Journal of Life Sciences Volume 6, Number 11, November 2012 (Serial Number 55)

David Publishing

David Publishing Company www.davidpublishing.com

Publication Information Journal of Life Sciences is published monthly in hard copy (ISSN 1934-7391) and online (ISSN 1934-7405) by David Publishing Company located at 9460 TELSTAR AVE SUITE 5, EL MONTE, CA 91731, USA. Aims and Scope Journal of Life Sciences, a monthly professional academic journal, covers all sorts of researches on molecular biology, microbiology, botany, zoology, genetics, bioengineering, ecology, cytology, biochemistry, and biophysics, as well as other issues related to life sciences. Editorial Board Members Dr. Stefan Hershberger (USA), Dr. Suiyun Chen (China), Dr. Farzana Perveen (Pakistan), Dr. Francisco Torrens (Spain), Dr. Filipa João (Portugal), Dr. Masahiro Yoshida (Japan), Dr. Reyhan Erdogan (Turkey), Dr. Grzegorz Żurek (Poland), Dr. Ali Izadpanah (Canada), Dr. Barbara Wiewióra (Poland), Dr. Valery Lyubimov (Russia), Dr. Amanda de Moraes Narcizo (Brasil), Dr. Marinus Frederik Willem te Pas (The Netherlands), Dr. Anthony Luke Byrne (Australia), Dr. Xingjun Li (China), Dr. Stefania Staibano (Italy), Dr. Wenle Xia (USA), Hamed Khalilvandi-Behroozyar (Iran). Manuscripts and correspondence are invited for publication. You can submit your papers via Web Submission, or E-mail to [email protected] or [email protected]. Submission guidelines and Web Submission system are available at http://www.davidpublishing.com. Editorial Office 9460 TELSTAR AVE SUITE 5, EL MONTE, CA 91731, USA Tel: 1-323-9847526, Fax: 1-323-9847374 E-mail: [email protected], [email protected] Copyright©2012 by David Publishing Company and individual contributors. All rights reserved. David Publishing Company holds the exclusive copyright of all the contents of this journal. In accordance with the international convention, no part of this journal may be reproduced or transmitted by any media or publishing organs (including various websites) without the written permission of the copyright holder. Otherwise, any conduct would be considered as the violation of the copyright. The contents of this journal are available for any citation. However, all the citations should be clearly indicated with the title of this journal, serial number and the name of the author. Abstracted / Indexed in Database of EBSCO, Massachusetts, USA Chemical Abstracts Service (CAS), USA Cambridge Scientific Abstracts (CSA), USA Chinese Database of CEPS, American Federal Computer Library center (OCLC), USA Ulrich’s Periodicals Directory, USA Chinese Scientific Journals Database, VIP Corporation, Chongqing, China Universe Digital Library S/B, Proquest Subscription Information Price (per year): Print $520, Online $360, Print and Online $680. David Publishing Company 9460 TELSTAR AVE SUITE 5, EL MONTE, CA 91731, USA Tel: 1-323-9847526, 323-410-1082; Fax: 1-323-9847374 E-mail: [email protected]

D

DAVID PUBLISHING

David Publishing Company www.davidpublishing.com

JLS Journal of Life Sciences Volume 6, Number 11, November 2012 (Serial Number 55)

Contents Molecules and Biological Pharmacy 1185

Expression Analysis of the ANS Gene in Fragaria × ananassa cv. Toyonaka Xiaonan Zhang, Qing Chen, Haowei Yu, Shuli Zhou and Haoru Tang

1190

A Review of Molecular Makers Applied in Cowpea (Vigna unguiculata L. Walp.) Breeding Huaqiang Tan, Manman Tie, Qian Luo, Yongpeng Zhu, Jia Lai and Huanxiu Li

1200

Does Müller Cell Differentiation Occur Prior to the Emergence of Synapses in Embryonic Turtle Retina? Yolanda Segovia, Rosa María Perez, Norberto Mauricio Grzywacz and Joaquin De Juan

1206

T-Helper 1 Cell/T-Helper 2 Cell Balance with Anti Inflammatory Therapy in Partly Controlled Asthmatic Children Gamal Abdel Naser Yamamah, Hala Hamdy Shaaban, Emad Ezzat Salama, Nevine El Helaly, Solaf Kamel and Elham Mostafa

Biological and Agricultural Engineering 1214

Response of Hypercholesterolemic Rats to Sesamum indicum Linn Seed Oil Supplemented Diet Olubunmi Bolanle Ajayi, James Braimoh and Karen Olasunkanmi

1220

Isolation and Identification of Aspergillus spp. During One Year in the Hospitals İskender Karalti and Günay Tülay Çolakoğlu

1225

Effect of Phenolic Compounds on the Growth and L-Malic Acid Metabolism of Oenococcus oeni Silvia Jane Lombardi, Patrizio Tremonte, Mariantonietta Succi, Bruno Testa, Gianfranco Pannella, Luca Tipaldi, Elena Sorrentino, Raffaele Coppola and Massimo Iorizzo

1232

Techniques Optimization of Combined Enzymatic Hydrolysis on Brewers’ Spent Grain from Novozymes Zhaoxia Li, Jinlong Yan, Dan Shen and Cheng Ding

1237

Enhancing Rice Productivity and Soil Nitrogen Using Dual-Purpose Cowpea-NERICA® Rice Sequence in Degraded Savanna Sylvester O. Oikeh, Abibu Niang, Robert Abaidoo, Pascal Houngnandan, Koichi Futakuchi, Brahima Koné and Amadu Touré

1251

Performance of Farmland Terraces in Maintaining Soil Fertility: A Case of Lake Maybar Watershed in Wello, Northern Highlands of Ethiopia Shimeles Damene, Lulseged Tamene and Paul L.G. Vlek

1262

Impact of Droughts on Cedrus atlantica Forests Dieback in the Aurès (Algeria) Dalila Kherchouche, Mahdi Kalla, Emilia M. Gutiérrez, Said Attalah and Madjid Bouzghaia

1270

The Development of a Seed Stock Industry Using Indigenous Livestock from Rural Keepers for Sustainable Production Michiel Matthys Scholtz

Interdisciplinary Researches 1277

Computational Evaluation of Selectivity of Triazole- and Amide-Based Drug Candidates, Flavanone Derivatives and Synthesized Steroid Compounds for Treatment of Diabetes Type II Hong-Phuc N. Nguyen, Diem-Trang T. Tran, Thanh N. Truong and Ly Le

1285

Experimental Teaching of Biology: A Professional Challenge. How Prepared Are the Teachers of High Schools of Heraklion, Greece? Maria Kalathaki

1299

The Welfare Assessment of Calves in Terms of the European Union Legislation Jana Takáčová, Peter Korim, Ladislav Takáč, Jana Korimová, Jana Maľová, Lukáš Michaľov and Martin Bulik

Journal of Life Sciences 6 (2012) 1185-1189

Expression Analysis of the ANS Gene in Fragaria × ananassa cv. Toyonaka Xiaonan Zhang, Qing Chen, Haowei Yu, Shuli Zhou and Haoru Tang College of Horticulture, Sichuan Agricultural University, Ya’an 625014, Sichuan, China Received: June 27, 2012 / Accepted: August 14, 2012 / Published: November 30, 2012. Abstract: Strawberry is an economically valuable crop all over the word. Its fruits contain large amounts of polyphenol compounds, anthocyanins for instance. Anthocyanins play important roles in attracting pollinators and protecting plants from various stresses. ANS (Anthocyanidin synthase) catalyzes the conversion of leucoanthocyanidins to colored anthocyanidins. In this study, the total anthocyanins concentration at seven developmental stages of the strawberry fruit were investigated by UV spectrophotometry at 496 nm and 700 nm; and the expression levels of the Fa-ANS gene were studied by qRT-PCR. The results showed that the anthocyanins contents gradually increased along with the fruit maturation; while the expression patterns of Fa-ANS were consistent with the anthocyanins. Key words: Anthocyanins, ANS, strawberry fruit, developmental stages.

1. Introduction Flavonoids are polyphenol compounds important in plant environment cross-talk, with about 9,000 structures which have been identified up to now. These compounds are found in all vascular plants as well as in some mosses [1-3]. Even in the same species a number of different flavonoids may occur. It is already well established that flavonoids have a significant impact on various aspects of plant biology [4]. Several different classes of flavonoids, including anthocyanins, flavonols, isoflavones, and oligomeric PAs (proanthocyanidins; also called condensed tannins) contribute in many ways to the growth and survival of plants [5, 6]. Anthocyanins are responsible for the orange to blue colors found in many flowers, leaves, fruits, seeds and other tissues, and are the largest subclass First author: Xiannan Zhang, master, research field: application of biological technology in horticulture plant. E-mail: [email protected]. Corresponding author: Haoru Tang, professor, research field: application of biological technology in horticulture plant. E-mail: [email protected].

of plant flavonoids [7]. They are widely distributed in seed plants, water-soluble, and stored in vacuoles [8]. Anthocyanins play important roles in attracting pollinators and protecting plants from various stresses [9]. Anthocyanins have been reported to be involved in enhancing immune function [10], protecting against age-related neurological disorders [11] and exhibiting anti-cancer properties [12]. Moreover, it has recently been shown that anthocyanins have a variety of bioactivities of medical interest, such as antioxidant activity, anti-inflammatory activity, anti-mutagenic activity, and visual function-improving effects [13, 14]. CHS (chalcon synthase), CHI (chalcone isomerase), F3H (flavanone 3-hydroxylase), DFR (dihydroflavonal 4-reductase), ANS (anthocyanidin synthase) involve in anthocyanins pathways, they are very important enzymes in anthocyanin pathways. ANS leads to the synthesis of anthocyanidin pigments and cyanidin-derived PA, and catalyzes the conversion of leucoanthocyanidins to colored anthocyanidins [15]. ANS has been studied at both the

1186

Expression Analysis of the ANS Gene in Fragaria × ananassa cv. Toyonaka

genetic and the biochemical level in various plants [16], including grapes and strawberry [17, 18]. However, the mostly wide used cultivar “Toyonaka” was not covered therein. Strawberry is an economically valuable crop, and the fruits are an excellent system to study non-climacteric ripening, widely grown in all temperate regions of the world. Its fruits contain large amounts of polyphenol compounds, anthocyanidins for instance, with significant antioxidant capacity and claimed beneficial health effects [18]. Apart from its commercial importance, strawberry is becoming a model of choice for functional genomics approaches in the studying of Rosaceae genetics [19]. In this study, the authors used the most extensive cultivar (Fragaria × ananassa cv. Toyonaka) applied in forcing culture of strawberry, to analyze the correlation between the total anthocyanins concentration and expression levels of the Fa-ANS gene at seven developmental stages of the fruit. The authors hope this could provide further molecular evidences to understand the affection of genetic background and developmental clues on the ripening physiology of strawberry fruits.

province in 2011. All fruits were frozen in liquid nitrogen upon harvesting in the field and stored at -80 °C until ready use. 2.2 RNA Isolation and cDNA Synthesis Fruits at different developmental stages were used for total RNA isolation by the protocol adopted by Djami-Tchatchoua et al. [21]. First strand cDNA was synthesized from 2 µg of the RNA by M-MuLV reverse transcriptase with Oligo-(dT)18 primer according to the instructions of the Easy-GoTM RT Premix kit (SBS Genetech, China) after treated with RNase-free DNase I (Sangon, Shanghai, China). 2.3 Quantitative Real Time PCR (qRT-PCR) Primer Design The qRT-PCR primers (Table 1) for Fa-ANS and Fa-Actin gene were designed to span the intron boundaries in Beacon Designer 7 (Primer, USA). The gene sequence used were those deposited in Genbank database of NCBI including: Fa-ANS (Genbank ID: AY695817) and Fa-Actin (Genbank ID: JN616288). 2.4 qRT-PCR for Expression Analysis The expression levels of Fa-ANS gene at seven

2. Materials and Methods

stages of strawberry fruits were determined by

2.1 Plant Material

qRT-PCR, using SYBR green method on a CFX96

Strawberry fruits from the cultivar. “Toyonaka” were collected at seven time points during fruit development indicated by Hou et al. [20], as follows: small green (SG, 7 days after fruit set), large green (LG, 15 days after fruit set), green ripe (GR, white fruits), turning red (TR, 1/4 red), half red (HR, 1/2 red), red ripe (RR, > 1/2 red), full red (FR). They were sampled from the Shuangliu country of Sichuan

real-time cycler (BIO-RAD, USA). Each PCR

Table 1 Gene Fa-ANS Fa-Actin

reaction (20 μL) contained 0.6 μL primer F, R (10 μM), 1 μL cDNA (10 ng), and 10 μL 1 × Takara SYBR Premix (Takara, Dalian, China). The qRT-PCR conditions were: 1 cycle at 95 °C for 3 min; 40 cycles at 95 °C for 10 s and 59 °C (ANS) or 55.7 °C (Actin) for 30 s, followed by a melt cycle from 65.0 °C to 95.0 °C. The Fa-Actin gene was served as an internal control.

Primers used for qRT-PCR analysis. Description Forward Reverse Forward Reverse

Sequences (5′-3′) GTGAGGGAGAAATGTAGGGAGGAT GGAGATGCCGTGGTTGATAAGG ACCTTCAATGTGCCTGCTAT ACACCATCACCAGAGTCAAG

Amplicon (bp) 81 101

Expression Analysis of the ANS Gene in Fragaria × ananassa cv. Toyonaka

1187

Three replicates of all qRT-PCR reactions were carried out on each sample. Amplification efficiency of all primers used was primarily determined prior to sample investigation. Relative expression values were firstly calculated as 2-ΔCT, normalizing against the internal control Fa-Actin gene. The maximal expression level of each gene observed was served as a calibrator (1.0) respectively, and the rest were expressed as ratios in relation to the calibrator (relative expression ratio).

expressed as mg/g FW [23].

2.5 Total Anthocyanidin Determination

The concentration of anthocyanins was assayed by UV spectrophotometry at 496 nm and 700 nm. As shown in Fig. 1, anthocyanin was found an increasing pattern as the fruits maturation. The authors’ result indicated that the content was lowest in the fruit at SG (green stage), and then gradually increased at FR (red stage). Total anthocyanins pigments values increased from 0.79 to 18.61 mg/g FW (fresh weight) from SG to FR. The values was significantly higher than the total anthocyanins reported for strawberry [18] (240 μg/g FW for “Camarosa”), and also higher than the total anthocyanins in bayberry [24] (109 mg/100g FW for “Myrica rubra”). Total anthocyanin accumulation patterns was consisting with that was found in blackberry and

Extractions of anthocyanidin from strawberry fruits at seven stages followed procedures described by Kao et al. [22]. Frozen fruit tissue (1.5 g) was homogenized in 20 mL of extraction solvent (60 mL of acetone, 60 mL of methanol, 30 mL of water, 15 mL of acetic acid). Samples were incubated in a water bath at 40 °C for 4 h, cooled to room temperature, and subsequently centrifuged at 15,000 × for 20 min at 4 °C (Eppendorf 5804R, Germany). The supernatant was collected and transferred into a new tube diluted 10 times (one with potassium chloride buffer (0.025 M, pH 1.0) and the other with sodium acetate buffer (0.4 M, pH 4.5) with a predefined dilution factor). Then let stand at room temperature for 15 min, and ready for analyzing instantly by UV spectrophotometry at 496 nm and 700 nm. Each sample was extracted three times. The monomeric anthocyanin pigment concentration in the extract was calculated as pelargonidin3-glucoside, which was proved to be the most abundant anthocyanin component in strawberry [23], by using the following formula: Anthocyanins content (mg·g-1)  A  MW  DF 1000

ε l

2.6 Statistics All chemical tests were triplicated and the data collected was analyzed with the SPSS 18.0 for windows software package. Results were expressed as means ± standard deviations.

3. Results and Discussion 3.1 Total Anthocyanins Concentration

(1)

where, A = (A496nm - A700nm)PH=1.0 - (A496nm A700nm)PH=4.5, MW (pelargonidin-3-glucoside molar weight) = 433.2, molar absorptivity () = 15,600 and cell pathlength (l) = 1 cm. (DF: SG, LG, GR = 5, TR, HR = 6, RR = 8, FR = 10), metabolite levels are

Fig. 1 Change patterns of anthocyanin in strawberry fruit. SG, small green; LG, large green; GR, green ripe; TR, turning red; HR, half red; RR, red ripe; FR, full red. Data separated within column represent significant levels of a, b, c, d, e, f at 0.05 by Duncan’s multiple range test.

1188

Expression Analysis of the ANS Gene in Fragaria × ananassa cv. Toyonaka

strawberry fruit [18, 25]. Anthocyanins accumulation was lowest in the fruit at SG, this might relate to proanthocyanidins accumulated to highest during SG, When anthocyanins accumulation was maximum at FR, proanthocyanidin accumulated to minimum during FR. 3.2 Expression of Fa-ANS Gene in the Strawberry Fruit Tissues ANS is a key enzyme of the branch pathway of anthocyanins biosynthesis, which catalyze the formation of leucoanthocyanidins to colored anthocyanins [15]. The results in the authors’ work showed that their expression levels increased continuously during fruit developments (Fig. 2). As shown in Fig. 2, the expression level of the Fa-ANS was lowest at SG, gradually increased to the maximum at FR, with the relative transcript abundance 0.02, 0.05, 0.08, 0.04, 0.18, 0.19, 1.00, respectively. The expression level of the Fa-ANS, which was a low peak at the turning TR, this is consistent with that observed by Fabrizio et al. at 2009 [18]. However, their results showed that expression levels of the Fa-ANS increased to the maximum at the red RR (ripe stage) as fruit maturated, and began to decreased at FR. The results in the authors’ work showed that the expression level of the Fa-ANS was highest at FR.

The authors speculated that the difference might be due to different environment or various species used. The authors used the Pearson correlation coefficients to perform a two dimensional analysis between gene expression and final products accumulation. The correlation coefficients of the anthocyanins concentration and expression of Fa-ANS was 0.942. They are highly significant correlation and gave a similar pattern: from SG to FR, total anthocyanins concentration gradually accumulated, transcript levels of Fa-ANS gradually also increased. However, when total anthocyanins concentration gradually accumulated as fruits maturated, transcript levels of Fa-ANS began to declined, and was a low peak at the turning red stage (TR), then gradually increased to the maximum until FR. This might be because that anthocyanin-related genes CHS, CHI, F3H (flavanone 3-hydroxylase), DFR (dihydroflavonal 4-reductase), involved in anthocyanin pathways, they are very important enzymes in anthocyanin pathways, not only ANS.

4. Conclusions In this study, the total anthocyanin concentration and the expression levels of the Fa-ANS gene from the strawberry fruits at seven developmental stages were found an increasing pattern as the fruits maturation. The expression patterns of Fa-ANS were consistent with the anthocyanins, and they have a similar pattern: from SG to FR, total anthocyanins concentration gradually accumulated, transcript levels of Fa-ANS gradually also increased.

Acknowledgments

Fig. 2 Expression of ANS gene in strawberry fruit. SG, small green; LG, large green; GR, green ripe; TR, turning red; HR, half red; RR, red ripe; FR, full red. Data separated within column represent significant levels of a, b, c, d, e at 0.05 by Duncan’s multiple range test.

The authors sincerely thank Miss Dan Lan (College of Animal Science and Technology, Sichuan Agricultural University, China) for her kind help with Real-Time PCR assay technology support.

References [1]

K.S. Gould, C. Lister, Flavonoid Functions in Plants, in Flavonoids, Chemistry, Biochemistry and Applications,

Expression Analysis of the ANS Gene in Fragaria × ananassa cv. Toyonaka

[2] [3] [4] [5] [6]

[7]

[8]

[9] [10]

[11]

[12]

[13]

[14]

[15]

[16]

CRC Press, Boca Raton, FL, USA. 2006, pp. 397-441. J.B. Harborne, H. Baxter, Handbook of Natural Flavnoids, Wiley, Chichester 2, 1999. C.A. Williams, R.J. Grayer, Anthocyanins and other flavonoids, Natural Products Repopts 21 (2004) 539-573. M. Stefan, M. Axel, Flavones and flavone synthases, Phytochemistry 66 (2005) 2399-2407. J.B. Harborne, C.A. Williams, Anthocyanins and other flavonoids, Natural Product Reports 18 (2001) 310-333. R.A. Dixon, L.W. Sumner, Legume natural products: Understanding and manipulating complex pathways for human and animal health, Plant Physiology 131 (2003) 878-885. D. Strack, V. Wray, The anthocyanins, in the flavonoids, advances in research since 1986, Chapman and Hall, London, 1994b, pp.1-22 (Chapter 1). T. Yoshikazu, S. Nobuhiro, O. Akemi, Biosynthesis of plant pigments: Anthocyanins, betalains and carotenoids, The Plant Journal 54 (2008) 733-749. J.B. Harborne, C.A. Williams, Advances in flavonoid research since 1992, Phytochemistry 55 (2000) 481-504. Y. Fu, J.C. Yu, X.R. Ding, J.X. Han, Effects of acupuncture on expressions of the transcription factors NF-E2, YB-1, LRG47 in the SAMP10 mice, J Tradit Chin Med 29 (2009) 54-59. W.H. Shin, S.J. Park, E.J. Kim, Protective effect of anthocyanins in middle cerebral artery occlusion and reperfusion model of cerebral ischemia in rats, Life Sciences 79 (2006) 130-137. H. Cai, T.H. Marczylo, N. Teller, K. Brown, W.P. Steward, D. Marko, et al., Anthocyanin-rich red grape extract impedes adenoma development in the apc(min) mouse: Pharmacodynamic changes and anthocyanin levels in the murine biophase, European Journal of Cancer 46 (2010) 811-817. G. Forkmann, S. Martens, Metabolic Engineering and Applications of Flavonoids, Current Opinion in Biotechnology, Elsevier, München, 2001, p. 155-160. T. Nakayama, H. Suzuki, T. Nishino, Anthocyanin acyltransferases: Specificities, mechanism, phylogenetics, and applications, Journal of Molecular Catalysis B: Enzymatic 23 (2003) 117-132. T.A. Holton, E.C. Cornish, Genetics and biochemistry of ant hocyanin biosynthesis, Plant Cell, 7 (7) (1995) 1071-1083. J. Bogs, M.O. Downey, J.S. Harvey, A.R, Ashton, G.J. Tanner, S.P. Robinson, Proanthocyanidin synthesis and

[17]

[18]

[19]

[20]

[21]

[22]

[23]

[24]

[25]

1189

expression of genes encoding leucoanthocyanidin reductase and anthocyanidin reductase in developing grape berries and grapevine leaves, Plant Physiology 139 (2005) 652-663. J. Bogs, F.W. Jaffe, A.M. Takos, A.R. Walker, S.P. Robinson, The grapevine transcription factor VvMYBPA1 regulates proanthocyanidin synthesis during fruit development, Plant Physiology 143 (2007) 1347-1361. C. Fabrizio, P. Anja, C.H. Ric, Developmental, genetic and environmental factors affect the expression of flavonoid genes, enzymes and metabolites in strawberry fruits, Plant, Cell and Environment 32 (2009) 1117-1131. R.G. Mathieu, L.K. Estelle, B. Laure, J.S. Daniel, M. Amparo, S. David, et al., Comparative genetic mapping between octoploid and diploid fragaria species reveals a high level of colinearity between their genomes and the essentially disomic behavior of the cultivated octoploid strawberry, Genetics Society of America 179 (2008) 2045-2060. Y.X. Hou, H.R. Tang, Y. Zhang, Y. Luo, Q. Chen, Cloning and expression analysis of ascorbate peroxidase gene during fruit development and ripening in Fragaria × ananassa cv. Toyonaka, World Journal of Agricultural Sciences 5 (6) (2009) 675-679. A.T Djami-Tchatchoua, C.J Straker, The isolation of high quality RNA from the fruit of avocado (Persea americana Mill.), South African Journal of Botany 78 (2012) 44-46. M.W.S. Kao, F.M. Woods, W.A. Dozier, R.C Ebel, M. Nesbitt, J. Jee, et al., Phenolic content and antioxidant capacities of alabama-grown thornless blackberries, International Journal of Fruit Science 7 (2008) 33-46. R.D. Liu, M. Zhang, X.X. Li, Comparisons of extraction solvents and quantitative methods for analysis of anthocyanins in strawberry and blueberry fruits, Acta Horticulturae Sinica 35 (5) (2008) 655-660. (in Chinese) S.S. Niu, C.J. Xu, W.S. Zhang, B. Zhang, X. Li, K.L. Wang, et al., Coordinated regulation of anthocyanin biosynthesis in Chinese bayberry (Myrica rubra) fruit by a R2R3 MYB transcription factor, Planta 231 (2010) 887-899. Q. Chen, X.N. Zhang, H.W. Yu, Y. Wang, H.R Tang, Changes of total anthocyanins and proanthocyanidins in the developing blackberry fruits, International Journal of ChemTech Research 4 (1) (2012) 129-137.

