalez-Zulueta M, Bender CM, Yang AS, Nguyen T, Beart RW, Van Tornout JM and Jones PA. (1995). Cancer Res., 55, 4531 ± 4535. Gra€ JR, Herman JG, Lapidus RG, Chopra H, Xu R, Jarrard DF, Isaacs WB, Pitha PM, Davidson NE and Baylin SB. (1995). Cancer Res., 55, 5195 ± 5199. Hahn SA, Schutte M, Hoque ATMS, Moskaluk CA, da Costa LT, Rozenblum E, Weinstein CL, Fischer A, Yeo CJ, Hruban RH and Kern SE. (1996). Science, 271, 350 ± 353. Hankins GR, De Souza AT, Bentley RC, Patel MR, Marks JR, Iglehart JD and Jirtle RL. (1996). Oncogene, 12, 2003 ± 2009. Henderson BE, Ross R and Berstein L. (1988). Cancer Res., 48, 246 ± 253. Herman JG, Latif F, Weng Y, Lerman MI, Zbar B, Liu S, Samid D, Duan D-S, Gnarra JR, Linehan WM and Baylin SB. (1994). Proc. Natl. Acad. Sci. USA, 91, 9700 ± 9704. Herman JG, Merlo A, Mao L, Lapidus RG, Issa J-PJ, Davidson NE, Sidransky D and Baylin SB. (1995). Cancer Res., 55, 4525 ± 4530. Hollstein M, Rice K, Greenblatt MS, Soussi T, Fuchs R, Sorlie T, Hovig E, Smith-Sorenssen B, Montesano R and Harris CC. (1994). Nucl. Acid Res., 22, 3551 ± 3555. Huang R-P, Fan F, De Belle I, Niemeyer C, Gottardis MM, Mercola D and Adamson ED. (1997). Int. J. Cancer, 72, 102 ± 109. Hussussian CJ, Struewing JP, Goldstein AM, Higgins PA, Ally DS, Sheahan MD, Clark WHJ, Tucker MA and Dracopoli NC. (1994). Nature Genet., 8, 15 ± 21. Huynh H, Alpert L and Pollak M. (1996). Cancer Res., 56, 4865 ± 4870.

Huynh HT, Larsson C, Narod S and Pollak M. (1995). Cancer Res., 55, 2225 ± 2231. Kamb A, Gruis NA, Weaver-Feldhaus J, Liu Q, Harshman K, Tavtigian SV, Stockert E, Day III RS, Johnson BE and Skolnick MH. (1994a). Science, 264, 436 ± 440. Kamb A, Shattuck-Eidens D, Eeles R, Liu Q, Gruis NA, Ding W, Hussey C, Tran T, Miki Y, Weaver-Feldhaus J, McClure M, Aitken JF, Anderson DE, Bergman W, Frants R, Goldgar DE, Green A, MacLennan R, Martin NG, Meyer LJ, Youl P, Zone JJ, Skolnick MH and Cannon-Albright LA. (1994b). Nature Genet., 8, 22 ± 26. Kas K, Voz ML, Hensen K, Meyen E and Van de Ven WJM. (1998). J. Biol. Chem., 273, 23026 ± 23032. Kas K, Voz ML, RoÈijer E, AÊstrom A-K, Meyen E, Stenman G and Van de Ven WJM. (1997). Nature Genet., 15, 170 ± 174. Knudson AG. (1971). Proc. Natl. Acad. Sci. USA, 68, 820 ± 823. Knudson AG. (1985). Cancer Res., 45, 1437 ± 1443. Knudson AG. (1993). Proc. Natl. Acad. Sci. USA, 90, 10914 ± 10921. Lee E-H, To H, Shew J-Y, Bookstein R, Scully P and Lee WH. (1988). Science, 241, 218 ± 221. Malzahn K, Mitze M, Thoenes M and Moll R. (1998). Virchows Arch., 433, 119 ± 129. Merlo A. (1995). Nature Med., 1, 686 ± 692. Mertens F, Johansson B, HoÈglund M and Mitelman F. (1997). Cancer Res., 57, 2765 ± 2780. Mollenhauer J, Wiemann S, Scheurlen W, Korn B, Hayashi Y, Wilgenbus KK, von Deimling A and Poustka A. (1997). Nature Genet., 17, 32 ± 39. Nagase T, Seki N, Ishikawa K-I, Tanaka A and Nomura N. (1996). DNA Res., 3, 17 ± 24. Negrini M, Sabbioni S, Possati L, Rattan S, Corallini A, Barbanti-Brodano G and Croce CM. (1994). Cancer Res., 54, 1331 ± 1336. Nishizazki T, DeVries S, Chew K, Goodson III WH, Ljung B-M, Thor A and Waldman FM. (1997). Gene Chrom. Cancer. 19, 267 ± 272. Noviello C, Courjal F and Theillet C. (1996). Clin. Cancer Res., 2, 1601 ± 1606. Ohtani-Fujita N, Fujita T, Aoike A, Osifchin NE, Robbins PD and Sakai T. (1993). Oncogene, 8, 1063 ± 1067. Orphanos V, McGown G, Hey Y, Boyle JM and SantibanezKoref M. (1995). Br. J. Cancer, 71, 290 ± 293. Ottaviano YL, Issa J-PJ, Parl FF, Smith HS, Baylin SB and Davidson NE. (1994). Cancer Res., 54, 2552 ± 2555. Pagotto U, Arzberger T, Ciani E, Lezlouac'h F, Pilon C, Journot L, Spengler D and Stalla GK. (1999). Endocrinology, 140, 987 ± 996. Petrangeli E, Lubrano C, Ravenna L, Vacca A, Cardillo MR, Salvatori L, Sciarra F, Frati L and Gulino A. (1995). Br. J. Cancer, 72, 973 ± 975. Rejthar A and Nenutil R. (1997). Neoplasma, 44, 370 ± 373. Rhei E, Kang L, Bogomolniy F, Federici MG, Borgen PI and Boyd J. (1997). Cancer Res., 57, 3657 ± 3699. Schaeren-Wiemers N and Ger®n-Moser A. (1993). Histochemistry, 100, 431 ± 440. Schuler GD, Boguski MS, Stewart EA, Stein LD, Gyapay G, Rice K, White RE, Rodriguez-Tome P, Aggarwal A, Bajorek E, et al. (1996). Science, 274, 540 ± 546. Sheng ZM, Marchetti A, Buttitta F, Chapene M-H, Campani D, Bistocchi M, Lidereau R and Callahan R. (1996). Br. J. Cancer, 73, 144 ± 147. Spengler D, Villalba M, Ho€mann A, Pantaloni C, Houssami S, Bockaert J and Journot L. (1997). EMBO J., 16, 2814 ± 2825. Spengler D, Waeber C, Pantaloni C, Holsboer F, Bockaert J, Seeburg PH and Journot L. (1993). Nature, 365, 170 ± 175.