Journal of Life Sciences 6 (2012) 1190-1199

A Review of Molecular Makers Applied in Cowpea (Vigna unguiculata L. Walp.) Breeding Huaqiang Tan, Manman Tie, Qian Luo, Yongpeng Zhu, Jia Lai and Huanxiu Li College of Horticulture, Sichuan Agricultural University, Ya’an 62504, Sichuan, China

Received: June 12, 2012 / Accepted: August 13, 2012 / Published: November 30, 2012. Abstract: In recent years, with the rapid development of molecular biology, molecular markers have been widely used in genetic breeding of various crops including cowpea. However, molecular researches in cowpea are lack of systematic summary. This review presents an overview of accomplishments on different aspects of molecular markers in cowpea genetic breeding, such as genetic diversity analysis, genetic linkage map construction, QTL mapping, etc. Furthermore, it provides the discussion of some existing problems about molecular markers applied in cowpea breeding and the prospect of the future development. The authors find that SSR is the most frequently used molecular marker, while SNP has not been used in the genetic diversity analysis of cowpea. And the authors also conclude that more QTL of cowpea should be located and more molecular markers linked to resistance gene should be found. This will be useful for scientists and breeders to research cowpea with the aid of molecular markers, thus accelerating improvement of cowpea varieties. Key words: Molecular markers, cowpea, breeding, genetic diversity, review.

1. Introduction Cowpea (Vigna unguiculata L. Walp.), which originates in Africa, is an important grain legume growing in tropical and subtropical regions, including Asia, Africa, Central and South America, the United States and part of the southern Europe. The planting area is more than 12.5 million hectares worldwide, with an annual production of more than 3 million tons [1]. The drier savanna and the Sahelian region of West and Central Africa produce about 70% of worldwide cowpea production, with Nigeria, Niger and Brazil being the largest producers [2]. Cowpea is called “poor man’s meat” [3] because the seed protein contents range from 23% to 32% of seed weight rich in lysine and tryptophan, and a substantial amount of mineral and vitamins (folic First author: Huaqiang Tan, master, research field: application of biological technology in horticulture plant. E-mail: [email protected]. Corresponding author: Huanxiu Li, professor, research field: application of biological technology in horticulture plant. E-mail: [email protected].

acid and vitamin B) necessary for preventing birth defect during the pregnancy stage [4]. In many parts of West Africa, cowpea hay is also critical in the feeding of animals during the dry season [5]. In addition, cowpea is a nitrogen-fixing plant, when used in rotation with cereal crops it can help restore soil fertility [6]. Therefore, cowpea can play an important role in the development of agriculture. The development of cowpea industry relies heavily on the improvement of existing cultivars and breeding of new varieties. Traditional selection mainly depends on the phenotypic variation. However, morphological markers are easily influenced by the environment, and some of them have epistatic effects [7]. Simultaneously, conventional breeding program requires selection on many generations of the material, leading to the reduction of reliability and efficiency. DNA molecular markers are genetic markers based on individual nucleotide sequence variation, which are the direct reflection of genetic polymorphisms at the DNA level. Compared with morphological markers,

A Review of Molecular Makers Applied in Cowpea (Vigna unguiculata L. Walp.) Breeding

cytological markers and biochemical markers, DNA molecular markers have some unique advantages, its multi-locus nature as well as high reproducibility, simplicity and low cost make it particularly attractive for analyzing a large number of samples with narrow genetic variation [8]. The technology mainly consists of RFLP (restriction fragment length polymorphism), AFLP (amplified fragment length polymorphism), SSR (single sequence repeat), RAPD (random amplified polymorphic DNA), SNP (single nucleotide polymorphisms), and so on. They are widely used in genetic diversity research, variety identification, phylogenetic analysis, gene mapping and resource classification, etc. [9]. The objective of this paper is to summarize the main previous achievements on molecular makers used in cowpea breeding and discuss the existing problem and the prospect in its application, in order to provide a reference for scientists who are engaged in this field.

2. Application of Molecular Markers in Cowpea Since the gene theory was put forward，genotypic selection has replaced phenotypic selection gradually. Since then, DNA molecular markers are becoming a research hotspot. The research on AFLP, SSR and RAPD is changing rapidly. 2.1 Analysis of Genetic Diversity For

cowpea

breeding,

the

genetic

diversity

information is extremely important, which is the basis of breeding and genetic research. Accurate assessment of genetic variability is important for the preservation and

utilization

of

germplasm

resources,

and

improvement of cultivars. For this reason, scholars all over the world have made extensive and in-depth research on the genetic diversity of cowpea. 2.1.1 The Application of RAPD RAPD is widely used in cowpea genetic analysis because it is simple and little DNA is required. The

1191

RAPD technology was proved to be a useful tool in the characterization of the genetic diversity among cowpea cultivars by Zannou et al. [10]. In their study, RAPD markers were used to evaluate the genetic diversity in 70 cowpea accessions collected throughout Benin. The genetic diversity was very large. Based on the molecular variance, the fixation index suggested a large differentiation of cowpea cultivars in Benin. Malviya et al. [11] used 18 sets of RAPD markers to analyse the genetic diversity among ten Indian cultivars of cowpea. The variation in genetic diversity among these cultivars ranged from 0.1742 to 0.4054. Cluster analysis using UPGMA revealed two distinct clusters I and II comprised of two and seven cultivars, respectively. Cultivar IC-9883 was found to be unique. Ba et al. [12] analysed 26 domesticated and 30 wild cowpea species from west, eastern and southern Africa. Wild species in eastern Africa had more polymorphisms, which may be the origin of V. unguiculata var. spontanea. Nkongolo et al. [13] determined the pattern and extend of RAPD marker variation within and among cowpea populations from different agroecological zones, a general lack of agreement between clustering and morphological features was observed. Chen et al. [14] analysed 40 yardlong beans collected from Jianghan University by RAPD makers. A total of 30 primers generated 140 polymorphic RAPD bands. The various numbers of bands amplified by RAPD among the varieties were noticed. 2.1.2 The Application of SSR SSR is the most frequently used marker in the genetic diversity analysis of cowpea. The earliest cowpea SSR research is conducted by Li et al. [15], and 27 SSR primers have been developed. After that, SSR research on cowpea from different areas, mainly Africa and Asia, has been carried out. Africa is the diversity center of wild cowpea, which was proved by Ogunkanmi et al. [16] with SSR analysis. Asare et al. [17] utilized SSR molecular markers to evaluate

1192

A Review of Molecular Makers Applied in Cowpea (Vigna unguiculata L. Walp.) Breeding

genetic diversity and phylogenetic relationships among 141 cowpea accessions collected throughout the nine geographical regions of Ghana. PIC (the polymorphism information content) varied from 0.07 to 0.66 with an average of 0.38. The Ghanaian cowpea accessions clustered into five main branches, each of which was loosely associated with the geographical regions from which samples were obtained. Badiane et al. [18] assessed the genetic diversity and phylogenetic relationships among 22 local cowpea varieties and inbred lines collected throughout Senegal by SSR markers, and developed a set of 44 polymorphic primer combinations from cowpea genomic or expressed sequence tags, the PIC value ranging from 0.08 to 0.33. The local varieties clustered in the same group, except 53-3, 58-53, and 58-57; while Ndoute yellow pods, Ndoute violet pods and Baye Ngagne were in the second group. Sawadogo et al. [19] evaluated the genetic diversity and phylogenetic relationships among cowpea genotypes used in breeding for resistance to Striga gesnerioides in Burkina Faso using simple SSR molecular markers. Very few primer combinations showed polymorphic bands capable of discriminating Striga-resistant from susceptible cultivars, which revealed a high efficiency of SSR markers. Although Asia is one of the major cowpea growing areas, genetic diversity researches on cowpea in Asia are still very little. Lee et al. [20] estimated the genetic diversity of 492 Korean cowpea landrace accessions using six SSR markers. The mean of Weir’s gene diversity was 0.665 from all the accessions. Cowpea gene diversity of six local provinces in Korea ranged from 0.370 in accessions of Gangwon to 0.680 in Jeonra provinces. Especially SSR markers VM36 and VM39, which seem to be good markers to distinguish the Gangwon accessions from others by occurring at a specific locus with higher than 78% of allele frequency, have been found. Xu et al. [21] assessed the genetic diversity of asparagus bean cultivars from different geographical origins in China by

EST-derived and GSS-derived SSR markers. PCA (principal coordinate analysis) and phylogenetic clustering based on 62 alleles detected by 14 polymorphic SSR markers distinguished ssp. unguiculata and sesquipedialis into separate groups. Improved cultivars of asparagus bean in China generally had a narrow genetic basis compared with landraces. This suggested that breeding programs of asparagus bean need to utilize landrace germplasm to enhance genetic variability, ensure long-term gains from selection, and reduce genetic vulnerability to pathogen or pest epidemics. Xu et al. [22] extracted the DNA of a total of 316 cultivated cowpea resources from China, Africa and other Asian countries, which were amplified by SSR to study their genetic diversity. The result showed that the genetic diversity of foreign accessions is higher than that of the domestic accessions. Cowpea in Guangxi and Hubei province has a rich genetic diversity, but a relatively low genetic diversity was found in Anhui, Jilin, Heilongjiang and Shanxi province. 2.1.3 The Application of AFLP AFLP is recognized as one of the most efficient molecular markers. Coulibaly et al. [23] employed AFLP to evaluate genetic relationships within a total of 117 cowpea accessions to assess the organization of their genetic diversity. Wild annual cowpea (var. spontanea) was more diverse than domesticated cowpea. Wild cowpea in eastern Africa was more diverse than in western Africa, suggesting an eastern African origin for the wild taxon. Fang et al. [24] examined genetic relationships among 60 advanced breeding lines from six breeding programs in West Africa and USA, and 27 landrace accessions from Africa, Asia, and South America. AFLP markers with six near infrared fluorescence labeled EcoRI + 3/1bases/MseI + 3/1bases primer sets were used in the study. Principal coordinates analysis showed clustering of breeding lines by program origin, indicating lack of genetic diversity compared to potential diversity.

A Review of Molecular Makers Applied in Cowpea (Vigna unguiculata L. Walp.) Breeding

2.1.4 The Application of Combinative Markers The advantages of combinative markers are that they could be analyzed both separately and in combination, which makes the result more reasonable. Diouf et al. [3] used RAPD and SSR techniques to study the genetic diversity in local cowpea varieties and breeding lines from Senegal. Microsatellite markers are found to be more effective than RAPD in determining the relationship among cowpea accessions and varieties. Tosti et al. [25] studied three neighbouring cowpea landraces currently cultivated in central Italy by AFLP and SAMPL markers to determine the distribution of genetic variation within and among them. The three landraces studied, although relatively similar, were highly different from one another as shown by the data obtained from the AFLP and SAMPL markers. Gillaspie et al. [26] utilized AFLP and SSR markers to assess genetic diversity and relatedness between Vigna unguiculata subspecies. Three AFLP primer combinations and 10 SSR primer sets successfully identified closely related accessions, and the presence of heterogeneity in some accessions. Results of cluster analysis between molecular markers and morphological traits are usually lack of consistency [13]. Reasons for this could be: the limited number of traits observed, the limited variation for the traits, the number of underlying genes for the traits, which may also be limited, and possible epistatic interactions among the genes [27]. In cowpea genetic breeding and evaluation of germplasm resources, a combination of molecular markers and classical markers is essential. Tantasawat et al. [8] estimated genetic diversity and relatedness of 23 yardlong bean (Vigna unguiculata spp. sesquipedalis) accessions and 7 accessions of a hybrid between cowpea (V. unguiculata spp. unguiculata) and dwarf yardlong bean in Thailand by morphological characters, SSR and ISSR markers. Five morphological characters were diverse among most accessions. However, five groups of 2-3 accessions

1193

could not be distinguished from one another based on these morphological characters alone. The comparison of average marker index of the multilocus marker and mantel test indicated higher efficiency of ISSR for estimating the levels of genetic diversity and relationships among yardlong beans and dwarf yardlong beans in the study. Ghalmi et al. [28] compared 20 landraces of cowpea scattered throughout Algeria through morphological and genetic characterization. Despite the absence of significant correlation between morphological and RAPD data, significant correlations between morphological data and both ISSR and a combined RAPD-ISSR dataset were noted. A conclusion had been made that ISSR markers were better linked to morphological variation than RAPD markers. 2.2 Construction of Genetic Linkage Map Genetic map refers to chromosomal linear linkage map which uses chromosome recombinant exchange rate as relative length units and mainly consists of genetic markers. It can be used to locate and mark the target gene to promote the application of marker-assisted breeding in practice. At the same time, it reveals the genetic basis of traits controlled by multiple genes and provides an important tool for map-based cloning. Therefore, building a high-density genetic linkage map is of great significance. The cowpea genetic linkage map is mainly constructed by a cross between a wild species or a cultivated species in the wild type and a cultivar because of its relatively narrow genetic background. There are not many current cowpea genetic maps which are usually constructed with RIL (recombinant inbred lines), the most commonly used mapping population (Table 1). The first map to be constructed was based mainly on the segregation of RFLP markers in the progeny of a cross between an improved cultivar and a putative wild progenitor type (Vigna unguiculata subsp. dekindtiana) [29]. The map consisted of 92 markers placed in eight linkage groups

1194

A Review of Molecular Makers Applied in Cowpea (Vigna unguiculata L. Walp.) Breeding

that spanned a total genetic distance of 684 cm. After that, Menendez et al. [30] constructed a genetic linkage map within the cultivated gene pool of cowpea. The map consisted of 181 loci, comprising 133 RAPDs, 19 RFLPs, 25 AFLPs, three morphological markers, and a biochemical marker (dehydrin). These markers identified 12 linkage groups spanning 972 cm with an average distance of 6.4 cm between markers. On the basis of the two maps above, Ouedraogo et al. [31] constructed an improved genetic linkage map, which was based on the segregation of various molecular markers and biological resistance traits. The new genetic map of cowpea consists of 11 LGs (linkage groups) spanning a total of 2670 cm, with an average distance of 6.43 cm between markers. And they also discovered a large, contiguous portion of LG1 that had been undetected in previous mapping work. This region, spanning about 580 cm, was composed entirely of AFLP markers. Subsequently, cowpea genetic linkage maps have been constructed one after another. A genetic linkage map of yardlong bean based on SSR makers from related Vigna species had been developed by Kongjaimun et al. [32]. The markers were clustered into 11 linkage groups spanning 852.4 cm in total length with a mean distance between adjacent markers of 3.96 cm. Andargie et al. [33] constructed a genetic linkage map using SSR markers and a RI (recombinant inbred) population of 159 individuals derived from a cross between the breeding line 524B and 219-01. 202 polymorphic SSRs were used to construct a genetic map consisting of 11 linkage

groups spanning 677 cm, with an average distance between markers of 3 cm. Xu et al. [34] reported the first genetic map of asparagus bean based on SNP and SSR markers. The current map consists of 375 loci mapped onto 11 linkage groups, with 191 loci detected by SNP markers and 184 loci by SSR markers. The overall map length is 745 cm, with an average marker distance of 1.98 cm. Muchero et al. [35] developed 1536 EST-derived SNPs and applied to 741 recombinant inbred lines from six mapping populations to construct a cowpea genetic map. Of these SNPs, 928 were incorporated into a consensus genetic map spanning 680 cm with 11 linkage groups and an average marker distance of 0.73 cm. The construction of current cowpea genetic map is mainly based on efficient molecular markers such as AFLP, SSR and SNP. RAPD markers are generally not used to construct genetic maps due to the poor reproducibility. High-density genetic map provides a powerful tool for analysing the heredity of target gene, monitoring specific genes or genomic regions transmitted from parent to next generation, as well as map-based cloning. Therefore, more high-density genetic map of cowpea should be developed by taking advantages of molecular markers. 2.3 Molecular Markers Linked to Resistance In breeding program, using molecular markers to select the target trait is called MAS (marker-assisted selection), which is the main application of molecular markers. In Africa the parasitic weed Striga gesnerioides is the main biotic factor restricting yield

Table 1 Some genetic linkage map of cowpea. MP: mapping population; AD: average distance; LG: number of linkage group; RIL: recombinant inbred lines; F2: F2 population. AD (cm)

LG

References

680

7.70

11

Young et al. [29]

IT84S-2049; 524B

2670

6.43

11

Ouedraogo et al. [31]

Six pairs of parents

680

0.73

11

Muchero et al. [35]

Markers used

MP

Parents

RFLP

F2

IT84S-2246-4; NI 963

AFLP

RIL

SNP

RIL

Length (cm)

SSR

RIL

219-01; 524B

677

3.00

11

Andargie et al. [33]

SSR

RIL

JP81610; TVnu457

852.4

3.96

11

Kongjaimun et al. [32]

SNP, SSR

RIL

Zhijiang282; ZN016

745

1.98

11

Xu et al. [34]

RAPD, RFLP, AFLP

RIL

IT84S-2049; 524B

972

6.40

12

Menendez et al. [30]

A Review of Molecular Makers Applied in Cowpea (Vigna unguiculata L. Walp.) Breeding

of cowpea. Growing cultivars that have resistance to the parasitic weeds is the best way. Searching for more molecular markers tightly linked to the resistance traits against parasitic of cowpea will greatly improve breeding efficiency. Ouedraogo et al. [36] identified three AFLP markers and seven AFLP markers that were linked to Rsg2-1, a single dominant gene controlling resistance to S. gesnerioides race 1, and Rsg4-3, a single dominant gene controlling resistance to S. gesnerioides race 3, respectively. Both of them were located within linkage group 1 of the cowpea genetic map. Boukar et al. [37] identified four AFLP markers, and mapped 3.2, 4.8, 13.5 and 23.0 cm, respectively, from Rsg1, a gene in IT93K-693-2 that gives resistance to race 3 of S. gesnerioides. The AFLP fragment from marker combination E-ACT/M-CAC, which was linked in coupling with Rsg1, was cloned, sequenced, and converted into a SCAR (sequence characterized amplified region) marker named SEACTMCAC83/85, which was co-dominant and useful in breeding programs. Rust disease, incited by the fungus Uromyces vignae, is one of the major diseases in cowpea production. Li et al. [38] determined that rust resistance was controlled by a single dominant gene designated Rr1. An AFLP marker (E-AAG/M-CTG) was converted to a SCAR marker, named ABRSAAG/CTG98, and the genetic distance between the marker and the Rr1 gene was estimated to be 5.4 cm. Aphid not only hinders growth, transmits virus, but also causes abnormal of flower, leaf and bud. Yield losses of up to 35% and 40% have been attributed to aphid infestation in Africa and Asia respectively [39]. Myers et al. [40] found one RFLP marker, bg4D9b, to be tightly linked to the aphid resistance gene (Rac1). The close association of Rac1 and RFLP bg4D9b presented a real potential for cloning this insect resistance gene. 2.4 QTL Mapping The location of genes controlling quantitative traits

1195

in the genome is known as QTL (quantitative trait loci). QTL could be detected by employing molecular markers in genetic linkage analysis, i.e. QTL mapping. With the help of molecular markers linked to QTL, the heredity of some related QTL could be tracked and the ability of genetic manipulation to QTL is greatly enhanced, thus improving the accuracy and predictability to select genotypes with superior quantitative trait. Therefore, the QTL mapping of cowpea is an important basic work (Fig. 1). At present, many scholars have utilized different genetic maps based on molecular markers to locate many QTL associated with cowpea yield. Kongjaimun et al. [32] developed a genetic linkage map of yardlong bean using 226 SSR makers from related Vigna species and to identify QTLs for pod length. One major and six minor QTLs were identified for pod length variation between yardlong bean and wild cowpea. Andargie et al. [33] identified the QTLs of cowpea agronomic traits related to domestication (seed weight, pod shattering) by SSR markers. Six QTL for seed size were revealed with the phenotypic variation ranging from 8.9%-19.1%. Four QTL for pod shattering were identified with the phenotypic variation ranging from 6.4%-17.2%. The QTL for seed size and pod shattering mainly clustered in two areas of LGs 1 and 10. Fatokun et al. [41] developed genomic maps for cowpea based on RFLP markers. Using these maps, major QTLs for seed weight had been identified. Muchero et al. [42] reported the mapping of 12 QTL associated with seedling drought tolerance and maturity in a cowpea recombinant inbred (RIL) population. Regions harboring drought-related QTL were observed on linkage groups 1, 2, 3, 5, 6, 7, 9, and 10 accounting for between 4.7% and 24.2% of the phenotypic variance. Further, two QTL for maturity were mapped on linkage groups 7 and 8 separately from drought-related QTL. Some QTL of resistance to disease and insects have also been identified. CoBB (cowpea bacterial blight), caused by Xanthomonas axonopodis pv. vignicola

1196

Fig. 1

A Review of Molecular Makers Applied in Cowpea (Vigna unguiculata L. Walp.) Breeding

QTL mapping of cowpea. LG: linkage group.

(Xav), is a worldwide major disease of cowpea. Agbicodo et al. [43] used a SNP (single nucleotide polymorphism) genetic map with 282 SNP markers constructed from the RIL population to perform QTL analysis. Three QTLs, CoBB-1, CoBB-2 and CoBB-3 were identified on linkage group LG3, LG5 and LG9, respectively. Besides, Muchero et al. [44] identified the QTL for Macrophomina phaseolina resistance and maturity in cowpea with SNP markers. Muchero et al. [45] also identified three QTL for resistance to Thrips tabaci and Frankliniella schultzei based on an AFLP genetic linkage map. These QTLs were located on linkage groups 5 and 7 accounting for between 9.1% and 32.1% of the phenotypic variance.

3. Conclusions and Future Prospects The ultimate goal of cowpea research is to classify germplasm resources, protect them and improve the yield and quality effectively. Traditional studies are based on phenotypic selection, and are easily affected by environmental or human factors. Research on the genes that controlling cowpea yield and quality from

the DNA level will improve the cowpea yield and quality eventually. As an important means of breeding, DNA molecular markers have demonstrated its unique advantages, and there have been some progress in its application in cowpea genetic breeding. However, there exists some problems and requires a long way to go in this direction. First of all, many researchers have come to a same conclusion: the genetic diversity of cultivated cowpea is very low [12, 15, 22, 23, 46, 47]. The narrow genetic base is one of the major limiting factors for today’s cowpea breeding, and the consequences are decline in vitality and range of variation. Cowpea improvement should partly rely on the diversity of large wild gene pool [48]. In order to improve the potential for high yield, adaptability, disease and insect resistance, a large number of excellent wild germplasm should be collected and applied in cowpea breeding program. In the second place, QTL studies of quantitative traits in cowpea are few, which cannot satisfy the need of breeding. Many important agronomic and economic characters of cowpea such as yield, protein content,

A Review of Molecular Makers Applied in Cowpea (Vigna unguiculata L. Walp.) Breeding

resistance and maturity are complex quantitative traits. Mapping more QTL of quantitative trait, analyzing the linkage between molecular marker and them are significant for research on marker-assisted breeding, mechanism of heterosis, genetic diversity, isolation and clone of quantitative trait gene. Last but not the least, few molecular markers linked to resistance gene have been found. There are a lot of diseases like rust, powdery mildew, fusarium wilt, and insect pests like bean weevil, pod borer in cowpea production. Seeking for more molecular markers linked to disease and insect resistance genes is an important means of assisted selection in breeding. The material could be selected on the DNA level with the help of molecular markers linked to resistance gene, and single or multiple genes linked to target traits could be detected, localized and tracked, thus reducing the blindness of selection and achieving the efficient improvement of cowpea yield, quality and resistance

[4]

[5]

[6]

[7]

[8]

[9]

traits. In a word, studies of molecular markers on cowpea

[10]

are still lacking. Molecular marker could be an auxiliary selection mean for breeding new cultivars or lines, but its application in cowpea is at the stage of exploration. Therefore, it is necessary to deepen the

[11]

research of molecular marker techniques in cowpea breeding.

Acknowledgments

[12]

This work was supported by “Shuang-Zhi Plan” of Sichuan Agricultural University, China. [13]

References [1]

[2]

[3]

B.B. Singh, D.R. Mohan-Raj, K.E. Dashiell, L.E.N. Jackai, Advances in Cowpea Research, International Institute of Tropical Agriculture, Ibadan, Nigeria, 1997. B.B. Singh, J.D. Ehlers, B. Sharma, F.R. Freire-Filho, Recent Progress in Cowpea Breeding: Challenges and Opportunities for Enhancing Sustainable Cowpea Production, Intl lnst Tropical Agric, Ibadan, Nigeria, 2002, pp. 22-40. D. Diouf, K.W. Hilu, Microsatellites and RAPD markers to study genetic relationships among cowpea breeding

[14]

[15]

[16]

1197

lines and local varieties in Senegal, Genetic Resources and Crop Evolution 52 (8) (2005) 1057-1067. S.S. Nielsen, W.E. Brandt, B.B. Singh, Genetic variability for nutritional composition and cooking time of improved cowpea lines, Crop Science 33 (3) (1993) 469-472. D.W. Wests, L.E. Francois, Effects of salinity on germination, growth and yield of cowpea, Irrigation Science 3 (3) (1982) 169-175. N. Sanginga, Role of biological nitrogen fixation in legume based cropping systems: A case study of West Africa farming systems, Plant and Soil 252 (2003) 25-39. V. Meglic, J.E. Staub, Inheritance and linkage relationships of isozyme and morphological loci in cucumber (Cucumis sativus L.), Theoretical and Applied Genetics 7 (1996) 865-872. P. Tantssawat, J. Trongchuen, T. Prajongjai, W. Seehalak, Y. jittayasothorn, Variety identification and comparative analysis of genetic diversity in yardlong bean (Vigna unguiculata spp. sesquipedalis) using morphological characters, SSR and ISSR analysis, Scientia Horticulturae 124 (2) (2010) 204-216. Y.H. Zhou, DNA Molecular Markers in Plant Research, Chemical and Industry Press, Beijing, China, 2005. (in Chinese) A. Zannou, D.K. Kossou, A. Ahanchede, J. Zoundjihekpon, E. Agbicodo, P.C. Struik, Genetic variability of cultivated cowpea in Benin assessed by random amplified polymorphic DNA, African Journal of Biotechnology 7 (24) (2008) 4407-4414. N. Malviya, B.K. Sarangi, M.K. Yadav, D. Yadav, Analysis of genetic diversity in cowpea (Vigna unguiculata L. Walp.) cultivars with random amplified polymorphic DNA markers, Plant Syst. Evol. 298 (2012) 523-526. F.S. Ba, R.S. Pasquet, P. Gepts, Genetic diversity in cowpea [Vigna unguiculata (L.) Walp.] as revealed by RAPD markers, Genetic Resources and Crop Evolution 51 (2004) 539-550. K.K. Nkongolo, Genetic characterization of Malawian cowpea (Vigna unguiculata (L.) Walp.) landraces: Diversity and gene flow among accessions, Euphytica 129 (2003) 219-228. C.Y. Chen, L. Pan, Z.H. Hu, H. Peng, Y. Ding, RAPD Analysis of yardlong bean (Vigna unguiculata ssp. sesquipedalis) cultivars, Journal of Jianghan University 36 (2008) 77-83. (in Chinese) C.D. Li, C.A. Fatokun, B. Ubi, B.B. Singh, G.J. Scoles, Determining genetic similarities and relationships among cowpea breeding lines and cultivars by microsatellite markers, Crop Science 41 (1) (2001) 189-197. L.A. Ogunkanmi, O.T. Ogundipe, N.Q. Ng, C.A. Fatokun,

1198

[17]

[18]

[19]

[20]

[21]

[22]

[23]

[24]

[25]

[26]

A Review of Molecular Makers Applied in Cowpea (Vigna unguiculata L. Walp.) Breeding Genetic diversity in wild relatives of cowpea (Vigna unguiculata) as revealed by simple sequence repeats (SSR) markers, Journal of Food, Agriculture & Environment 6 (2008) 263-268. A.T. Asare, B.S. Gowda, K.A. Galyuon, L.L. Aboagye, J.F. Takrama, M.P. Timko, Assessment of the genetic diversity in cowpea (Vigna unguiculata L. Walp.) germplasm from Ghana using simple sequence repeat markers, Plant Genetic Resources 8 (2) (2010) 142-150. F.A. Badiane, B.S. Gowda, N. Cisse, D. Diouf, O. Sadio, M.P. Timko, Genetic relationship of cowpea (Vigna unguiculata) varieties from Senegal based on SSR markers, Genetics And Molecular Research 11 (1) (2012) 292-304. M. Sawadogo, J.T. Ouedraogo, B.S. Gowda, M.P. Timko, Genetic diversity of cowpea (Vigna unguiculata L. Walp.) cultivars in Burkina Faso resistant to Striga gesnerioides, African Journal of Biotechnology 9 (48) (2010) 8146-8153. J.R. Lee, H.J. Back, M.S. Yoon, S.K. Park, Y.H. Cho, C.Y. Kim, Analysis of genetic diversity of cowpea landraces from Korea determined by Simple Sequence Repeats and establishment of a core collection, Korean Journal of Breeding Science 41 (4) (2009) 369-376. P. Xu, X.H. Wu, B.G. Wang, Y.H. Liu, D.H. Qin, J.D. Ehlers, Development and polymorphism of Vigna unguiculata ssp. unguiculata microsatellite markers used for phylogenetic analysis in asparagus bean (Vigna unguiculata ssp. sesquipedialis (L.) Verdc.), Mol Breeding 25 (4) (2010) 675-684. Y.H. Xu ， J.P. Guan, X.S. Zong, Genetic diversity analysis of cowpea germplasm resources by SSR, Acta Agronomica Sinica 33 (7) (2007) 1206-1209. (in Chinese) S. Coulibaly, R.S. Pasquet, R. Papa, P. Gepts, AFLP analysis of the phenetic organization and genetic diversity of Vigna unguiculata L. Walp. reveals extensive gene flow between wild and domesticated types, Theoretical and Applied Genetics 104 (2002) 358-366. J.G. Fang, C.T. Chao, P.A. Roberts, J.D. Ehlers, Genetic diversity of cowpea [Vigna unguiculata (L.) Walp.] in four West African and USA breeding programs as determined by AFLP analysis, Genetic Resources and Crop Evolution 54 (6) (2007) 1197-1209. N. Tosti, V. Negri, On-going on-farm microevolutionary processes in neighbouring cowpea landraces revealed by molecular markers, Theoretical and Applied Genetics 110 (7) (2005) 1275-1283. A.G. Gillaspie, M.S. Hopkins, R.E. Dean, Determining genetic diversity between lines of Vigna unguiculata subspecies by AFLP and SSR markers, Genetic Resources and Crop Evolution 52 (3) (2005) 245-247.

[27] J.W. Schut, X. Qi, P. Stam, Association between relationship measures based on AFLP markers, prdgree data and morphological traits in barley, Theoretical and Applied Genetics 95 (7) (1997) 1161-1168. [28] N. Ghalmi, M. Malice, J.M. Jacquemin, S.M. Ounane, L. Mekiche, J.P. Baudoin, Morphological and molecular diversity within Algerian cowpea (Vigna unguiculata (L.) Walp.) landraces, Genet Resources and Crop Evolution 57 (3) (2010) 371-386. [29] G. Thottappilly, L.M. Monti, D.R. Mohan-Raj, A.W. Moore, Biotechnology: Enhancing research on tropical crops in Africa, IITA, Ibadan, Nigeria, 1992, pp. 237-246. [30] C.M. Menendez, A.E. Hall, P. Gepts, A genetic linkage map of cowpea (Vigna unguiculata) developed from a cross between two inbred, domesticated lines, Theoretical and Applied Genetics 95 (1997) 1210-1217. [31] J.T. Ouedraogo, B.S. Gowda, M. Jean, T.J. Close, An improved genetic linkage map for cowpea (Vigna unguiculata L.) combining AFLP, RFLP, resistance traits, Genome 45 (1) (2002) 175-188. [32] A. Kongjaimun, A. Kaga, N. Tomooka, P. Somta, T. Shimizu, Y. Shu, An SSR-based linkage map of yardlong bean (Vigna unguiculata (L.) Walp. subsp. unguiculata Sesquipedalis Group) and QTL analysis of pod length, Genome 55 (2) (2012) 81-92. [33] M. Andargie, R.S. Pasquet, B.S. Gowda, G.M. Muluvi, M.P. Timko, Construction of a SSR-based genetic map and identification of QTL for domestication traits using recombinant inbred lines from a cross between wild and cultivated cowpea (V. unguiculata (L.) Walp.), Mol Breeding 28 (2011) 413-420. [34] P. Xu, X.H. Wu, B.G. Wang, Y.H. Liu, J.D. Ehlers, T.J. Close, A SNP and SSR based genetic map of asparagus bean (Vigna. unguiculata ssp. sesquipedialis) and comparison with the broader species, PLoS ONE 6 (1) (2011) 1-8. [35] W. Muchero, N.N. Diop, P.R. Bhat, R.D. Fentonb, S. Wanamakerb, M. Pottorffb, A consensus genetic map of cowpea [Vigna unguiculata (L.) Walp.] and synteny based on EST-derived SNPs, PNAS 106 (43) (2009) 18159-18164. [36] J.T. Ouedraogo, V. Maheshwari, D.K. Berner, C.A. Stpierre, F. Belzile, M.P. Timko, Identification of AFLP markers linked to resistance of cowpea (Vigna unguiculata L.) to parasitism by Striga gesnerioides, Theoretical and Applied Genetics 102 (2001) 1029-1036. [37] O. Boukar, L. Kong, B.B. Singh, L. Murdock, H.W. Ohm, AFLP and AFLP-derived SCAR markers associated with Striga gesnerioides resistance in cowpea, Crop Science 44 (4) (2004) 1259-1264. [38] G.J. Li, Y.H. Liu, J.D. Ehlers, Z.J. Zhu, X.H. Wu, B.G.

A Review of Molecular Makers Applied in Cowpea (Vigna unguiculata L. Walp.) Breeding

[39]

[40]

[41]

[42]

[43]

Wang, Identification of an aFLP fragment linked to rust resistance in asparagus bean and its conversion to a SCAR marker, HortScience 42 (5) (2007) 1153-1156. S.R. Singh, D.J. Allen, Pests and diseases, resistance and protection in cowpea, in : R.J. Summerfield and A.H. Bunting (Eds.), Advances in Legumes Science, Royal Botanic Gardens, Kew, London, 1980. G.O. Myers, C.A. Fatokun, N.D. Young, RFLP mapping of an aphid resistance gene in cowpea (Vigna unguiculata L. Walp.), Euphytica 91 (1996) 181-187. C.A. Fatokun, D.I. Menancio-Hautea, D. Danesh, N.D. Young, Evidence for orthologous seed weight genes in cowpea and mung bean based on RFLP mapping, Genetics 132 (3) (1992) 841-846. W. Muchero, J.D. Ehlers, T.J. Close, P.A. Roberts, Mapping QTL for drought stress-induced premature senescence and maturity in cowpea [Vigna unguiculata (L.) Walp.], Theoretical and Applied Genetics 118 (5) (2009) 849-863. E.M. Agbicodo, C.A. Fatokun, R. Bandyopadhyay, K. Wydra, N.N. Diop, W. Muchero, Identification of markers associated with bacterial blight resistance loci in

[44]

[45]

[46]

[47]

[48]

1199

cowpea [Vigna unguiculata (L.) Walp.], Euphytica 175 (2010) 215-226. W. Muchero, J.D. Ehlers, T.J. Close, P.A. Roberts, Genic SNP markers and legume synteny reveal candidate genes underlying QTL for Macrophomina phaseolina resistance and maturity in cowpea [Vigna unguiculata (L.) Walp.], BMC Genomics 12 (2011) 8-22. W. Muchero, J.D. Ehlers, P.A. Roberts, QTL analysis for resistance to foliar damage caused by Thrips tabaci and Frankliniella schultzei (Thysanoptera: Thripidae) feeding in cowpea [Vigna unguiculata (L.) Walp.], Mol Breed 25 (1) (2010) 47-56. R.E. Vaillancourt, N.F. Weeden, J. Barnard, Isozyme diversity in the cowpea species complex, Crop Science 33 (3) (1993) 606-613. R.S. Pasquet, Allozyme diversity of cultivated cowpea Vigna unguiculata (L.) Walp., Theoretical and Applied Genetics 101 (2000) 211-219. R.S. Pasquet, G. Mergeai, J.P. Baudoin, Genetic diversity of the African geocarpic legume Kersting’s groundnut, Biochemical Systematics and Ecology 30 (10) (2002) 943-952.

Journal of Life Sciences 6 (2012) 1200-1205

Does Müller Cell Differentiation Occur Prior to the Emergence of Synapses in Embryonic Turtle Retina? Yolanda Segovia1, Rosa María Perez2, Norberto Mauricio Grzywacz3 and Joaquin De Juan1 1. Departamento de Biotecnología, Universidad de Alicante, Alicante 03080, Spain 2. Departamento de Enfermería, Universidad de Alicante, Alicante 03080, Spain 3. Department of Biomedical Engineering, University of Southern California, Los Angeles, CA 90089-111, USA Received: May 30, 2012 / Accepted: August 13, 2012 / Published: November 30, 2012. Abstract: Müller cells are the main glial cells in the retina, and are related to plexiform layer activity. Recent studies have demonstrated that Müller cells are involved in the synaptic conservation, plasticity, development and metabolism of glutamate. During turtle retinal development, layers, cells and synapses appear at different times. The aim of this research is to study the emergence of Müller cells during embryonic development and their relationship with the synaptogenesis. The authors used retinas from Trachemys scripta elegans embryos at stages S14, 18, 20, 23, and 26. Some retinas were processed with immunocytochemistry in order to detect the presence of glutamine synthetase in Müller cells, which was used as a marker of these cells. Other retinas from the same stages were processed for ultrastructural studies. Samples were observed in confocal and transmission electron microscopes, respectively. The present results show that glutamine synthetase expression in Müller cells occurs at S18, before the emergence of the retinal layers and the early synapses. Key words: Synaptogenesis, retinal development, glutamine synthetase, ultrastructure, immunochemistry.

1. Introduction In recent years, synaptogenesis research has focused on the role of glial cells in the formation and elimination of synapses [1, 2]. In vertebrate retinas, Müller cells represent the main glial cell type and play an important role in the maintenance of retina homeostasis. Their trophic factors and mediators are active players in the synthesis, release and signaling of the synaptic function [3]. GS (Glutamine synthetase) is an enzyme present in all organisms, from bacteria to humans, which catalyzes the amidation of glutamate to glutamine. In the vertebrate retina, GS is found exclusively within Müller cells [4-6], and it plays an important role in controlling the level of extracellular neurotransmitters such as glutamate and GABA [4, 7]. Corresponding author: Joaquín De Juan, Ph.D., professor, research field: cell biology. E-mail: [email protected].

It is thought that GS expression occurs in parallel to the morphological differentiation of Müller cells during retinal development [8, 9] and to astrocyte differentiation in brain development [10-12]. Studies by Prada et al [13] showed that GS expression during development is not related to the degree of differentiation. In fact, early Müller cell differentiation is not detectable by the marker proteins available to date [14]. However, Peterson et al [15] showed that GS is expressed early in development, and they described the process of Müller cell differentiation using a biphasic model in which different markers appear according to the development stage. During the embryonic retinal development, before light responses begin, a transient circuit gives rise to propagating synchronized waves between neighbor ganglion cells [16]. This spontaneous activity could be the starter of the synaptogenesis and regulate the emergence of distinct connectivity patterns [17].

Does Müller Cell Differentiation Occur Prior to the Emergence of Synapses in Embryonic Turtle Retina?

Propagating retinal waves have been also studied in the turtle retina during development [18]. Müller cells could be also participating in this process [3]. The aim of this research was to study Müller cell differentiation in relation to the emergence of synapses in the inner plexiform layer of embryonic turtle retina. To this end, we examined the expression of glutamine synthetase as a marker of the Müller cells. The synapses in the inner plexiform layer were detected using ultrastruc tural techniques. The main result of this study has demonstrated that Müller cells were differentiated before synapses occurred

in

turtle

retina

during

embryonic

development. This finding suggests that Müller cells may play a decisive role in synaptic plasticity and the emergence of electrical activity during turtle retinal development.

was

obtained

from

the immunostaining studies. Subsequently, sections were treated with a saturated solution of sodium-periodated for 20 minutes at room temperature and rinsed in 0.1N HCl and distilled water. Nonspecific binding was blocked by incubation in 5% normal goat serum. Sections were incubated overnight at room temperature in a dark humid chamber in rabbit anti-glutamine synthetase (Sigma-Aldrich; dilution 1:500). The following day, slides were washed in PBS and incubated for two hours in CyTM3-conjugated Affinity Pure Donkey anti-rabbit IgG (Jackson Immuno Research Laboratories; dilution 1:100). Sections were washed for 30 min in PBS and cover-slipped with Vectashield mounting medium. Sections from each turtle eyecup were used for controlling experiments. Immunolabeled sections were examined by confocal microscopy. 2.2 Ultrastructural Studies

2. Materials and Methods Data

1201

embryonic

turtle

(Trachemys scripta elegans) retinas supplied by Kliebert (Hammond, LA). Turtle developmental stages were selected using criteria established by Yntema [19]. The following stages were used: S14, S18, S20, S23 and S26 (hatching). All procedures were performed in accordance with the National Institute of Health Guide for the Care and Use of Laboratory Animals. Turtle eggs were kept in a humid incubator at 29 °C. Animals were decapitated and pithed, and the eyes were removed quickly and bisected [20]. Once the retinas had been isolated, they were examined using two types of procedures: ultrastructural and immunostaining studies. 2.1 Immunohistochemistry After isolation, retinas were immediately submerged overnight in 4% paraformaldehyde, 0.1 % glutaraldehyde in 0.1 M phosphate buffer and included in an acrylic resin, LR-White (London Resin Company Ltd). Some semi thin sections were dyed with toluidine blue, while others were used to perform

For transmission electronic microscopy, the retinas were fixed by immersion in 1% paraformaldehyde, 1.6% glutaraldehyde, and 0.15 Mm calcium in 0.1 M phosphate buffer (pH 7.4) overnight. Then, retinas were washed in 0.1 M phosphate buffer, postfixed in 2 % osmium tetraoxide, and included in an epoxy resin, Epon 812. Thin sections of 70 nm were contrasted with uranyl acetate and lead citrate and observed in a Zeiss EM10C/CR electron microscope.