3987

ZAC downregulation in breast tumors B Bilanges et al

3988

Stirzaker C, Millar DS, Paul CL, Warnecke PM, Harrison J, Vincent PC, Frommer M and Clark SJ. (1997). Cancer Res., 57, 2229 ± 2237. T'Ang A, Varley JM, Chakraborty S, Murphee AL and Fung Y-K. (1988). Science, 242, 218 ± 221. Taylor-Papadimitriou J, Stampfer M, Bartek J, Lewis A, Boshell M, Lane EB and Leigh IM. (1989). J. Cell Sci., 94, 403 ± 413. Teng DH-F, Hu R, Lin H, Davis T, Iliev D, Frye C, Swelund B, Hansen KL, Vinson VL, Gumpper KL, Ellis L, ElNaggar A, Frazier M, Jasser S, Langford LA, Lee J, Mills GB, Pershouse MA, Pollack RE, Tornos C, Tronsoco P, Yung WKA, Fuji G, Berson A, Bookstein R, Bolen JB, Tavtigian SV and Steck PA. (1997). Cancer Res., 57, 5221 ± 5225. Theille M, Seitz S, Arnold W, Jandrig B, Frege R, Schlag PM, Haensch W, Guski H, Winzer K-J, Barret JC and Scherneck S. (1996). Oncogene, 13, 677 ± 685.

Varrault A, Ciani E, Apiou F, Bilanges B, Ho€mann A, Pantaloni C, Bockaert J, Spengler D and Journot L. (1998). Proc. Natl. Acad. Sci. USA, 95, 8835 ± 8840. Venkatachalam S, Shi Y-P, Jones SN, Vogel H, Bradley A, Pinkel D and Donehower LA. (1998). EMBO J., 16, 4657 ± 4667. Voz ML, Astrom AK, Kas K, Mark J, Stenman G and Van de Ven WJM. (1998). Oncogene, 16, 1409 ± 1416. Yoshiura K, Kanai Y, Ochiai A, Shimoyama Y, Sugimura T and Hirohashi S. (1995). Proc. Natl. Acad. Sci. USA, 92, 7416 ± 7419. Zou Z, Anisowicz A, Hendrix MJC, Thor A, Neveu M, Sheng S, Ra®di K, Seftor E and Sager R. (1994). Science, 263, 526 ± 529.