3. Results 3.1 Retinal Development Embryogeny lasts about 60 days in the turtle Trachemys scripta elegans, divided into 26 stages [19]. Prior to stage 18 (≈ embryonic day 25), there is no clear differentiation in retinal layers. The synaptogenesis of turtle retina begins at S18 when IPL (the inner plexiform layer) first appears throughout the retina. In this stage, the IPL is visible under light microscopy (Fig. Aa1), although our electronic microscopy results show that the IPL is not completely

1202

Does Müller Cell Differentiation Occur Prior to the Emergence of Synapses in Embryonic Turtle Retina?

Fig. 1 Photomicrographs from embryonic turtle retinas. Stage 18 (A), S20 (B), S23 (C) and S26 (D). (a1, b1, c1 and d1) Photomicrographs taken from 1 μm-thick vertical semi-thin section stained with toluidine blue. (a2, b2, c2 and d2) Confocal photomicrographs taken from 1 μm-thick vertical semi-thin section processed for GS immunoreactivity. (a3, b3, c3 and d3) Electron micrographs taken from 70 nm-thick vertical thin-sections of IPL. (A) OPL is not clearly visible in contrast to the IPL (a1). NbL and endfeet region of Müller cells (arrows), show a scanty GS labeling (a2). In electron micrographs, IPL appears as an area with empty spaces, filled by growing neurites, without synapses (a3). (B) OPL becomes visible (b1), and a large increase in GS expression is observed in the INL and the GCL (b2). Extracellular spaces and the synaptic contacts are scarce in the IPL (b3). (C) All layers are well identifiable (c1). INL, GCL and endfeet region (arrows) show GS immunoreactivity (c2). IPL show clear synaptic contacts (c3), with synaptic vesicles (*). (D) All layers are mature and well defined (d1). The pattern of GS labeling is here more diffuse and locate in the middle INL (d2). IPL show clear synaptic contacts (d3), with synaptic vesicles and synaptic ribbons (sr). ONL, outer nuclear layer; NbL, neuroblastic layer, OPL, outer plexiform layer, INL, inner nuclear layer; IPL, inner plexiform layer; GCL, ganglion cell layer. GS, glutamine synthetase. Scale bars 25 μm (a1-a2; b1-b2; c1-c2; d1-d2); 0.5 μm (a3; b3; c3; d3).

1203

Does Müller Cell Differentiation Occur Prior to the Emergence of Synapses in Embryonic Turtle Retina?

mature at this stage. It appears as a thin zone with many empty spaces, which are rapidly filled by growing neurites (Fig. Aa3). Therefore, this stage is still immature. OPL (the outer plexiform layer) is also immature at S18, being essentially invisible with light microscopy, in contrast to the IPL (Fig. Aa1). It takes about S20 (≈ embryonic day 30) for the OPL to become visible under light microscopy (Fig. Bb1). However, this layer does not present synaptic contacts. Moreover, at this stage, electron microscopy shows that the empty extracellular spaces are practically absent in the IPL (Fig. Bb3). Synaptic contacts, such as conventional synapses and occasional synaptic ribbons appear for the first time in this layer, but they are scarce. At S23 (≈ embryonic day 40), the OPL and IPL layers are evident (Fig. Cc1). The electronic microphotograph reveals abundant synapses in plexiform layers (Fig. Cc3). Furthermore, in the IPL there are more synaptic contacts, conventional synapses and synaptic ribbons than at S20. At hatching (S26), all layers and synapses in the retina are well defined (Fig. Dd1-d3). 3.2 Development of GS Immunoreactivity

4. Discussion In order to understand the possible influence of Müller cells in retinal synaptogenesis, we studied their appearance during retinal development using GS immunoreactivity in the retina, and this was used as a specific marker for these cells [4, 6]. In fact, GS is the earliest described marker of Müller cells in zebrafish [15] and other species [21]. In our study, GS immunoreactivity was first observed at S18, when the IPL had developed, separating the retina into a definitive GCL and INL [20]. These findings corroborate the results of previous reports in which labeling of Müller cells occurs before the completion of lamination; the IPL has taken shape while the OPL has not completed development. The early appearance of Müller cells suggests an important role in neurogenesis [15]. As has been reported in other papers, during development, glial cells function as a scaffold and are involved in axonal migration in nervous tissues [22-28]. Moreover, the observation that at S18, GS immunoreactivity is very low could be because it is basal or constitutive [29]. In effect, if GS is basal at S18, it cannot be involved in

In stages prior to S18, the retina showed negative

the degradative metabolism of extracellular glutamate

immunoreactivity to GS. The first positive GS

released by neuronal activity, since there are no

immunoreactivity appears at S18 (Fig. Aa2). At this

differentiated synapses in either of the plexiform

stage, Müller cells show a low labeling intensity in

layers at this stage [30-32]. In fact, in our results at

INL (the inner nuclear layer) and GCL (ganglion cell

this stage, the electron microscopy shows an IPL as a

layer). Five days later, at S20, a large increase in GS

thin acellular zone consisting of immature neurites

expression is seen in the INL and the GCL (Fig. Bb2).

and growth cones scattered within large extracellular

This period shows an intensive staining of inner

spaces and without synaptic contacts. On the other

Müller cell processes and the granular pattern of

hand, later in development, glial cells promote

Müller cell bodies and Müller cell endfeet can be

synapse formation and plasticity [2, 33]. As already

observed. At S23, Müller cells show more GS

mentioned

immunoreactivity than at previous stages. This

synaptogenesis in turtle starts at S20, when plexiform

increase is more noticeable in the INL than in the

layers have been formed and both conventional

endfeet region of Muller cells (Fig. Cc2). Finally, at

synapses and occasional synaptic ribbons appear.

S26, the granular pattern of GS changes to a diffuse

From S20 to hatching, the number and maturation of

pattern with a Müller cell shape throughout the retina

synaptic contacts increase. This increase in synaptic

(Fig. Dd2).

contacts during development occurs in parallel with

in

the

results

section,

retinal

1204

Does Müller Cell Differentiation Occur Prior to the Emergence of Synapses in Embryonic Turtle Retina?

the increase in GS immunoreactivity from S20 to hatching. These results are consistent with those reported by Prada et al. [13] in rats.

[5]

5. Conclusions GS labeled Müller cells were observed in

[6]

Trachemys scripta elegans retinas from S18, prior to complete emergence of retinal layers and initiation of synapse formation at S20. At S23 (≈ embryonic day

[7]

40), the OPL and IPL are evident and electronic microphotographs show abundant conventional and ribbon synapses. GS labeling indicates a progressive

[8]

increase between S18 and S26, suggesting that Müller cells may play an important role in synaptic plasticity [9]

during turtle retinal development.

Acknowledgments The authors thank Vanessa Pinilla, Gemma Prieto

[10]

and Shaila Lecegui for their technical assistance. Confocal and ultrastructural images were obtained by the University Alicante Technical Research Services (SSTTI).

This

Conselleria

project

d'Educació

was

supported

(Generalitat

by

[11]

the

Valenciana)

Grants BEST-2008-069 and BEST-2010-229 to JDJ

[12]

and the Pro-vice-chancellorship of Research Grants VIGROB-137 (2010-2011).

References [1]

[2]

[3]

[4]

C. Eroglu, B.A. Barres, B. Stevens, Glia as active participants in the development and function of synapses, in: J.W. Ehlers, M.D. Hell (Eds.), Structural and Functional Organization of Synapse, Springer, New York, 2008, pp. 683-714. B. Stevens, Neuron-astrocyte signaling in the development and plasticity of neural circuits, Neurosignals 16 (2008) 278-288. R.A. de Melo Reis, A.L. Ventura, C.S. Schitine, M.C. de Mello, F.G. de Mello, Muller glia as an active compartment modulating nervous activity in the vertebrate retina: Neurotransmitters and trophic factors, Neurochemical Research 33 (2008) 1466-1474. F. Shen, B. Chen, J. Danias, K.C. Lee, H. Lee, Y. Su, et al., Glutamate-induced glutamine synthetase expression in retinal Muller cells after short-term ocular

[13]

[14]

[15]

[16]

hypertension in the rat, Investigative Ophthalmology & Visual Science 45 (2004) 3107-3112. P. Linser, A.A. Moscona, Induction of glutamine synthetase in embryonic neural retina: Localization in Müller fibers and dependence on cell interactions, Proceedings of the National Academy of Sciences of the United States of America 76 (1979) 6476-6480. R.E. Riepe, M.D. Norenburg, Müller cell localization of glutamine synthetase a rat retina, Nature 265 (1977) 654-655. A. Bringmann, T. Pannicke, B. Biedermann, M. Francke, I. Iandiev, J. Grosche, et al., Role of retinal glial cells in neurotransmitter uptake and metabolism, Neurochemistry International 54 (2009) 143-160. G.J. Chader, Hormonal effects on the neural retina: I. Glutamine synthetase development in the retina and liver of the normal and triiodothyronine-treated rat, Archives of Biochemistry and Biophysics 144 (1971) 657-662. J.W. Olney, An electron microscopic study of synapse formation, receptor outer segment development, and other aspects of developing mouse retina, Investigative Ophthalmology and Visual Science 7 (1968) 250-268. K.M. Mearow, J.F. Mill, L. Vitkovic, The ontogeny and localization of glutamine synthetase gene expression in rat brain, Molecular Brain Research 6 (1989) 223-232. A.J. Patel, A. Hunt, C.S.M. Thaourdin, Regional development of glutamine synthetase activity in the rat brain ant its association with differentiation of astrocytes, Developmental Brain Research 8 (1983) 31-37. J.F. Wernicke, J.J. Volpe, Glial differentiation in dissociated cell cultures of neonatal rat brain: Noncoordinate and density-dependent regulation of oligodendroglial enzymes, Journal of Neuroscience Research 15 (1986) 39-47. F.A. Prada, A. Quesada, M.E. Dorado, C. Chmielewski, C. Prada, Glutamine synthetase (GS) activity and spatial and temporal patterns of GS expression in the developing chick retina: Relationship with synaptogenesis in the outer plexiform layer, Glia 20 (1998) 221-236. P.R. Williams, S.C. Suzuki, T. Yoshimatsu, O.T. Lawrence, S.J. Waldron, M. Parsons, et al., In vivo development of outer retinal synapses in the absence of glial contact, The Journal of Neuroscience 30 (2010) 11951-11961. R.E. Peterson, J.M. Fadool, J. McClintock, P.J. Linser, Muller cell differentiation in the zebrafish neural retina: Evidence of distinct early and late stages in cell maturation, The Journal Comparative Neurology 429 (2001) 530-540. K. J. Ford, A.L. Félix, M.B. Feller, Cellular mechanisms underlying spatiotemporal features of cholinergic retinal waves, The Journal of Neuroscience 32 (2012) 850-863.

Does Müller Cell Differentiation Occur Prior to the Emergence of Synapses in Embryonic Turtle Retina? [17] F. Soto, X. Ma, J.L. Cecil, B.Q. Vo, S.M. Culican, D. Kerschensteiner, Spontaneous activity promotes synapse formation in a cell-type-dependent manner in the developing retina, The Journal of Neuroscience 32 (2012) 5426-5439. [18] N.M. Grzywacz, E. Sernagor, Spontaneous activity in developing turtle retinal ganglion cells: Statistical analysis, Visual Neuroscience 17 (2000) 229-241. [19] C.L. Yntema, A series of stages in the embryonic development of Chelydra serpentine, Journal of Morphology 125 (1968) 219-251. [20] L.T. Nguyen, J. De Juan, M. Mejia, N.M. Grzywacz, Localization of choline acetyltransferase in the developing and adult turtle retinas, The Journal Comparative Neurology 420 (2000) 512-526. [21] P.J. Linser, R. Peterson, J. McClintock, J. Possley, R. Orozco, The regulation of Müller cell differentiation: Focus on the definitive Müller cell markers glutamine synthetase and carbonic anhydrase-II, Brain Research 37 (1996) 213-214. [22] P. Rakic, Neuron-glia relationship during granule cell migration in developing cerebellar cortex: A Golgi and electronmicroscopic study in Macacus rhesus, The Journal Comparative Neurology 141 (1971) 283-312. [23] M. Singer, R.H. Nordlander, M. Egar, Axonal guidance during embryogenesis and regeneration in the spinal cord of the newt: The blueprint hypothesis of neuronal pathway patterning, The Journal Comparative Neurology 185 (1979) 1-21. [24] J. Silver, U. Rutishauser, Guidance of optic axons in vivo by a preformed adhesive pathway on neuroepithelial

1205

endfeet, Developmental Biology 106 (1984) 485-499. [25] J.R. Jacobs, C.S. Goodman, Embryonic development of axon pathways in the Drosophila CNS: I. A glial scaffold appears before the first growth cones, The Journal of Neuroscience 9 (1989) 2402-2411. [26] J.R. Jacobs, Y. Hiromi, N.H. Patel, C.S. Goodman, Lineage, migration, and morphogenesis of longitudinal glia in the Drosophila CNS as revealed by a molecular lineage marker, Neuron 2 (1989) 1625-1631. [27] G. Fishell, M.E. Hatten, Astrotactin provides a receptor system for CNS neuronal migration, Development 113 (1991) 755-765. [28] T.N. Stitt, U.E. Gasser, M.E. Hatten, Molecular mechanisms of glial guided neuronal migration, Annuals of the New York Academy of Sciences 633 (1991) 113-121. [29] A.A. Moscona, Hormonal regulation of glutamine synthetase in the retina: Role of cell interactions, Progress in Clinical and Biological Research 226 (1986) 297-306. [30] H. Hering, S. Kröger, Formation of synaptic specializations in the inner plexiform layer of the developing chick retina, The Journal Comparative Neurology 375 (1996) 393-405. [31] W.F. Hughes, A. LaVelle, On the synaptogenic sequence in the chick retina, The Anatomical Record 179 (1974) 297-301. [32] K. Meller, P. Glees, The differentiation of neuroglia-Müller-cells in the retina of chick, Cell and Tissue Research 66 (1965) 321-332. [33] M. Bolton, C. Eroglu, Look who is weaving the neural web: Glial control of synapse formation, Current Opinion in Neurobiology 19 (2009) 491-497.

Journal of Life Sciences 6 (2012) 1206-1213

T-Helper 1 Cell/T-Helper 2 Cell Balance with Anti Inflammatory Therapy in Partly Controlled Asthmatic Children Gamal Abdel Naser Yamamah1, Hala Hamdy Shaaban2, Emad Ezzat Salama1, Nevine El Helaly2, Solaf Kamel3 and Elham Mostafa1 1. Pediatrics Department, National Research Center (NRC), Cairo 12622, Egypt 2. Pediatrics Department, Faculty of Medicine, Cairo University, Cairo 11562, Egypt 3. Clinical and Chemical Pathology Department, National Research Center, Cairo 12622, Egypt Received: May 20, 2012 / Accepted: July 12, 2012 / Published: November 30, 2012. Abstract: The authors aimed to assess Th1 (T-helper cell 1)/Th2 (T-helper cell 2) balance, through evaluation of serum IFN- (interferon gamma) and IL-4 (interleukin 4), during asthma exacerbation and study the effect of anti inflammatory therapy. A randomized prospective case-control study was designed. The study included 30 asthmatic patients, aging 8-14 years. All were diagnosed as partly controlled asthmatics. Twenty, age and sex matched, healthy children were included in the study as control group. All participants were subjected to medical history, clinical examination, pulmonary function testing, eosinophilic blood counting, estimation of serum interleukine-4 and interferon gamma. Patients were treated for 6 weeks with 2 different anti inflammatory drugs. All methods were then repeated for follow up. IL-4 serum level was significantly higher in subjects with partly controlled asthma than in control subjects (P = 0.01), and then in asthmatic patients after therapy (P = 0.0000), while IFN-γ serum level was significantly lower in subjects with partly controlled asthma than in control subjects (P = 0.01), and than in asthmatic patients after therapy (P = 0.0000). Interferon gamma showed a significant negative correlation with IL-4 among the healthy control group (r = -0.559, P = 0.010). Both LTA (leukotriene antagonist) and ICS (inhaled corticosteroids) therapy lead to significant improvement, but there were no statistically significant differences (P > 0.05) between them as regard the pulmonary functions and the laboratory evaluating parameters. Both serum levels of IL-4 and IFN-γ could be used as a reliable inflammatory biomarker for the evaluation and follow up of asthmatic patients. Key words: Th1, Th2, IFN-, IL-4, partly controlled asthma, LTA, ICS.

1. Introduction Asthma is a chronic inflammation of the airways with reversible episodes of obstruction, caused by an increased reaction of the airways to various stimuli in which many cells and cellular elements play a role [1]. Approximately 300 million people worldwide currently have asthma, with estimates suggesting that asthma prevalence increases globally by 50% every decade. Prevalence is high (> 10%) in developed Corresponding author: Gamal Abdel Naser Yamamah, M.D., professor, research fields: pediatrics, allergy and immunology. E-mail: [email protected].

countries and, although data are still missing (including data for much of Africa), rates are increasing in developing regions as they become more westernized [2]. Recent guidelines provide classification of asthma by level of control into three categories (controlled, partly controlled and uncontrolled asthma), based on daytime symptoms, nocturnal symptoms, limitation of activity, need to quick-relief medicine, peak flow rate, and incidence of exacerbation per year [3]. Cytokines direct and modify the inflammatory response in asthma and likely determine its severity

T-Helper 1 Cell/T-Helper 2 Cell Balance with Anti Inflammatory Therapy in Partly Controlled Asthmatic Children

[4]. Th2 cells differentiate from uncommitted precursor T cells under the influence of IL-4. They orchestrate allergic inflammation through the release of the cytokines IL-4, IL-5, IL-9, and IL-13 [5]. The conventional definition of a Th1 or Th2 cell depends strictly on the secretion of IFN-γ or IL4. Th1 cells secrete IFN-γ but do not secrete IL4, whereas Th2 cells secrete IL4 but not IFN-γ. T cells secreting neither IFN-γ nor IL4 are neither Th1 nor Th2 cells. They are Th3 cells [6]. Generally, in healthy individuals the immune system is in homeostasis, or has balanced expression of Th1 and Th2 cytokines. If a foreign invader triggers an adaptive cellular or Th1-type response, the feedback mechanism within the immune system greatly reduces the humoral or Th2-type response. Once the invader is controlled or eliminated, a combination of hormones and cytokines act quickly to return the system back towards homeostasis through the same feedback mechanism [7]. Research has focused on an imbalance between Th1 and Th2 cytokine profiles and evidence that allergic diseases, and possibly asthma, are characterized by a shift toward a Th2 cytokine-like disease, either as over expression of Th2 or under expression of Th1. Airway inflammation in asthma may represent a loss of normal balance between two “opposing” populations of Th lymphocytes [4]. The current “hygiene hypothesis” of asthma illustrates how this cytokine imbalance may explain some of the dramatic increases in asthma prevalence in westernized countries. This hypothesis is based on the assumption that the immune system of the newly born is skewed toward Th2 cytokine generation. Following birth, environmental stimuli such as infections will activate Th1 responses and bring the Th1/Th2 relationship to an appropriate balance. Evidence indicates that the incidence of asthma is reduced in association with certain infections (M. tuberculosis, measles, or hepatitis A), exposure to other children (e.g., presence of older siblings and

1207

early enrollment in childcare), and less frequent use of antibiotics [8]. The objective of the authors’ study was to assess Th1/Th2 balance in asthmatic children, represented by serum level of IFN- and IL-4 respectively, and to correlate this ratio with asthma severity. Also to assess Th1/Th2 changes with different anti inflammatory therapy.

2. Subjects and Methods 2.1 Study Design A randomized prospective case-control study was designed. Subjects: The study included 30 asthmatic patients, between the ages of 8-14 years. All of the patients were diagnosed as partly controlled asthmatics based upon the classification of asthma control according to GINA guidelines [3]. They were attending the Allergy Clinic of Children’s Hospital, Cairo University, Egypt, over 9 months period from February to October 2010. The patients did not suffer any other respiratory or health problems. They were not participating in any other clinical study. Patients were not receiving treatment in the previous month to the study. Twenty, age and sex matched, healthy children were included in the study as control group. All the participant’s guardians had signed written form consent after explaining the steps and aim of the study to them. Patients with history of chronic lung or systemic diseases were excluded from the study. 2.2 Methods All participants were subjected to: (1) Thorough medical history: including personal history-full history of asthma as onset, course and duration of symptoms-frequency and severity of symptoms etc.. (2) Clinical examination: including vital signs recording, weight and height measuring, chest examination in detail and other systems examination (Table 1).

1208

T-Helper 1 Cell/T-Helper 2 Cell Balance with Anti Inflammatory Therapy in Partly Controlled Asthmatic Children

(3) Pulmonary Function Test: Using a spirometer (Fukuda Denshi, Spirosoft SP5000). Spirometric parameters included: FVC (forced vital capacity), FEV1(forced expiratory volume in the first second), PEFR (peak expiratory flow rate), FEF 25-75% (forced expiratory flow at middle half of expiration). The results of spirometry were expressed as a percentage of the predicted value adjusted for age, gender, weight, height and race (Table 2). Pulmonary function tests of cases before treatment showed levels consistent with partly controlled asthma stated by GINA [9]. All measured parameters ranged between 60% and 80% of the predicted value of healthy children. (4) Eosinophilic blood count (5) Estimation of serum IL-4: This was done by ELISA (enzyme linked immuno-sorbent assay), AviBion Human IL-4 ELISA kit provided by Orgenium Laboratories, Helsinki Finland, for the quantitative detection of human IL-4 in body fluids. The minimum detectable dose of IL-4 for this ELISA assay is < 3 pg/mL. (6) Estimation of serum IFN-: This was done by ELISA kit, for quantitative detection of human IFN-γ, provided by Bender MedSystems, Austria, Europe. The minimum detectable dose of IFN-γ for this ELISA assay is < 0.99 pg/mL. The intra-assay Table 1

IL-4 and IFN-. (9) Statistical Methods: SPSS (version15) statistical package was used for analysis of data. Data was summarized as mean and SD (standard deviation) of the total count for each group. Paired t-test and simple t-test have been used to test the equality of the means of

different

measured

parameters.

Pearson’s

correlation ( r ) was done to detect the relation among all the parameters that has been studied. P-value is considered to be significant if P < 0.05. A ROC (receiver-operating characteristic) curve was conducted using the GraphPad PRISM (version 5)

Characteristics of the study population.

Item Age (years) Gender (females/males) Weight (kg) Height (cm) Table 2

coefficient of variation for ELISA was 4.5%. (7) Medical treatment for 6 weeks: patients were randomly distributed into 2 groups: Group 1: 15 patients (8 males and 7 females) received a selective and orally LTA (5 mg per day chewable tablets for children < 12 years or 10 mg tablet for children ≥ 12 years, once daily, at bedtime). Group 2: 15 patients (11 males and 4 females) received ICS at a dose of 100 micrograms twice daily. It was supplied as an accuhaler/diskus, delivering 100 µg per action as oral inhalation). (8) Follow up: After 6 weeks, patients were subjected to: history follow up of symptoms and signs, clinical examination, pulmonary function testing, eosinophilic counting and assessment of both serum

Asthmatic children (n = 30) Mean ± S.D. 10.8 ± 2.24 11/19 37.2 ± 11.77 139.8 ± 13.9

Healthy controls (n = 20) 10.9 ± 2.26 10/10 37.6 ± 7.63 136.2 ± 12.2

P-value 0.818 0.349 0.894 0.342

Pulmonary function results for the studied groups.

Healthy control P-value Asthmatic before treatment P-value Asthmatic after treatment P-value Mean ± S.D. * Mean ± S.D. ** Mean ± S.D. *** FEV1% 85.54 ± 5.85 0.0000 72.50 ± 7.89 0.0000 85.10 ± 6.05 0.802 FVC% 86.00 ± 8.39 0.0001 73.30 ± 10.75 0.0000 84.97 ± 7.73 0.656 PEFR% 67.85 ± 7.85 0.0000 56.23 ± 7.51 0.0000 67.47 ± 6.38 0.850 FEF 25%-75% 79.75 ± 8.37 0.0022 68.67 ± 15.69 0.0001 81.23 ± 12.49 0.644 *: comparing the healthy controls and the asthmatic before therapy; **: comparing asthmatics before and after therapy; ***: comparing healthy control with asthmatics after therapy. Pulmonary function test

T-Helper 1 Cell/T-Helper 2 Cell Balance with Anti Inflammatory Therapy in Partly Controlled Asthmatic Children

improved after 6 weeks of therapy (P < 0.000). However, there were no significant difference between patients and the healthy controls (P > 0.05) as shown in Table 2. IL-4 serum level was significantly higher in patients than in control subjects (P = 0.01), and then in asthmatic patients after therapy (P = 0.0000). IFN-γ serum level was significantly lower in patients than in control subjects (P = 0.01), and then in asthmatic patients after therapy (P = 0.0000). Blood eosinophilic count was higher in patients than in control subjects (P = 0.0000), and then in asthmatic patients after therapy (P = 0.0000) as seen in Table 3. Interestingly, interferon gamma showed a significant negative correlation with IL-4 among the healthy control group (r = -0.559, P = 0.010) (Fig. 1). In the present work, mean serum IL-4 levels of asthmatic children was higher than healthy control group (P ≤ 0.0001). Krogulska et al. [10] stated that

for detection of reliability of IL-4 and IFN-γ for detection of asthma, and their best cutoff values. An AUCs (area under the curves) near 1 represents a perfect test; while an area of 0.5 represent a worthless test.

3. Results and Discussion Unfortunately, asthma is one of the most common chronic diseases, with an estimated 300 million individuals affected worldwide. Its prevalence is increasing, especially among children [9]. At present, lung function testing is the standard method for asthma assessment. It provides valuable information about severity of airway obstruction. 3.1 Spirometric and Lab Changes with Therapy The spirometric parameters showed significant differences (P < 0.05) between the healthy controls and the asthmatic patients before treatment. They Table 3

1209

Laboratory findings including serum IL-4, IFN-γ and eosinophilic count.

Healthy control P-value Asthmatic before treatment P-value Asthmatic after treatment P-value Mean ± S.D. * Mean ± S.D. ** Mean ± S.D. *** IL-4 2.4550 ± 1.1128 0.0100 5.5300 ± 2.9464 0.0000 3.1500 ± 1.2542 0.051 IFN-γ 2.2300 ± 1.5485 0.0100 0.5767 ± 0.4967 0.0000 5.2733 ± 3.1940 0.000 Eosinophil 2.2000 ± 1.5424 0.0000 6.3667 ± 3.7736 0.0000 2.9333 ± 2.4626 0.242 *: comparing the healthy controls and the asthmatic before therapy; **: comparing asthmatics before and after therapy; ***: comparing the healthy controls with the asthmatics after therapy. Item



Linear Regression

5.0 





4.0

INF-G

 

3.0



 



2.0

   

1.0











2.00

3.00

4.00



5.00

IL-4 Fig. 1

Correlation between IFN-γ and IL-4 in healthy controls (r = -0.559, P = 0.010).

1210

T-Helper 1 Cell/T-Helper 2 Cell Balance with Anti Inflammatory Therapy in Partly Controlled Asthmatic Children

studies suggested that IL-4 production increases in patients with asthma in comparison with healthy people. Abdulamir et al. [11] reported that the inflammatory reactions in mild intermittent asthma group were driven mainly by Th2 cytokines because of the very high level of IL-4 and moderately low level of IFN-γ. In one study of 64 asthmatics and 50 healthy controls, multivariate backward logistic regression models demonstrated that of all the cytokines tested (including TNF-alpha, IL-2, 4, 5, 10) the pro-inflammatory Th2 associated cytokine IL-4 was the only significant indicator of an asthma diagnosis [12]. The authors’ results conclude that, during acute attack, the serum IL-4 level increases and this confirms the increased activity of Th2 cells, and confirms its role in asthma. IFN-γ was lower in the asthmatics compared to the healthy children with statistically significant difference (P ≤ 0.0001). These findings were in concordance with Fu et al. [13] who revealed that the average level of serum IFN-γ decreased significantly in asthmatic patients as compared with that in control group (P < 0.01). In contrast, Hacken et al. [14] held a study including 17 atopic asthmatics and 8 non-atopic healthy subjects and reached a conclusion that the serum IL-4 and IFN-γ levels were

significantly higher in asthmatic subjects as compared to healthy controls. The authors’ results stated that there is an imbalance in the Th1/Th2 ratio represented in the significant low level of serum IFN-γ and the high level of serum IL-4 in asthmatic children compared to healthy ones. Asthma is believed to result from an imbalance consisting of overproduction of Th2 cytokines (IL-4, IL-5 and IL-13) with reduced production of the Th1 cytokine IFN-γ [15]. This was clearly declared by the high negative correlation between IL-4 and IFN-γ present in the present study. 3.2 Value of IL-4 and IFN-γ As Biomarkers By using ROC curve, the AUC for FEV1 and PEFR were 0.903 and 0.881 respectively, with significant P-value < 0.0001. Using ROC curve of FEV1% for the evaluation of asthma, AUC gives the best cutoff value at 78%, where sensitivity was 80% and specificity was 90%. The AUC for IL-4 and IFN-γ were 0.861 and 0.863 respectively, also with significant P-value < 0.0001. An IL-4 cutoff value of 2.6 pg/mL yields a sensitivity of 83.33% and a specificity of 75%, whereas an IFN-γ cutoff value of 1.3 pg/mL yields a sensitivity of 93.33% and a specificity of 65% (Figs. 2a and 2b).

ROC of IF-G:ROC curve 1.0

0.8

0.8

a ROC curve of serum IL-4 (a) and IFN-γ (b).

1 - Specificity b

1.0

0.8

0.0

1.0

0.8

0.0 0.6

0.0 0.4

0.2

0.2

0.2

1 - Specificity

Fig. 2

0.4

0.6

0.4

0.6

0.4

0.6

0.2

Senstivity

1.0

0.0

Senstivity

ROC of IL-4:ROC curve

T-Helper 1 Cell/T-Helper 2 Cell Balance with Anti Inflammatory Therapy in Partly Controlled Asthmatic Children

The results of ROC curve and calculation of AUC meant that the serum IL-4 level of 2.6 pg/mL is the point below which the patients could be properly controlled and above which they are not, and that conclusion with sensitivity of 83.33% and a specificity of 75%. Same wise, the serum IFN-γ level of 1.3 pg/mL is the point above which patients could be properly controlled and below which they are not controlled. The authors’ results came in agreement with Lababidi et al. [16] who reported that AUC in ROC curve for FEV1 for asthmatic children was 0.721. In another study including asthmatic children (aged 10.7 ± 3 years) and healthy controls (aged 10 ± 0.4 years), Robroeks et al. [12] reached a conclusion that asthma control was best assessed by exhaled IFN-γ and IL-4 (sensitivity 82%, specificity 80%, P < 0.05). These results show that the authors can consider IL-4 and IFN-γ as a reliable inflammatory markers for asthma monitoring and follow up, compared to the pulmonary function test which is still considered the corner stone for asthma monitoring and follow-up. 3.3 Effect of LTA and ICS Therapy The patients receiving ICS shows better improvement as regard FEV1%, FVC% and blood eosinophilic count which were 13.87%, 13.13% and

-3.53 respectively compared to that in the LTA group which were 11.33%, 10.20% and -3.33 respectively, yet there were no statistically significant difference (P-value > 0.05) between the two groups, except for the serum level of IL-4. Group 2 (ICS) showed significant better improvement (-3.16) compared to group 1 (LTA) which was improved by (-1.6) with P-value < 0.05 (Fig. 3). In the current study, The authors have compared the effect of both LTA (group 1) and ICS (group 2) for the treatment of asthma. There were no statistically significant differences between them as regard any of the assessed parameter (P > 0.05). This finding confirms the random distribution of patients and that there was no bias as regard selecting which medication to be used for any case. In both groups (1 and 2), the pulmonary function showed comparable statistically significant improvement of spirometry after treatment. Comparing the improvement between those two groups, the patients receiving ICS showed better improvement as regard FEV1% and FVC% compared to that in the LTA group, yet there were no statistically significant difference (P-value > 0.05) between the two groups. This means that in the authors’ patients with partly controlled asthma, the

100.00% 80.00% percentage of 60.00% improvment 40.00% 20.00% 0.00% LTA

Fig. 3

1211

Comparing the improvement between the two groups: LTA and ICS.

ICS

1212

T-Helper 1 Cell/T-Helper 2 Cell Balance with Anti Inflammatory Therapy in Partly Controlled Asthmatic Children

efficacy of LTA and ICS is nearly the same. Still there is debate about the efficacy of therapy between LTA and ICS. Many authors assume near equality effects [17, 18]. Others recommend ICS [19, 20]. In the current study, the authors have compared the improvement between the two groups based on the used medication and it turned out that although there was no statistical significant difference in the improvement of IFN-γ. However, serum IL-4 showed better statistical significant improvement in group 2 (receiving ICS) compared to group 1 (receiving LTA), with P-value ≤ 0.05.

[4]

[5]

[6]

[7]

4. Conclusions There is immunological imbalance between Th1 and Th2 cytokines represented in the high level of serum IL-4 and low level of serum IFN-γ in children with partly controlled asthma. This imbalance was clear during acute attacks and was improved markedly after using either ICS or LTA. ICS (fluticasone) showed significantly better effect on the serum level of IL-4 compared to LTA (montelukast). Both serum levels of IL-4 and IFN-γ could be used as a reliable inflammatory biomarker for the evaluation and follow up of asthmatic patients.

Recommendations The assessment of serum IL-4 and IFN-γ is a good tool for building up the treatment protocol of partly controlled asthmatic children. The study confirms that ICS is still more potent in Th2 suppression than LTA and still has the upper hand in treatment of partly controlled asthma.

[8] [9]

[10]

[11]

[12]

[13]

References [1]

[2] [3]

American Lung Association, Asthma and children fact sheet, available online at: www.lungusa.org.1-800LUNGUSA (accessed Feb. 2010). S.S. Braman, The Global Burden of Asthma, Chest 130 (2006) 4-12. E.D. Bateman, S.S. Hurd, P.J. Barnes, J. Bousquet, J.M. Drazen, M. FitzGerald, et al., Global strategy for asthma management and prevention, available online at:

[14]

[15]

www.ginasthma.org (accessed 2008). EPR ΙΙΙ- Expert Panel Report 3: Prevention Program, NAEPP expert panel report guidelines for the diagnosis and management of asthma–update on selected topics 2002, National Institutes for Health, http://www.nhlbi.nih.gov/guidelines/archives/epr-2_upd/i ndex.htm (accessed Nov.7, 2007). P.J. Barnes, The cytokine network in asthma and chronic obstructive pulmonary disease, J. Clin. Invest. 118 (11) (2008) 3546-3556. G. Monteleone, I. Monteleone, D. Fina, P. Vavassori, G. Del Vecchio Blanco, R. Caruso, Interleukin-21 enhances T-helper cell type I signaling and interferon-gamma production in Crohn’s disease, Gastroenterology, Mar 128 (3) (2005) 687-694. Hollis-Eden, Basic Immunology, available online at: http://www.classes.biology.ucsd.edu/bimm124 (accessed 2010). W. Eder, M.G. Ege, E. von Mutius, The asthma epidemic, N. Engl. J. Med. 355 (2006) 2226-2235. E.D. Bateman, L.P. Boulet, A. Cruz, M. FitzGerald, H. Mark Levy, P. O’Byrne, Global Initiative For Asthma, Pocket Guide for Asthma Management and Prevention, available online at: http://www.ginasthma.org (accessed 2010). A. Krogulska, K. Wasowska-Królikowska, E. Polakowska, S. Chrul, Cytokine profile in children with asthma undergoing food challenges, J. Investig. Allergol. Clin. Immunol. 19 (1) (2009) 43-48. A.S. Abdulamir, R.R. Hafidh, F. Abubakar, K.A. Abbas, Changing survival, memory cell compartment, and T-helper balance of lymphocytes between severe and mild asthma, BMC Immunology 9 (2008) 73. C.M. Robroeks, K.D. Van de Kant, Q. Jöbsis, H.J. Hendriks, R. Van Gent, E.F. Wouters, Exhaled nitric oxide and biomarkers in exhaled breath condensate indicate the presence, severity and control of childhood asthma, Clinical & Experimental Allergy 37 (9) (2007) 1303-1311. H.H. Fu, Y. ShiQing, H. Gao, X. YongJian, Changes of serum IL-4, IL-12, IL-13, IFN-γ and IgE levels and their clinical significance in acute attack of asthma, Journal of Modern Laboratory Medicine 24 (5) (2009) 120-123. N.H. Hacken, Y. Oosterhoff, F. Kauffman, L. Guevarra, T. Satoh, D.J. Tollerud, et al., Elevated serum interferon-γ in atopic asthma correlates with increased airways responsiveness and circadian peak expiratory flow variation, Eur. Respir. J.11 (1998) 312-316. S. Boniface, V. Koscher, E. Mamessier, Assessment of T lymphocyte cytokine production in induced sputum from asthmatic: A flow cytometry study, Clin. Exp. Allergy 33

T-Helper 1 Cell/T-Helper 2 Cell Balance with Anti Inflammatory Therapy in Partly Controlled Asthmatic Children (2003) 1238-1243. [16] H. Lababidi, A. Hijaoui, M. Zarzour, Validation of the Arabic version of the asthma control test, Annals of Thoracic Medicine 3 (2) (2008) 44-47. [17] Z.M. Radwan, G.A. Yamamah, H.H. Shaaban, A.O. Abdel-Rahman, A.A Ismaeil, E.M. Mostafa, Effect of different monotherapies on serum nitric oxide and pulmonary functions in children with mild persistent asthma, Arch. Med. Sci. 6 (6) (2010) 919-925. [18] D.A. Bukstein, A.T. Luskin, A. Bernstein, “Real-world”

1213

effectiveness of daily controller medicine in children with mild persistent asthma, Ann. Allergy Asthma. Immunol. 90 (5) (2003) 543-549. [19] W.W. Busse, R.F. Lemanske, Asthma, New England Journal Med. 344 (2001) 350-362. [20] M.L. Garcia, U. Wahn, L. Gilles, A. Swern, C.A. Tozzi, P. Polos, Montelukast compared with fluticasone for control of asthma among 6 to 14 year old patients with mild asthma: The MOSAIC study, Pediatrics 116 (2005) 360-369.

Journal of Life Sciences 6 (2012) 1214-1219

Response of Hypercholesterolemic Rats to Sesamum indicum Linn Seed Oil Supplemented Diet Olubunmi Bolanle Ajayi, James Braimoh and Karen Olasunkanmi Department of Biochemistry, Faculty of Sciences, Ekiti State University, P.M.B. 5363, Ado-Ekiti, Nigeria Received: May 08, 2012 / Accepted: August 13, 2012 / Published: November 30, 2012. Abstract: Fatty acid composition of Sesamum indicum oil was determined by gas chromatography and the response of hypercholesterolemic rats to diet supplemented with Sesamum indicum seed oil was investigated. Twenty four rats weighing between 120-130 g were randomly assigned into four groups. Group A was fed normal diet, Group B, C and D were fed hypercholesterolemic diet (i.e. 20% fat + 1% cholesterol) for two weeks to establish hypercholesterolemia. Group B were maintained on hyper diet while C and D were fed 5% and 10% benniseed oil supplemented diet for four weeks. Plasma was collected and analyzed for TC (total cholesterol), HDL-C (high density lipoprotein), LDL-C (low density lipoprotein) and TG (triglycerides) levels. Linoleic acid (42.44%) and oleic acid (40.60%) were the major unsaturated fatty acid in the oil. Significant increase (P < 0.05) was observed in the TC, TG, LDL and LDL/HDL ratio of the hypercholesterolemic rats compared to the normal control. Supplementation with Sesamum indicum seed oil at 5% and 10% levels resulted in significant decrease (P < 0.05) in TC, TG, LDL and LDL/HDL ratio, and significant increase in the HDL-C. The high level of unsaturated fatty acid in the oil may in part be responsible for the hypocholesterolemic effect of the oil. Key words: Sesamum indicum, fatty acid composition, hypercholesterolemia, lipid profile.

1. Introduction Dietary fats and cholesterol play a major role in CHD (coronary heart disease) development, mostly by modulating plasma lipoprotein concentrations. Dietary modification remains the cornerstone of CHD prevention. Different types of dietary lipids have been shown to affect lipid metabolism and serum lipid profile differently. Lipoprotein disorder is among the most common metabolic disease occurring in human. It may lead to CHD [1]. Excessive levels of blood cholesterol accelerate atherogenesis and lowering high blood cholesterol reduces the incident of CHD [2]. Knowledge about the levels of cholesterol subfractions is more meaningful than simple plasma cholesterol level. The higher the level of LDL-C, the greater the risk on atherosclerotic heart disease, Corresponding author: Olubunmi Bolanle Ajayi, Ph.D., associate professor, research field: nutritional biochemistry. E-mail: [email protected].

conversely, the higher the level of HDL-C, the lower the risk on coronary heart disease [3]. It is almost accepted that atherosclerosis is a disorder of lipid transport and metabolism cholesterol by-product would form thick, tough deposit called plague on the inner wall of the arteries, stiffening them and then starving the heart of blood, creating choke point where a clot could stop the flow entirely [4]. Apart from the lipid from the diet source, the body in turn manufactures its own cholesterol. Inefficient clearance of excess cholesterol for reasons that are largely genetic [5], resulting in accumulation of cholesterol in the blood and deposition of lipid in the minor layer of arterial wall causes atherosclerosis. Furthermore, the effect of dietary cholesterol on plasma cholesterol levels may be influenced by the type of fatty acid consumed which may be saturated or unsaturated [6]. Sesame seed is the seed of Sesamum indicum Linn family Pedaliacea, believed to be indigenous to

Response of Hypercholesterolemic Rats to Sesamum indicum LINN Seed Oil Supplemented Diet

1215

tropical Africa and cultivated in India, China and Nigeria [7]. Sesame oil is obtained by refining the expressed or extracted oil from the seeds of Sesamum indicum. The oil consists of glycerides of oleic, linoleic, palmitic, stearic and myristic acids and also contains a crystalline substance, sesamine and a phenolic substance sesamol, which gives the red colour with a 1% solution of sucrose in strong hydrochloric acid [8]. Sesame seeds and sesame oil have been evaluated as one of the familiar health foods of ancient time. However, compared with other vegetable oils, sesame oil contains a relatively high percentage of unsaponifiable matter (1%-3%) which includes sterols, sterol esters, mainly α-tocopherol and unique compounds called sesame lignans [9]. The two major oil-soluble lignans, sesamin and sesamolin are considered responsible for the unique properties of sesame seed oil. Sesamin is known to reduce the absorption and biosynthesis of cholesterol in rats and plasma cholesterol in humans [10], sesamin also elevates α-tocopherol levels in humans. The aim of the present study was to determine the fatty acid composition and to examine the effect of supplementation of sesame seed oil on the plasma lipid profile of hypercholesterolemic rats.

of the 14% boron fluoride in methanol was added. The mixture was heated for 5 min at the temperature of 90 °C to achieve complete methylation process. The fatty acid methyl esters were thrice extracted from the mixture with redistilled n-hexane. The content was concentrated to 1 mL for gas chromatography analysis and 1 µL was injected into the injection port for GC.

2. Materials and Methods

respectively they were maintained on these dietary

2.1 Collection of Sample Sesame seeds were purchased from Oja-Oba market in Ado-Ekiti. It was identified and authenticated at the Herbarium Section of Plant Science Department, Ekiti State University, Ado-Ekiti, Nigeria. It was cleaned, washed and sundried. Extraction of oil: Oil was extracted using Soxhlet extractor and n-hexane as the solvent (bpt 40-60 °C). The extracted oil was concentrated in a rotary evaporator. The fatty acid composition of the oil was determined using gas chromatography. 50 mg of the oil sample was saponified for 5 min at 95 °C with 3.4 mL of 0.5 M KOH in dry methanol. The mixture was neutralized using 0.7 M HCl. 3 mL

Fatty acid analysis: This was determined in an HP 6890 model gas chromatography fitted with a flame ionization detector FID. Separation was carried out in a capillary column (30 m × 0.25 mm × 0.25 µm). The starting temperature was 70 °C maintained for 4 min at a heating rate of 10 °C/min. Nitrogen was the carrier gas. The fatty acid peaks were qualified by comparison with internal standards and identified by their retention times and their mass spectra. Experimental procedure: The rats were randomly assigned into four groups (A, B, C and D) comprising of six rats each. Group A served as the normal control while group B, C and D served as the test group. Initially, animals in groups (B, C and D) were fed with 20% fat + 1% cholesterol for two weeks to establish hypercholesterolemia. Thereafter, rats in groups C and D were treated with feed supplemented with 5% and 10% Sesamum indicum seed oil regimen for four weeks while being weighed weekly. 2.2 Preparation of Serum and Tissue Homogenate At the end of the experiment, rats were fasted overnight, anaesthesized and blood samples were collected by cardiac puncture into lithium-heparin bottles. It was centrifuged at 3,000 rpm for 10 min and the plasma was separated and kept until required for analysis. Biochemical analysis: TC, HDL-C, LDL-C, TG were estimated from the plasma. Plasma total cholesterol was estimated using Randox laboratory kit based on the enzymatic end point method. The HDL-Cholesterol was determined by the method of Steins et al. [11]. LDL-Cholesterol was calculated

1216

Response of Hypercholesterolemic Rats to Sesamum indicum LINN Seed Oil Supplemented Diet

with the Friedeweld formula [12]. Statistical analysis: The results are expressed as mean ± S.D. Analysis of variance was used to test for differences in the groups. All the values were expressed as mean ± S.D. Differences were considered to be statistically significant at P < 0.05. The diet composition is shown in Table 1.

3. Results and Discussion Table 2 shows the fatty acid composition of Sesamum indicum seed oil. The percentage oil is 43.5% and this agrees with earlier findings [13] thus suggesting that obtaining commercial quantities of the oil from sesame seed for the needed industrial pharmaceutical purpose for SEOFS (self emulsifying oil formulations) production would be feasible and this may likely compete with synthetic oil which are more expensive. Table 1

Diet composition (g/kg).

A Corn starch 290 Soya meal 510 Sucrose 100 Vit. Mineral mix 50 Soya bean oil 50 Sesamum indicum seed oil Cholesterol Table 2

B 130 510 100 50 200 10

C 290 510 100 50 50 -

D 240 510 100 50 100 -

Fatty acid composition of Sesamun indicum oil.

Fatty acid Palmitic acid (C16:0) Palmitoleic acid(C16:1) Stearic acid (C18:0) Oleic acid (C18:1) Linoleic acid (C18:2) Linolenic acid (C18:3) Arachidonic acid (C20:4) Arachidic acid (C20:0) Behenic acid (22:0) Erucic acid (22:1) Lignoceric acid (24:0) Total fatty acid present Saturated fatty acid Monounsaturated fatty acid Polyunsaturated fatty acid

Composition (%) 10.06 0.04 6.17 40.60 42.44 0.39 0.06 0.09 0.04 0.02 0.09 100.00 16.45 40.66 42.88

The oil contains high levels of unsaturated fatty acid (i.e. oleic 40.60% and linoleic 42.44%). This agrees with previous reports [14]. Hence it can be classified in the oleic-linoleic acid group. Linoleic acid is an important polyunsaturated fatty acid in human food because it helps prevent heart diseases [15]. The high percentage of oil makes the seed a distinct potential for the oil industry for producing drug dispersants in therapeutics. The linoleic acid content in S. indicum oil was higher than T. anguina (20.10%) and S. mahogan (30.1%). Linoleic acid is the precursor of prostaglandins (known to occur in accessory genital gland, seminal plasma and lung tissue of humans and plays a vital role in human health [16]. In a previous work it was shown that S. indicum oil contains β-carotene which is a major precursor of vitamin A and other retinoid like compounds. This suggests that this oil is a good source of vitamin A which is required for the maintenance of healthy skin and good vision, and a robust immune system. β-carotene is also a powerful antioxidant and has been shown to help guard against cancer and heart diseases [13]. Table 3 shows the plasma lipid profile of hypercholesterolemic, those treated with sesame oil of 5% and 10% level and control rats. The observed significant (P < 0.05) increase in TC, TG, LDL and LDL/HDL ratio of rats could be due to the addition of cholesterol in the diet. A diet composed of cholesterol has often been used to raise cholesterol levels in plasma and tissues of experimental animals [17]. These findings agree with previous reports [18]. However, on treatment with S. indicum oil at 5% and 10% levels a significant decrease in plasma TC, TG, LDL and LDL/HDL ratio was observed, this effect observation is also concentration dependent. The possible mechanism of lowering cholesterol level is thought to be by depressing the hepatic activities of lipogenic and cholesterogenic enzymes such as malic enzymes, fatty acid synthase, glucose

Response of Hypercholesterolemic Rats to Sesamum indicum LINN Seed Oil Supplemented Diet

Table 3

1217

Plasma lipid profile of hypercholesterolemic and treated rats.

Control (A) Hypercontrol (B) 5% Sesame oil (C) 10% Sesame oil (D)

TC 2.15 ± 0.2a 3.03 ± 1.5b 2.63 ± 0.16ab 2.00 ± 0.31a

TG 0.57 ± 0.08a 0.97 ± 0.04b 0.79 ± 0.06ab 0.59 ± 0.30a

6-phosphate dehydrogenase [19, 20] and HMGCoA (3-hydroxy-3-methyl glutaryl CoA) reductase [21, 22]. The increase in TG concentration in the hypercholesterolemic rats might be attributed to accelerated lipolysis which may consequently deplete the fatty acid stores. On treatment with sesame seed oil a decrease in TG concentrations was observed. Similarly, Sirato-Yasumoto et al. [23] observed that plasma TG concentration were lower in rats fed with lipid dose of sesame seed oil-rich diet than the low-dose diet compared to hypercholesterolemic rats, they concluded that consumption of sesame (rich in lignans) diet have more profound physiological effects on hepatic fatty acid oxidation and plasma TG levels. Other studies also said that sesamolin a compound found in this oil will strongly inhibit lipid peroxidation in vivo [24]. LDL is a major component of the total cholesterol and is directly related to CHD as a major atherogenic lipoprotein and hence, appears to be the main target of any lipid lowering agents including sesame seed oil as reflected in this study. The significant increase (P < 0.05) in LDL-C in the hypercholesterolemic group may enhance deposition of lipid on arterial walls and hence precipitate lipid related diseases [25]. The HDL-C also reduced significantly in the hypercholesterolemic rats compared to the normal control but on supplementation with S. indicum seed oil a significant (P < 0.05) increase was observed. HDL-C is essential in the transport of cholesterol from cells and arteries to the liver where it is catabolised. It is also considered to have anti-atherogenic properties since there is negative correlation between HDL-C and risk of cardiovascular disease. These findings are due to the fact that Apo

HDL-C 1.30 ± 0.11a 0.73 ± 0.03b 0.87 ± 0.04a 1.06 ± 0.09a

LDL-C 0.59 ± 0.14a 1.86 ± 0.08b 1.41 ± 0.12a 0.84 ± 0.22a

LDL/HDL 0.45 ± 0.01a 2.54 ± 0.07b 1.62 ± 0.14ab 0.78 ± 0.15a

A-1 the major HDL-protein inhibits LDL oxidation [26], other studies show that low HDL-C level with low Apo A-1 will increase LDL oxidation and hence decrease the LDL/HDL ratio [27]. It has been reported that the Sesamum indicum seed oil could lower the level of lipids in plasma as well as in the liver of rodents [28]. HDL-C has preventive role in CHD by reducing endothelial incorporation of lysophosphatidyl choline [29]. The supplemented diet had significantly reduced (P < 0.05) LDL/HDL ratio compared to the hyperchlesterolemic group and a more favourable lipoprotein profile was produced. LDL/HDL ratio is thought to be a stronger index of atherogenicity of lipoproteins rather than the lipid profile of the individual lipoprotein fraction (i.e. the lower the ratio the less atherogenic the lipoprotein profile) [30] Therefore the decrease in the atherogenic index of the sesame oil based diet may suggest that it has beneficial effects on the cardiovascular systems. Similarly, Bhaskaran et al. [31] reported a significant reduction in TC, LDL and TG levels in mice when the atherogenic diet was reformulated with the same concentration of sesame oil used in this study. Also, Hirata et al. [32] reported that daily oral intake of sesamin in hypercholesterolemic patients for four weeks significantly reduced total and LDL-C concentration. The hypoglycemic effect of this oil might be related to the amount of sesamin, L-arginine or unsaturated fatty acids in it. The mechanism of hypocholesterolemic effect of sesamin is believed to be related to the inhibition of intestinal absorption of cholesterol, increasing excretion of cholesterol into bile and decreased activity of HMGCoA reductase

1218

Response of Hypercholesterolemic Rats to Sesamum indicum LINN Seed Oil Supplemented Diet

[33]. Evidence that diet can be effective means to lower blood levels of total and LDL-C [34] reinforces the importance of the current findings with sesame seed oil.

[11]

[12]

4. Conclusion Therefore, it can be concluded that the hypocholesterolemic potentials of S. indicum Linn seed oil may in part be due to the high levels of unsaturated fatty acids in the oil and may therefore be useful for prophylaxis and therapeutic treatment in clinical conditions associated with hyperlipidemia and hypercholesterolemia.

Acknowledgments

[13]

[14]

[15]

[16]

The authors wish to thank Mrs. Olarinde for typing the manuscript.

References G.D. Sloop, A critical analysis of the role of cholesterol in atherogenesis, Atherosclerosis 142 (1999) 265-272. [2] S.M. Grundy, Comparison of monounsaturated fatty acid and carbohydrates for lowering plasma cholesterol N, Eng. J. Med. 314 (1986) 745-748. [3] A.S. Truswell, Diet, plasma lipids—a reappraisal, Am. J. Ciln. Nutrition 48 (1978) 1263-1275. [4] J.L. Goldstein, Y.K. Ho, S.K. Basu, M.S. Brown, Binding site on macrophage that mediates uptake and degradation of actylated low density lipoprotein, producing massive cholesterol deposit, Proc. Natl. Acad. Sci. 76 (1) (1979) 333-337. [5] M.I. Lemonick, East Yourself out, In Time Magazine, July 19, 1999. [6] R. Mcpherson, G.A. Spiller, Effect of dietary fatty acids and cholesterol on cardiovascular disease risk factors in man, in: G.A. Spiller, G.D. Sloop (Eds.), Handbook of Lipids in Human Nutrition, CRC Press, FL, USA, 1999, p. 41. [7] T.E. Wallis, Sesame seed, in: T.E. Wallis (Ed.), Textbook of Pharmacognosy, 5th ed., Nazia Printers, India, 1997, p. 220. [8] C.E. William, Sesame oil, in: Trease and Evans (Eds.), 14th ed., Harcourt Brace and Company Asia PTE Ltd., India, 1996, p. 185. [9] J. Frank, Beyond vitamin E supplementation: An alternative strategy to improve vitamin E status, J. Plant Physiol. 162 (7) (2002) 834-843. PMID: 16008112. [10] A.M. Ali, K. Afaf, Sesame seed is a rich source of dietary

[17]

[1]

[18]

[19]

[20]

[21]

[22]

[23]

[24]

lignans, Journal of the American Oil Chemists’ Society, 83 (8) (2006) 719-723. E.A. Steins, G.L. Meyers, National cholesterol education programme: Recommendations for triglyceride measurements, Clinical Chemistry 41 (1995) 1421-1426. W. Friedewald, R. Levy, D. Fredrickson, Estimation of the concentration of low-density lipoprotein cholesterol in plasma, without use of the preparative ultracentrifuge, Clin. Chem. 18 (1972) 499-502. L. Tashiro, Y. Fukuda, J. Osawa, Oil, minor components of sesame strains, Journal of the American Oil Chemists’ Society 67 (2002) 508-511. O.U. Njoku, J.A. Boniface, N.C. Obitte, D.C. Odimeywu, Some nutriceutical potential of beniseed oil, Int. J. App. Res. Natural Products 24 (2010) 11-19. C. Boelhouwer, Trenos in chemistry and technology of lipids, Journal of the American Oil Chemists’ Society 60 (2) (1983) 457-462. G.M. Ali, S. Yasumoto, M.S. Katsuta, Assessment of genetic diversity in sesame (Sesamum indicum L.) detected by amplified fragment length polymorphism markers, Journal of Biotechnology 10 (2011) 12-23. G. Sener, J. Balkan, U. Cevikbas, M. Keyertlysal, Melatonin reduces cholesterol accumulation and prooxidant state induced by high cholesterol diet in the plasma, liver and aorta of C57134/6J mice, J. Pineal. Res. 36 (2004) 212-216. L.M. Sheyla, P. Heberth, L.P. Maria, C. Rinaldo, Dietary models for inducing hypercholesterolemia in rats, Brazilian Archives of Bio. and Tech. 48 (2005) 203-209. M.S. Chi, E.T. Koh, T.J. Steward, Effects of garlic on lipid metabolism in rats fed cholesterol or lard, J. Nutr. 112 (1982) 241-248. A.A. Qureshi, N. Abuirmeileh, Z.Z. Din, C.E. lson, W.C. Burger, Inhibition of cholesterol and fatty acid biosynthesis in liver enzymes and chicken hepatocytes by polar fractions of garlic, Lipids 1 (1983a) 343-348. A.A. Qureshi, N. Abuirmeileh, Z.Z. Din, Y. Ahmad, C.E. Elson, W.C. Burger, Suppression of avian hepatic lipid metabolism by solvent extracts of garlic: Impact on serum lipids, J. Nutr. 113 (1983b) 1746-1755. A.A. Qureshi, T.D. Crenshaw, N. Abuirmeileh, D.M. Peterson, C.E. Elson, Influence of minor plants constituents on porcine hepatic lipid metabolism: Impact on serum lipids, Atherosclerosis 64 (1987) 109-115. S. Sirato-Yasumoto, M. Katsuta, Y. Okuyama, Y. Takanashi, T. Ide, Effect of sesame seeds rich in sesamin and sesamolin on fatty acid oxidation in rat liver, J. Agri. Fd. Chem. 49 (5) (2001) 2647-2651. M.H. Kang, M. Naito, K. Sakai, K. Ushida, T. Osawa, Mode of action of sesame ligman in protecting low-density lipoprotein against oxidative damage in vitro,

Response of Hypercholesterolemic Rats to Sesamum indicum LINN Seed Oil Supplemented Diet Life Sci. 66 (2008) 161-171. [25] H.C. McGill, S.N. Kole, K. Groupta, T.A.B. Senders, Unresolved problems in the diet-heart issue, Atherosclerosis 1 (1998) 164-176. [26] T. Olita, K. Takala, W. Horiachis, Protective effect of lipoprotein containing apoproteins A-1 on Cu2+ catalyzed oxidation of human low density lipoprotein, FEBS Let. 257 (1989) 435-438. [27] J. Ghosh, T.K. Mishira, Y.N. Rao, S.K. Agbarwal, Oxidized LDL, HDL cholesterol, LDL cholesterol levels in patient of coronary artery disease, Ind. J. Clin. Biochem. 21 (2006) 181-184. [28] S. Satchithanandam, R. Chanderbhan, A.T. Kharroubi, R.J. Clavert, D. Klurfeld, S.A. Tepper, et al., Effect of sesame oil on serum and liver lipid profiles in the rat, Int. J. Vitain. Nut. Res. 66 (1996) 386-392. [29] Y.M. Nasiruddin, N. Ahmed, Effects of an unani formulation on lipid profile in rats, Ind. J. Pharmacol 25 (2006) 56-57.

1219

[30] A.A. Margaret, I.B. Umoh, A.E. Essien, Effect of raw beniseed and beniseed soup diets on some biochemical and haematological parameters of male albino wistar rats, Nig. J. Biochem. Molecular Bio. 23 (2) (2008) 20-24. [31] S. Bhaskaran, N. Santanam, M. Penumetcha, S. Parthasarathy, Inhibition of atherosclerosis in low-density lipoprotein receptor negative mice by sesame oil, J. Med. Food 9 (2006) 487-490. [32] F. Hirata, K. Fujita, Y. Ishikura, K. Hosoda, Hypocholesterolemic effect of sesame lignans in human, Atherosclerosis 122 (2006) 135-136. [33] N. Hirose, T. Inoue, K. Nishihara, M. Sugano, Inhibition of cholesterol absorption and synthesis in rats by sesamin, J. Lipid. Res. 32 (2008) 629-638. [34] L.M. Delahanty, B. Sooner, D. Hayen, D.M. Nathem, Clinical and cost outcomes of medical nutrition therapy for hypercholesterolemia: A controlled trial, J. Am. Diet Assoc. 101 (2002) 1012-1023.

Journal of Life Sciences 6 (2012) 1220-1224

Isolation and Identification of Aspergillus spp. During One Year in the Hospitals İskender Karalti1 and Günay Tülay Çolakoğlu2 1. Nutrition and Dietetics Department, Faculty of Health Sciences, Yeditepe University, İstanbul 34755, Turkey 2. Biology Department, Faculty of Arts and Sciences, Marmara University, İstanbul 34722, Turkey Received: May 22, 2012 / Accepted: May 23, 2012 / Published: November 30, 2012. Abstract: The aim of the present study was monitoring of Aspergillus spp. in six different hospitals in İstanbul. The authors know that disease like aspergillosis illness caused by Aspergillus spp. is very dangerous for people’s health. Therefore, the present work has been performed to evaluate the hospitals’ environment. Petri-plate method has been performed for isolation. Samples were taken at six different hospitals and various locations of each. 13 different Aspergillus species and 141 Aspergillus colonies have been isolated in totally. Maximally isolated species are: Aspergillus niger (29.1%). A. nidulans (21.3%), A. candidus (12.8%), A. ochraceus (9.2%), and A. versicolor (7.8%). A. fumigates, A. flavus are the most pathogen species in human which have been isolated minimally. Key words: Aspergillus, hospital air, Istanbul.

1. Introduction

growth than outdoor, because of higher humidity [8].

Fungi can be found at the atmosphere and can live in different environmental conditions [1]. A large constructions, humidity, temperature, location of hospital affect density of them [2]. They can cause many illnesses such as respiratory tract sickness, allergic reactions, sinusitis, hospital infections time to time [3-5]. At the same time higher density of fungi in clinical environment are risky in terms of immunocompromised patients (HIV carriers, oncology patients and old patients). Especially, aspergillosis caused by certain types of Aspergillus species is seen in chemotherapy patients rather frequently. Therefore, mould flora determination of hospitals air is very important [6]. There are only a few studies about airborne fungi at hospitals of some cities [7]. Temperature, relative humidity and other climatic conditions affect density of fungal colonies. Indoor conditions are more suitable for fungal

2. Materials and Methods

Corresponding author: İskender Karalti, Ph.D., Assist. Prof., research fields: microbiology, moleculer microbiology, mycology. E-mail: [email protected].

The study was done during the period of February 2005 - January 2006. Samples were taken from six hospitals (Table 1) and five different departments (microbiology laboratory, toilets, waiting rooms, hospital gardens and libraries). Isolation in the study has been performed by using Petri-plate method based on gravity. PDA (peptone dextrose agar) was used as the culture medium while collecting the samples. 30 mg/L streptomycin had been added to the culture to prevent bacteria reproduction. Rose-bengal stain was added to the culture in order to prevent faster reproduction of moulds [9]. Plaques containing Peptone Dextrose Agar which was used for isolation were put into 7 days of incubation in laboratories at room temperature (22-26 ºC). Later, every reproduced fungus colony was been put into PDA, SDA (Sabouraud Dextrose Agar) and CZA (Czapek’s Agar) by utilizing passage to the culture mediums. These plaques were

1221

Isolation and Identification of Aspergillus spp. During One Year in the Hospitals

also put into incubation for 7 days at room temperature (22-26 ºC). After the incubation, pure cultures of microfunguses were obtained. Lactophenol solution stained by picric acid and lactophenol solution stained by cotton blue were used for investigation of microscopic structures of moulds. Preparates made of pure cultures were examined at microscope. Various structures of microfunguses were measured for 50 times and averaged. Identification of Aspergillus species was tried to be performed by making use of the genus Aspergillus (Raper and Fennel, 1965) [6].

3. Results 141 Aspergillus colonies have been isolated from six hospitals (Table 1). 13 different species were identified in this study. Maximum isolated species was A. niger (29.1%). This species is generally known contaminant, but it is rarely pathogen. This one was follwed by A. nidulans (21.3%), A. candidus (12.8%), A. ochraceus (9.2%), A. versicolor (7.8%), A. cervinus (6.4%), A. flavus (5.7%), A. fumigatus (2.8%), A. reptans and A. restrictus (1.4%), A. flavipes, A. niveus and A. ustus (0.7%) (Fig. 1, Table 2). The highest isolation was seen in March and the lowest isolation was seen in July and August (Table 3). Table 2

A. niger which was the mostly isolated was found in all months and A. candidus was isolated during the year except July and August. When looking hospital based, the maximum fungal colony was isolated in E; and followed by C, D and F, A, B (Fig. 2). The maximal isolation was found in autumn; the lowest isolation was found in summer for Aspergillus spp. (Fig. 3).

4. Discussion It is known that fungi have ability to grow in the different environmental conditions. Molds thrive in areas of high humidity. In our country, spring and autumn is more convenient for fungal growth [10]. The lowest isolation was done in winter [11, 12]. In our study, the maximum fungal colony was found in summer and spring. The most Aspergillus spp. was seen in March, and followed by September and Table 1 Hospitals which samples were taken and their class. Sample class

Hospital name

A

Education and Research Hospital

B

University Hospital

C

Education and Research Hospital

D

State Hospital

E

Education and Research Hospital

F

Private Hospital

Aspergillus species identified in air from hospitals during the study.

Species name Aspergillus candidus Aspergillus cervinus Aspergillus flavipes Aspergillus flavus Aspergillus fumigatus Aspergillus nidulans Aspergillus niger Aspergillus niveus Aspergillus ochraceus Aspergillus reptans Aspergillus restrictus Aspergillus ustus Aspergillus versicolor Total

A 2 1 1 1 3 3

B 1

C 3

1

2

1 5

5 9

Hospitals D 3 1 2 1 3 8 1

1

F 4

3 13 8

2 5 8

12 1

1 1

1 1 14

E 5 7

9

4 23

1 22

3 51

3 22

Total 18 9 1 8 4 30 41 1 13 2 2 1 11 141

Percentage, % 12.8 6.4 0.7 5.7 2.8 21.3 29.1 0.7 9.2 1.4 1.4 0.7 7.8 100

1222

Fig. 1 Table 3

Isolation and Identification of Aspergillus spp. During One Year in the Hospitals

The distribution of isolated Aspergillus spp.. Distribution of Aspergillus species according to months.

Species name Aspergillus candidus Aspergillus cervinus Aspergillus flavipes Aspergillus flavus Aspergillus fumigatus Aspergillus nidulans Aspergillus niger Aspergillus niveus Aspergillus ochraceus Aspergillus reptans Aspergillus restrictus Aspergillus ustus Aspergillus versicolor Total

1 1

4 2

2 3 1

3 2 1

2 1

2 2 4 1 1 1

5

2

4 3 2 1 1 3 4

5 1 1

3

Months 6 7 1

4

4

8

9 3 2

10 1 1

11 1 1

1

1

1

1

2 1

7 6

5 4

5 4

3

2

7

21

19

12

5

1

12 2

2 2 1 3 12

14

8 24

16

5

5

4

4

Total 18 9 1 8 4 30 41 1 13 2 2 1 11 141

and they reported that the maximum isolation had been done in spring and autumn for Aspergillus spp.. Only one hospital (C) has central air condition system among the hospitals which were taken samples. This hospital is education and research hospital and the biggest hospital of Turkey. C and E hospital are in the same location in İstanbul. However although 51 colonies were found in E, 22 colonies were found in C. Fig. 2

The colony count according to hospitals.

October. The similar results were found in different researches in our country. For example, nine Aspergillus spp. were found by E. Aydoğdu et al. [13]

In published artciles it was indicated that use of central air condition system was influenced by microbial growth [1]. Because these systems have a HEPA (high efficiency particulate air) filter that is barrier for microorganisms and protects patients from airborne

Isolation and Identification of Aspergillus spp. During One Year in the Hospitals

Fig. 3

1223

Fungal colony counts according to seasons.

infection. So, the authors can think that using central

References

air condition system is useful for microbically control

[1]

in hospitals. Aspergillus fumigatus, A. flavus and A. terreus are major opportunist pathogens for immunocompromised patients [14]. A. terreus was not isolated in the present

[2]

study. A. flavus and A. fumigatus were isolated minimally from hospitals, and these results are rejoicing for patients and hospital staff. Aspergillus niger is most commonly reported in lots

[3]

of studies in Turkey and other countries [15]. It is known that contaminant in microbiological cultures

[4]

and rarely is reported as pathogen for human. It is likely responsible for external ear infection when assessed as a pathogen [14]. This species was found in

[5]

all months during the study. As a result, the fungal flora in the hospitals should

[6]

be known. So, air samples can be taken time to time even if routinely and we suggest that we should use central air condition system for microbial control in

[7]

hospitals.

Acknowledgments This study was supported by the Marmara

[8]

University Scientific Research Projects Commission (BAPKO), Project No.: FEN-C-DRP-080410-0090. The authors would like to sincerely thank Marmara University for supporting.

[9]

S. Sarıca, A. Asan, M.T. Oktun, M. Ture, Monitoring ındoor airborne fungi and bacteria in the different areas of Trakya University Hospital, Edirne, Turkey, Indoor Built Environment 11 (2002) 285-292. I. Fournel, M. Sautour, I. Lafon, N. Sixt, C. L’Ollivier, F. Dalle, et al., Airborne Aspergillus contamination during hospital construction works: Efficacy of protective measures, France J. Infect. Control 38 (2010) 189-194. A. Yücel, A.S. Kantarcıoglu, Epidemiology of hospital acquired (nosocomial) fungal ınfections, Cerrahpasa J. Med. 32 (2001) 259-269. J.U. Ponikau, D.A. Sherris, E.B. Kern, H.A. Homburger, E.F. Frigas, T.A. Gaffey, et al., The diagnosis and ıncidence of allergic fungal sinusitis, Mayo. Clin. Proc. 74 (1999) 877-887. G. Çolakoglu, Mould counts in the atmosphere at the Europe Quarter of İstanbul, Turkey, J. Basic Microbiol. 36 (1996) 389-392. G. Çolakoğlu, I. Karaltı, The determination of airborne fungal flora of two different hospitals in İstanbul (Turkey), Advances in Environmental Biology 5 (2011) 3645-3652. M.T. Hedayati, S. Mayahi, R. Aghili, K. Goharimoghadam, Airborne fungi in indoor and outdoor of asthmatic patients home, living in the city of Sari, Iran J. Allergy Asthma Immunol. 4 (4) (2005) 189-191. W. Wang, X. Ma, Y. Ma, L. Mao, F. Wu, X. Ma, et al., Seasonal dynamics of airborne fungi in different caves of the Mogao Grottoes, Dunhuang, China, Int. Biodeter. Biodegr. 64 (2010) 461-466. Ö.S. Sarıca, A. Asan, Y. Tungan, M. Türe, Airborne fungal concentrations in east patch of Edirne City

1224

Isolation and Identification of Aspergillus spp. During One Year in the Hospitals

(Turkey) in autumn using two sampling methods, Trakya Üniv. J. Sci. 6 (1) (2005) 97-106. [10] Z. Çetinkaya, F. Fidan, M. Ünlü, M. Hasenekoglu, L. Tetik, R. Demirel, Afyon atmosferinde alerjen fungus sporlari, Akciger Arsivi 6 (2005) 140-144. [11] G. Çolakoglu, Indoor and outdoor mycoflora in the different districts of the city of Istanbul (Turkey), Indoor and Built Environment 13 (2004) 91-100. [12] A. Asan, B. Sen, S. Sarica, Airborne fungi in urban air of

Edirne City (Turkey), Biologia. 57 (2002) 59-68. [13] H. Aydogdu, A. Asan, Airborne fungi in child day care centers in Edirne City, Turkey, Environmental Monitoring and Assessment 147 (2008) 423-444. [14] G.S. De Hoog, J. Guarro, J. Gene, M.J. Figueras, Atlas of Clinical Fungi, ASM Press, Netherlands, 2001, pp. 1-1000. [15] A. Asan, Aspergillus, Penicillium and related species reported from Turkey, Mycotaxon 89 (1) (2004) 155-157.

Journal of Life Sciences 6 (2012) 1225-1231

Effect of Phenolic Compounds on the Growth and L-Malic Acid Metabolism of Oenococcus oeni Silvia Jane Lombardi1, Patrizio Tremonte1, Mariantonietta Succi1, Bruno Testa1, Gianfranco Pannella1, Luca Tipaldi1, Elena Sorrentino1, 2, Raffaele Coppola1, 2 and Massimo Iorizzo1 1. Department of Agriculture, Food and Environment, University of Molise, Campobasso 86100, Italy 2. Institute of Food and Nutrition National Research Council, Avellino 83100, Italy Received: March 21, 2012 / Accepted: May 30, 2012 / Published: November 30, 2012. Abstract: The effect of some phenolic compounds recurrent in wines on technological features of Oenococcus oeni was studied in order to individuate those strains to be utilized as starter in the deacidification of aged red wines. For this purpose, the growth and the L-malic acid metabolism of 100 O. oeni strains, previously isolated from different wines, was assayed in a synthetic medium added with ethanol, malic acid and phenol carboxylic (gallic, caffeic, p-coumaric and ferulic) acids or flavonoids (catechin and quercetin) at different concentrations. Results evidenced a different sensitivity of strains to each assayed compound. All the compounds restrained or stimulated the growth of 57 and 11 strains respectively, while no effect was detected on 6 strains. The remaining 26 strains showed a different behaviour: all were restrained by ferulic acid and stimulated by gallic acid and catechin. As for caffeic acid, 17 out of 26 strains were restrained, while 9 strains were stimulated. The main result obtained in this study was the establishment of a relationship between the effect of phenolic compounds on the O. oeni growth and the behaviour of the malolactic fermentation. This study may enrich the selection criteria of strains for the deacidification of aged red wines. Key words: Phenol carboxylic acids, flavonoids, lactic acid bacteria, malic acid metabolism.

1. Introduction Red wines contain a large number of phenolic compounds, known for their beneficial biological and physiological properties, such as anti-inflammatory, antiallergenic, anticarcinogenic, antihypertensive, antiarthritic and antimicrobial activities 1, 2. This last activity attracted increasing attention for the possibility to naturally inhibit spoilage microorganisms in wine, and their effect on the microbial growth was related to their constitution and concentration 1, 3, 4. However, it must also take into account the positive role of some bacteria in wine. In fact, several species of LAB (lactic acid bacteria) may carry out MLF (the malolactic fermentation), which, after the alcoholic fermentation, is definitely the most

Corresponding author: Massimo Iorizzo, Ph.D., professor, research field: wine microbiology. E-mail: [email protected].

important biological phenomenon in wine. The chemical reaction consists in the conversion of L-malic acid into L-lactic one and CO2 5. This reaction allows a reduction of wine total acidity, giving to its taste more or less softness. The final effect of the MLF is not simply the deacidification, but an important influence on the aromatic features of wine. In fact bacteria, developing their metabolic functions, are able to produce compounds ex-novo and to transform pre-existent molecules, modifying in a marked way the taste of the product 5-8. This fermentation represents the first important action of both the maturation and ageing processes of the wine and it is particularly appreciated in those areas characterised by mild climate, e.g. where the musts often have an excess of malic acidity and where important Italian red wines (Aglianico, Barolo, Barbera, Nebbiolo and Tintilia), that need stabilization,

1226

Effect of Phenolic Compounds on the Growth and L-Malic Acid Metabolism of Oenococcus oeni

are produced. The most important LAB able to perform MLF is

natural compounds of red wines, such as phenolic

thanks to its many properties, such as low production

compounds, can affect the growth of O. oeni 3, 19-21. However the influence of these compounds on O. oeni remains unclear and it is still debated 1. Therefore, the knowledge of O. oeni response to these compounds could represent a fundamental selection criterion in MLF starter development. For these reasons, the present study was addressed to define the effect of the most common phenol carboxylic acids and flavonoids present in wines on the growth and the L-malic acid metabolism of different O. oeni strains.

of acetic acid, and presence of enzymatic activities

2. Materials and Methods

represented by Oenococcus oeni, capable to grow at low pH values, and high ethanol and sulphur dioxide concentrations. Moreover the -glucosidase activity expressed by strains of O. oeni can interact with phenolic compounds of red wines 9. This enzymatic activity is important for the stability of antocyanic compounds and it is correlated with the formation of aromatic compounds 9-11. Commonly, O. oeni is considered an ideal species of oenological interest,

that increase the aroma and reduce the risk of wine spoilage 12. Nowadays, the use of O. oeni strains as malolactic starter cultures to improve the fermentation process and wine quality is a common winemaking practice 13. However, the induction of MLF by use of commercially available strains is not always successful, because wine is a very harsh environment for bacterial growth 14, 15. The low pH, the low availability of nutrients and the presence of ethanol and sulphur dioxide represent the main obstacles to the growth of lactic acid bacteria and, in particular, of O. oeni 16. O. oeni strains are selected according to the following criteria: resistance to ethanol and SO2, ability to grow at low pH levels, ability to perform MLF, no health hazard for the end consumer and resistance to technological stress (freezing, freeze-drying). All the criteria of guidelines for the selection of commercial malolactic starter, first reviewed by Henick-Kling in 1995 17 and confirmed in a review by Torriani et al. 18, do not consider the possible interaction between the phenolic compounds and the strain of O. oeni used as starter. This lack is due to the poor scientific knowledge regarding the correlation between the presence of phenolic compounds in wine and the behaviour (growth and metabolic activity) of O. oeni strains. In fact, certain

2.1 Microorganisms and Growth Conditions One hundred strains of Oenococcus oeni, previously isolated from different Italian wines and belonging to the Di.A.A.A. cultures collection (University of Molise), were used in this study. Strains were cultivated in MLO 22 at pH 4.8. After over-night incubation at 28 °C under anaerobic conditions (Anaerogen, Oxoid, Milan, Italy), each strain was inoculated into the same medium (OD600nm 0.2) added of each phenolic compound as follows: phenolic acids (caffeic, ferulic, p-coumaric, and gallic acids) and catechin at 50, 100 and 500 mg/L; quercetin at 10, 50 and 100 mg/L. Concentrations were chosen taking into account their natural content in red wines, as well as previous works in this field 3, 23. Solutions, all purchased from Sigma-Aldrich (Steinheim, Germany), were prepared by adding 10 g/L of each compound in 60% (v/v) ethanol and then added to MLO in different concentrations as previously reported. Before inoculation, media were added of malic acid (5 g/L) and adjusted to a final ethanol content of 6% (v/v), as reported by other authors 3. Each individual assay was made in triplicate. 2.2 Evaluation of Bacterial Growth The

microbial

growth

was

assessed

by

Effect of Phenolic Compounds on the Growth and L-Malic Acid Metabolism of Oenococcus oeni

spectrophotometric analysis. In all cases, the inoculum was adjusted to obtain an initial OD600nm value of 0.2. Cultures were incubated at 20 °C and the absorbance at λ = 600 nm was read at time 0 and after 2, 4, 6, 8, 10, 12 and 14 days of incubation in the same conditions, using a CECIL 2501 2000 series spectrophotometer (Cecil Instruments, Cambridge, UK). Results were expressed as the mean and S.D. of three repetitions.

1227

assayed compounds, except for catechin at 50 and 100 mg/L and quercetin at 10 and 50 mg/L; these concentrations did not affect the growth of O. oeni strains from Group B (Neutralism). Eleven strains from group C were stimulated by the presence of both phenolic acids and flavonoids, with a hyperstimulatory effect registered in presence of gallic acid. So, strains from groups A, B and C were respectively not affected, delayed/not affected, and stimulated/hyperstimulated by phenolyc compounds.

2.3 Assessment of L-Malic Acid Utilization

Different behaviours were evidenced for groups D and

L-malic acid was directly determined on the medium prepared with the addition of each amount of phenolic compounds and inoculated with each strain as reported before. For this purpose, the enzymatic kit from Boehringer (Mannheim, Germany) was used following the procedure recommended by the producer. In detail, each strain was incubated at 20 °C for 14 days in the growth medium added of each substance. Analyses were carried out at time 0 and after 2, 4, 6, 8, 10, 12 and 14 days of incubation.

E, whose strains showed different responses to

3. Results and Discussion

ferulic acid; gallic acid produced a hyperstimulation,

phenolic compounds. In detail, the growth of 17 strains from group D was restrained by caffeic acid, strongly restrained by ferulic acid, and stimulated by gallic acid and catechin used at 100 and 500 mg/L. No effect (neutralism) was evidenced in presence of p-coumaric acid, of quercetin, and of catechin at 50 mg/L. A different response to phenolic compounds was also showed by the 9 strains from group E. In this case, the growth of the strains was restrained only by while catechin and quercetin at high and low

3.1 Effect of Phenolic Compounds on the Growth of O. oeni

concentration, respectively, and caffeic acid had a

Data obtained evidenced a different response of O. oeni strains in the presence of phenolic compounds used in this study. On these bases, assayed strains were divided into six groups (Table 1). Group A, consisting of 6 strains, was not restrained nor stimulated by phenolic compounds. Group B, composed of 57 strains, was restrained by all the

registered with catechin and quercetin, at low and high

Table 1

stimulatory activity. No effect (neutralism) was concentration, respectively, and by p-coumaric acid. Data obtained in this study confirm only in part the results showed by others authors. For instance, Campos et al. 23 established that phenolic acids, used at concentration of 100 mg/L, gave no noticeable effect on the growth of O. oeni, while an inhibitory

Response of O. oeni strains to the presence of the phenolic compounds tested.

Microorganisms Group A (6 strains) Group B (57 strains) Group C (11 strains) Group D (17 strains) Group E (9 strains)

Caffeic acid (mg/L) 50 100 500 N N N - + + + - + + +

Ferulic acid (mg/L) 50 100 500 N N N - + + + -- --- -

p-coumaric acid (mg/L) 50 100 500 N N N - + + + N N N N N N

Gallic acid (mg/L) 50 100 500 N N N ++ ++ ++ + + + ++ ++ ++

50 N N + N N

Catechin (mg/L) 100 500 N N N + + + + + +

N: neutralism; -: restraining effect; --: strong restraining effect; +: moderate stimulation; ++: hyperstimulation.

Quercetin (mg/L) 10 50 100 N N N N N + + + N N N + N N

1228

Effect of Phenolic Compounds on the Growth and L-Malic Acid Metabolism of Oenococcus oeni

action was detected only when the phenolic compounds were used at concentration of 500 mg/L. A negative effect of some phenolic compounds (ferulic acid, gallic acid and catechin) on O. oeni development was also reported by Garcia-Ruiz et al. 20. Other authors 3, 24-26 evidenced that gallic acid and catechin, in concentration found in wine, stimulate the growth of O. oeni. A study performed by Cuhsbie et al. 27 showed that quercetin exerted a strong inhibitory dose-dependent effect on the growth of O. oeni. Figueiredo et al. 15, studying the effect of phenolic aldehydes and flavonoids on the growth of O. oeni VF, established that phenolic compounds essentially exhibit microbial inhibitory properties, which may influence the malolactic fermentation. Moreover, these data suggest that the response of O. oeni to phenolic compounds is probably strictly strain-dependent. Since strains from groups D and E resulted differently influenced by phenolic acids, as described above (Table 1), their behaviour in presence of those ones which positively or negatively

influenced the growth was investigated for 14 days. Fig. 1 shows the effect of caffeic, ferulic and gallic acids on the growth of O. oeni strains from group D. The inhibitory effect expressed by caffeic and ferulic acids caused a decrease in the highest growth rate, when compared to the control, already after 4 days of incubation. Moreover, the behaviours reported in Figs. 1a and 1b, evidenced that the restraining effect expressed by ferulic acid was higher than that produced by caffeic acid. This last datum was also found by Reguant et al. 3. Fig. 1c shows that gallic acid seemed to stimulate the growth of O. oeni from the group C independently from the concentration, with a higher growth rate in comparison with the control. A stimulatory effect expressed by gallic acid on the growth of some Lactobacillus species was also described by other authors 3, 20, 23, 28. In Fig. 2, the behaviours of 11 strains from group E in presence of different concentrations of caffeic, ferulic and gallic acids are reported, i.e. those acids which stimulated, restrained, or hyperstimulated,

Fig. 1 Growth of Oenococcus oeni strains (group D) in MLO media supplemented with: (a) caffeic acid, (b) ferulic acid, and (c) gallic acid.

Fig. 2 Growth of Oenococcus oeni strains (group E) in MLO media supplemented with: (a) caffeic acid, (b) ferulic acid, and (c) gallic acid.

Effect of Phenolic Compounds on the Growth and L-Malic Acid Metabolism of Oenococcus oeni

respectively, the growth. In detail, the effect of caffeic (Fig. 2a) and ferulic (Fig. 2b) acids was similar independently from the concentration, and it was evidenced starting from the 8th or the 4th day of incubation, respectively. When the strains from group E were cultivated in presence of gallic acid (Fig. 2c) a strong stimulatory effect was observed already after the 4th day of incubation. This last datum confirms the results reported by other authors 3, 26, which highlighted a stimulatory effect produced by gallic acid on O. oeni strains. 3.2 L-Malic Acid Utilization L-malic acid decarboxylation in presence of phenolic acids and flavonoid compounds was evaluated for a period of 14 days. Substantial differences in comparison with the control were appreciated already after 8 d, as reported in Table 2. In detail, the effect of stimulus, hyperstimulus, neutralism or delay differently influenced the MLF. In

1229

fact, strains from group A, whose growth was not influenced by both phenolic acids and flavonoids, showed values of L-malic similar to those of the control (about 2.4 mg/L), indicating a comparable L-malic decarboxylation in presence and in absence of phenolic compounds. When the phenolic compounds produced a restraining effect on the growth of O. oeni strains (group B), a strong decrease in the L-malic acid decarboxylation rate was observed (Table 2), as indicated by the amount of L-malic of about 4.8-4.9 mg/L, i.e. very similar to that initially added to the medium (5 mg/L). The MLF expressed by strains from group C was stimulated by all the assayed phenolic compounds, but the more interesting result on the MLF was given by gallic acid, the sole one which gave hyperstimulation. In fact, the effect of hyperstimulus caused a strong consumption of malic acid, whose amount diminished at values of 0.82-0.95 mg/L. This last datum resulted in contrast with that of Alberto et al. 25, that assigned

Table 2 Acid malic concentration after 8 days of incubation at 20 °C in MLO inoculated with Oenococcus oeni strains in absence or in the presence of phenolic compounds at different concentrations. Initial concentrations acid malic: 5 mg/L. Conditions

Concentrations (mg/L)

Group B (57 strains) 2.41 (± 0.14) 4.85 (± 0.13) 4.87 (± 0.15) 4.91 (± 0.09) 4.95 (± 0.05) 4.96 (± 0.03) 4.99 (± 0.01) 4.99 (± 0.01) 4.91 (± 0.06) 4.92 (± 0.07)

50

2.46 (± 0.17)

4.98 (± 0.01) 0.95 (± 0.18)

1.24 (± 0.14)

0.99 (± 0.06)

100

2.48 (± 0.18)

4.97 (± 0.01) 0.82 (± 0.19)

1.25 (± 0.21)

0.86 (± 0.12)

500

2.48 (± 0.19)

4.99 (± 0.01) 0.84 (± 0.10)

1.22 (± 0.16)

0.85 (± 0.14)

50

2.44 (± 0.21)

2.41 (± 0.11) 1.13 (± 0.13)

2.39 (± 0.10)

2.41 (± 0.10)

100

2.45 (± 0.13)

2.42 (± 0.14) 1.11 (± 0.16)

1.43 (± 0.10)

1.29 (± 0.13)

500

2.45 (± 0.17)

2.39 (± 0.15) 1.15 (± 0.14)

1.45 (± 0.09)

1.21 (± 0.07)

5

2.42 (± 0.12)

2.51 (± 0.10) 1.23 (± 0.23)

2.40 (± 0.14)

1.19 (± 0.11)

10

2.42 (± 0.14)

2.43 (± 0.15) 1.18 (± 0.21)

2.45 (± 0.16)

2.39 (± 0.14)

100

2.44 (± 0.13)

2.41 (± 0.06) 1.17 (± 0.17)

2.43 (± 0.12)

2.42 (± 0.19)

Control

(without phenolic compounds) 50 Caffeic acid 100 500 50 Ferulic acid 100 500 50 p-coumaric acid 100 500 Gallic acid

Catechin

Quercetin

Microorganisms Group C Group D (11 strains) (17 strains) 2.43 (± 0.15) 2.46 (± 0.13) 1.24 (± 0.09) 4.8 (± 0.11) 1.16 (± 0.15) 4.86 (± 0.17) 1.13 (± 0.08) 4.84 (± 0.15) 1.15 (± 0.09) 4.91 (± 0.09) 1.12 (± 0.07) 4.92 (± 0.04) 1.09 (± 0.09) 4.94 (± 0.03) 1.21 (± 0.12) 2.48 (± 0.15) 1.11 (± 0.13) 2.50 (± 0.17) 1.14 (± 0.24) 2.52 (± 0.19)

Group A (6 strains) 2.44 (± 0.11) 2.45 (± 0.15) 2.48 (± 0.18) 2.51 (± 0.15) 2.44 (± 0.11) 2.47 (± 0.18) 2.48 (± 0.19) 2.43 (± 0.21) 2.45 (± 0.10) 2.47 (± 0.21)

Group E (9 strains) 2.46 (± 0.10) 1.11 (± 0.13) 1.11 (± 0.22) 1.09 (± 0.17) 4.90 (± 0.06) 4.91 (± 0.07) 4.81 (± 0.09) 2.41 (± 0.14) 2.44 (± 0.08) 2.43 (± 0.09)

1230

Effect of Phenolic Compounds on the Growth and L-Malic Acid Metabolism of Oenococcus oeni

no effect to gallic acid on the malic acid utilization. On the other hand, the authors’ results confirm that gallic acid not only stimulate the growth of certain strains of O. oeni, but also increase their ability to use malic acid, as also suggested by other authors 20. A strong relation between the effect of assayed phenolic compounds on the growth of O. oeni strains and the MLF was also observed for groups D and E. In detail, the malic acid decreased at values of about 2.4-2.5 mg/L, i.e. very similar to those of the controls, when compounds did not affect the growth of O. oeni; a restraining effect resulted in a very low consumption of malic acid (values of about 4.8-4.9 mg/L), while a stimulating effect resulted in a high consumption of malic acid (values of about 1 mg/L). As already evidenced for group C, also in this case the hyperstimulatory effect registered in presence of gallic acid on strains belonging to group E resulted in the highest consumption of malic acid (values lower than 1 mg/L).

4. Conclusions This work could enrich the scientific literature on the influence of phenolic compounds on the growth of O.

oeni

strains

involved

in

the

biological

deacidification of aged red wines. Moreover, the influence of these compounds on activities of technological

interest,

such

as

L-malic

decarboxylation, was highlighted. In fact, the most important scientific enrichment produced by this study is ascribable to those results which ascertained a relation between the effect of phenolic compounds on the growth of O. oeni strains and their L-malic decarboxylation. Furthermore the results clearly showed that the response of O. oeni strains to phenolic compounds is strictly strain-dependent. This last datum remarks the importance to study the response to phenolic compounds of useful O. oeni strains to be used in the formulation of starters for the biological deacidification of red wine. Therefore, the present study can improve and the selection criteria for the

development of malo-lactic starters.

Acknowledgments The research, conducted within the project “Pilot study for the rationalization of the winemaking process for the production of wines made from grapes Tintilia, was financially supported by the Regional Agency for Innovation and Development of Agriculture in Molise (ARSIAM)” of Molise Region.

References [1]

M.J. Rodrìguez-Vaquero, M.R. Alberto, M.C. Manca de Nadra, Antibacterial effect of phenolic compounds from different wines, Food Control 18 (2007) 93-101. [2] G. Chunsriimyatav, V. Pavel, K. Vlastimil, H. Ignas, Review on comparative analyses of different phenolic acids content in different beers, J. Life Sci. 4 (2010) 58-62. [3] C. Reguant, A. Bordons, L. Arola, N. Rozès, Influence of phenolic compounds on the physiology of Oenococcus oeni from wine, J. Appl. Microbiol. 88 (2000) 1065-1071. [4] M.R. Alberto, M.E. Farías, M.C. Manca de Nadra, Effect of wine phenolic compounds on Lactobacillus hilgardii 5w viability, J. Food Prot. 65 (2002) 148-150. [5] S. Maicas, I. Pardo, S. Ferrer, Continuous malolactic fermentation in red wine using free Oenococcus oeni, World Journal Microbiol Biotechnol 15 (1999) 737-739. [6] R.E. Kunkee, Some roles of malic acid in the malolactic fermentation in wine making, FEMS Microbiol Biotechnol 56 (1991) 35-39. [7] S.Q. Liu, Malolactic fermentation in wine-beyond deacidification, J. Appl. Microbiol. 92 (2002)589-601. [8] M.A. Pozo-Bayòn, E.G. Algegrià, M.C. Polo, C. Tenorio, P.J. Martìn-Avarez, M.T. Calvo De La Banda, et al., Wine volatile and amino acid composition after malolactic fermentation: Effect of Oenococcus oeni and Lactobacillus plantarum starter cultures, J. Agric. Food Chem. 53 (2005) 8729-8735. [9] I. Rosi, M. Vinella, P. Domizio, Characterization of β-glucosidase activity in yeasts of oenological origin, J. Appl. Bacteriol. 77 (1994) 519-527. [10] Y.Z. Guanata, C.L. Bayonove, C. Tapiro, R.E. Cordonnier, Hydrolysis of grape monoterpenyl β-D-glucosides by various β-glucosidases, J. Agr. Food Chem. 38 (1990) 1232-1236. [11] I. Rosi, P. Domizio, S. Ferrari, S. Zini, M. Picchi, Influence of different malo-lactic bacteria starter on wine quality, in: The Management of Malolactic Fermentation of Wine, A Symposium (Lallemand Italia, ed.),

Effect of Phenolic Compounds on the Growth and L-Malic Acid Metabolism of Oenococcus oeni Paragraphic, Toulouse, France, 1998, pp. 37-42. [12] D. Ribéreau-Gayon, D. Dubourdieu, B. Donèche, A. Lonvaud-Funel, Handbook of Enology: The Microbiology of Wine and Vinifications, 2nd ed., Wiley and Sons, Chichester, 2006. [13] P. Ruiz, P.M. Izquierdo, S. Sesena, M.L. Palop, Selection of autochthonous Oenococcus oeni strains according to their oenological properties and vinification results, Int. J. Food Microbiol. 137 (2010) 230-235. [14] F. Coucheney, N. Desroche, M. Bou, R. Tour-Maréchal, L. Dulau, J. Guzzo, A new approach for selection of Oenococcus oeni strains in order to produce malolactic starter, Int. J. Food Microbiol. 105 (2005) 463-470. [15] A.R. Figueiredo, F. Campos, V. de Freitas, T. Hogg, J.A. Couto, Effect of phenolic aldehydes and flavonoids on growth and inactivation of Oenococcus oeni and Lactobacillus hilgardii, Food Microbiol. 25 (2008) 105-112. [16] L. Solieri, F. Genova, M. De Paola, P. Giudici, Characterization and technological properties of Oenococcus oeni strains from wine spontaneous malolactic fermentations: A framework for selection of new starter cultures, J. App. Microbiol. 108 (2010) 285-298. [17] T. Henick-Kling, Control of malolactic fermentation in wine: Energetic, flavour modification and methods of starter culture preparation, J. Appl. Bacteriol. Symp. 79 (Suppl.) (1995) 29S-37S. [18] S. Torriani, G.E. Felis, F. Fracchetti, Selection criteria and tools for malolactic starters development: An update, Ann. Microbiol. 61 (2011) 33-39. [19] C. Papadopoulu, K. Soulti, I.G. Roussis, Potential antimicrobial activity of red and white wine phenolic extracts against strains of Staphylococcus aureus,

[20]

[21]

[22]

[23]

[24]

[25]

[26]

[27]

[28]

1231

Escherichia coli and Candida albicans, Food Technol. Biotechnol. 43 (2005) 41-46. A. García-Ruiz, B. Bartolomé, A.J. Martínez-Rodríguez, E. Pueyo P.J. Martín-Álvarez, M.V. Moreno-Arribas, Potential of phenolic compounds for controlling lactic acid bacteria growth in wine, Food Control 19 (2008) 835-841. V. Cheynier, P.L. Teissedre, Polyphenols in Oenology, Scientific and Technological Basis, Technique et Documentation, Paris, 1998, pp. 323-324. G. Caspritz, F. Radler, Malolactic enzyme of Lactobacillus plantarum, J. Biol. Chem. 258 (1983) 4907-4910. F.M. Campos, J.A. Couto, T.A. Hogg, Influence of phenolic acids on growth and inactivation of Oenococcus oeni and Lactobacillus hilgardii, J. Appl. Microbio. 94 (2003) 167-174. N. Vivas, A. Lonvaud-Funel, Y. Glories, Effect of phenolic acids and anthocyanins on growth, viability and malolactic activity of a lactic acid bacterium, Food Microbiol 14 (1997) 291-300. M.R. Alberto, M.E. Farías, M.C. Manca de Nadra, Effect of gallic acid and catechin on Lactobacillus hilgardii 5w growth and metabolism of organic compounds, J. Agr. Food Chem. 49 (2001) 4359-4363. M.R. Alberto, C. Gòmez-Cordovés, M.C. Manca de Nadra, Metabolism of gallic acid and catequin by Lactobacillus hilgardii from wine, J. Agr. Food Chem. 52 (2004) 6465-6469. T.P. Cuhsnie, A.J. Lambert, Antimicrobial activity of flavonoids, Int. J. Antimicrob. Agents 26 (2005) 343-356. D. Stead, The effect of hydroxycinnamic acids on the growth of wine-spoilage lactic acid bacteria, J. Appl. Bacteriol. 75 (1993) 135-141.

Journal of Life Sciences 6 (2012) 1232-1236

Techniques Optimization of Combined Enzymatic Hydrolysis on Brewers’ Spent Grain from Novozymes Zhaoxia Li1, Jinlong Yan2, Dan Shen2 and Cheng Ding2 1. School of Chemical and Biological Engineering, Yancheng Institute of Technology, Yancheng 224051, China 2. School of Environmental Science and Engineering, Yancheng Institute of Technology, Yancheng 224051, China

Received: August 23, 2012 / Accepted: October 09, 2012 / Published: November 30, 2012. Abstract: Purpose: To extract protein, decrease the cellulose and facilitate the digestion and absorption of brewers’ spent grain by animal. Topic: Discuss and optimize the hydrolysis conditions of the combined enzymatic hydrolysis by Novozymes. Method: The fresh brewers’ spent grain was firstly dried, smashed and sifted. Then as indicators of the protein extraction rate in the enzyme solution and the content of cellulose in the index, the parameters of enzymatic hydrolysis, such as the solid-liquid ratio, reaction temperature, pH, enzyme dosage and reaction time, were investigated in detailed. After hydrolysis, the brewers’ spent grain was put in the boiling water bath for inactivation for 15 minutes, and centrifuged, the supernatants were volume to 100 mL and the protein content was measured. After the precipitate was dried, the cellulose content was also measured. Achievements: The optimized conditions were with temperature of 50 °C, pH 6.5, enzyme amount of 30 mg for Novozymes enzyme and 2.5 h for reaction time. Under these conditions, the protein extraction rate in the enzyme reaction reached 41.82%, and the cellulose content reached 13.90%, the degradation rate of cellulose was 18.86%. Key words: Brewer’s grain, Novozymes, combined enzymatic hydrolysis, protein, crude fiber.

1. Introduction With the industrial level in recent years and economic and social development, environmental protection and pollution control has become a concern of mankind. Almost all countries adapt to this reality by modifying industrial activities in order to recover residual residue is no longer regarded as waste, but as raw materials. Brewer’s grains (brewers’ spent grain, BSG) is the main residue of barley malt production in the beer brewing industry [1], whose main ingredient is protein, fiber components, and other nutrients, so beer bad comprehensive utilization has been subject to the attention of domestic and foreign research workers [2-4], which has long been used as livestock feed. The BSG is characterized by high-energy value [5], with the expansion of the scale of the beer industry, 

Corresponding author: Zhaoxia Li, M.Sc., professor, research fields: microbiology and biochemical engineering. E-mail: [email protected].

brewer’s grains production is also rapidly increase. Brewer’s grains contain a large number of useful elements on the human body, such as non-starch polysaccharides, gluten, gliadin, and it is a good protein and dietary fiber source. Until now, BSG is the main application, including poultry, pigs and fish, and animal feed because it can provide all the essential amino acids and proteins, and find a better growth performance in 30% of the diet fed fish [6, 7]. Brewer’s grains in the high fiber content, NDF (neutral detergent fiber) content of up to 50% or more, including cellulose, hemicelluloses and lignin, among them form a tight structure and makes it difficult to be degraded and used, and greatly reduced the potential value of brewer’s grains. Therefore, pretreatment is necessary on the brewer’s grains and reduce the brewer’s grains fiber content. The cell wall polysaccharides can be degraded into their corresponding constituents by hydrolytic

Techniques Optimization of Combined Enzymatic Hydrolysis on Brewers’ Spent Grain from Novozymes

procedures (hydrothermal, enzymatic or acidic). Enzymatic hydrolysis is often used to hydrolyse polysaccharides in lignocellulosic materials, but the results vary with the type of preparation employed. Up to 47% of the polysaccharides in untreated BSG can be hydrolysed [8, 9] using a commercial enzyme preparation, and pre-treatment of BSG with NaOH or H2SO4 before enzymatic hydrolysis doubled the release of soluble sugars. Moreover, a combination of extrusion cooking and enzymatic hydrolysis is a very promising procedure for recovery of soluble carbohydrates from BSG [10, 11]. In general, liquefaction of BSG with a multi-enzyme carbohydrate-degrading mixture, such as Ultraflo, resulted in a solubilization of approximately 30% of the biomass within 3 h. Further researches on the features of BSG structure which restrict enzymatic hydrolysis need to be identified and overcome to allow better utilization of BSG. In the present work, the enzymatic hydrolysis of BSG by combined Novozymes enzymes was investigated; the protein extraction rate and the content of cellulose under different hydrolysis conditions were also discussed in detail. The aim of this work was to find the optimum technical conditions of the enzymatic hydrolysis for the added-value production using BSG as raw materials.

2. Materials and Methods 2.1 Materials BSG was provided friendly by Yancheng Limited Liability Company of Chongqing Beer Group, and the combined enzymes were obtained commercially from Tianjin Branch of Novozymes, Denmark. The main chemical compositions of BSG were shown in Table 1. 2.2 Pretreatment of BSG Dried the fresh BSG at 105 °C by oven till constant weight, and cooled. After smashing the BSG by a high speed crusher and sieving to pass through 60 meshes, the BSG was stored at 4 °C and utilized for

1233

subsequent experiments. 2.3 Enzymatic Hydrolysis 2.0 g BSG was firstly added to 20 mL disodium phosphate-citric acid buffer solution (pH 6.5), then 30 mg of combined enzymes was added. The mixtures were incubated at 50 °C for 3 h by a water-bath, and then inactivated for 15 min in boiling water bath. After cooling, the suspension was centrifuged at 4,000 rpm, the supernatant was collected and volume to 100 mL. The concentration of protein in the supernatant was determined by Kjeldahl method. The pellet after the centrifugation was dried and the content of cellulose was also determined. To test the conditions on the enzymatic hydrolysis efficiency, the ratio of solid to liquid was changed as 1:5, 1:10, 1:15 and 1:25, the temperature was elevated from 30 °C to 70 °C at pH values 5.4, 6.0, 6.8 and 7.0. The amount of added enzyme was also changed as 10, 15, 20 and 25 mg, and the extraction time was also varied from 1 to 5 h. All the experiments were conducted in quintuplicate. Excel 2003 and Origin 7.0 analysis software for windows were used for statistical tests.

3. Results and Discussion 3.1 Effect of the Ratio of Solid to Liquid on Enzymatic Hydrolysis Efficiency The concentration of protein in the solution was firstly increased and the content of cellulose was also decreased significantly with the increase of the ratio of solid to liquid (Fig. 1a). BSG was not well dispersed due to the high viscosity and bad mobility in the low ratio. As shown in Fig. 1a, the enzymatic reaction was also influenced by the concentration of enzyme, which decreased with the elevated ratio, and the optimum condition was found to be 1:20. Table 1 Compostions of brewers’ spent grain investigated (%, n = 3). Compositions Percent (%)

Ash Protein Cellulose H2O Ca P 25.49 17.13 78.47 0.16 0.47 4.40

1234

Techniques Optimization of Combined Enzymatic Hydrolysis on Brewers’ Spent Grain from Novozymes

3.2 Effect of the Temperature on Enzymatic Hydrolysis Efficiency Fig. 1b shows that the combined enzyme enzymes had an optimal activity at 60 °C. As temperature increased from 30 to 60 °C, the concentration of protein in the solution was increased to 34.58%, and the lowest concentration of cellulose was found to be 13.97% at 50 °C. As temperature increased from 60 °C to 70 °C, the activity of enzyme was decreased due to the tertiary structure and conformation changes result from the higher temperature.

leading to the deactivation enzymes. The effect of pH value on enzymatic hydrolysis efficiency was shown in Fig. 2a. Results show that the extraction rates of protein and cellulose were 32.68% and 13.43% at the optimum pH 6.5, respectively. 3.4 Effect of the Amount of Added Enzyme on Enzymatic Hydrolysis Efficiency With the increasing of added amount of enzyme, the hydrolysis effect and the yield of protein can be improved. But, enzyme molecule will be saturated by the substrate when the amount ratio of enzyme

3.3 Effect of the pH Value on Enzymatic Hydrolysis Efficiency

substrate improved to certain value, and little help to

The chemical conformation and active central of enzymes are influenced by pH values. Instead, excessive extreme pH will damage enzyme structure,

shows the effect of the amount of added enzyme on

improve the extraction efficiency at this point. Fig. 2b enzymatic hydrolysis efficiency. Best extraction efficiency were achieved at 25 mg of enzyme, and no

Fig. 1

Effect of solid-liquid ratio (a) and temperature (b) on the extraction of protein and cellulose.

Fig. 2

Effect of pH (a) and the amount of added enzyme (b) on the extraction of protein and cellulose.

Techniques Optimization of Combined Enzymatic Hydrolysis on Brewers’ Spent Grain from Novozymes

further improvement was found in more added amount of enzyme (Fig. 2b) 3.5 Effect of the Extraction Time on Enzymatic Hydrolysis Efficiency As shown in Fig. 3, the enzymatic hydrolysis efficiency was increased with the increasing of extraction time in less than 3 h. The maximum extraction rate of protein was 36.88% and the minimum extraction rate of cellulose was 13.41%.

3.6 Results Experiment

and

1235

Analysis

of

the

Orthogonal

To optimum the techniques, a L9 (34) orthogonal experiment was also conducted to investigated the appreciated conditions for further application. Results were shown in Table 2. The importance of factors affected the protein extraction rate were as the following: temperature > pH > extraction time > the amount of enzyme added, and for the extraction of cellulose were pH > the amount of enzyme > added extraction time > temperature. The extraction of protein was more affected by such factors than the cellulose extraction, so the extraction rate of protein was more appreciated for the indicator of enzyme hydrolysis efficiency. Optimum hydrolysis conditions were found to be A2B2C2D1, that were pH 6.5, 50 °C, 2.5 h of extraction time and 30 mg of enzyme added. Additional

Fig. 3 Effect of the amount of extraction time on the extraction efficiency of protein and cellulose. Table 2

experiments shown that the extraction rate achieved 41.82%, higher than all the values listed in Table 2.

Results and analysis of the orthogonal experiment.

No.

A Temperature/°C

B pH

C Amount of added enzyme/mg

1 2

40 40

6.0 6.5

20 25

3

40

7.0

4

50

5

50

6 7

D Time/h

Protein/%

Cellulose/%

2.5 3.0

27.03 27.34

16.60 15.89

30

3.5

21.85

16.05

6.0

25

3.5

32.13

15.64

6.5

30

2.5

37.23

14.60

50

7.0

20

3.0

29.31

14.33

60

6.0

30

3.0

27.58

14.67

8

60

6.5

20

3.5

27.74

15.52

9

60

7.0

25

2.5

28.56

15.81

Protein/%

Cellulose/%

k1

25.41

28.91

28.03

30.94

k2

32.89

30.77

29.34

28.08

k3

27.96

26.57

28.89

27.24

R k1

7.48 16.18

4.20 15.64

1.31 15.48

3.70 15.67

k2

14.86

15.34

15.78

14.96

k3

15.33

15.40

15.11

15.74

R

1.32

0.3

0.67

0.78

Techniques Optimization of Combined Enzymatic Hydrolysis on Brewers’ Spent Grain from Novozymes

1236

4. Conclusions Enzymatic hydrolysis efficiency was affected by lots of factors, such as solid-liquid ratio, reaction temperature, pH, enzyme dosage and reaction time. Under optimum hydrolysis conditions of pH 6.5, 50 °C, 2.5 h of extraction time and 30 mg of enzyme added, the extraction rate of protein achieved 41.82%.

Acknowledgments This work was financially supported by Qinglan Program of Science and Technology Innovation Team of Jiangsu Province (2010) and Special Operation Plan of Science & Technology Enriching Civilization and Enhancing the County (BN2010077).

References [1]

[2]

[3]

S.I. Mussatto, G. Dragone, I.C. Roberto, Brewers’ spent grain: Generation, characteristics and potential applications, Journal of Cereal Science 43 (1) (2006) 1-14. P. Forssell, H. Kontkanen, H.A. Schols, S.W.A. Hinz, V.G.H. Eijsink, J. Treimo, et al., Hydrolysis of Brewers’ spent grain by carbohydrate degradingenzymes, Journal of the Institute of Brewing 114 (4) (2008) 306-314. S.I. Mussatto, M. Fernandes, G. Dragone, I.M. Mancilha, I.C. Roberto, Brewers’ spent grain as raw material for lactic acid production by Lactobacillus delbrueckii, Biotechnology Letters 29 (12) (2007) 1973-1976.

[4]

I. Celus, K. Brijs, J.A. Delcour, Enzymatic hydrolysis of brewers’ spent grain proteins and technofunctional properties of the resulting hydrolysates, Journal of Agricultural and Food Chemistry 55 (21) (2007) 8703-8710. [5] J.A. Robertson, K.J.A. I’Anson, J. Treimo, C.B. Faulds, T. F. Brocklehurst, V.G.H. Eijsink, et al., Profiling brewers’ spent grain for composition and microbial ecology at the site of production, LWT-Food Science and Technology 43 (6) (2010) 890-896. [6] V.I. Kaur, P.K. Saxena, Incorporation of brewery waste in supplementary feed and its impact on growth in some carps, Bioresource Technology 91 (1) (2004) 101-104. [7] F.C. Ezeonu, A.N.C. Okaka, Process kinetics and digestion efficiency of anaerobic batch fermentation of brewer’s spent grains (BSG), Process Biochemistry 31 (1) (1996) 7-12. [8] D.S. Tang, G.M. Yin, Y.Z. He, S.Q. Hu, B. Li, L. Li, et al., Recovery of protein from brewer’s spent grain by ultrafiltration, Biochemical Engineering Journal 48 (1) (2009) 1-5. [9] S.I. Mussatto, G. Dragone and I.C. Roberto, Ferulic and p-coumaric acids extraction by alkaline hydrolysis of brewer’s spent grain, Industrial Crops and Products 25 (2) (2007) 231-237. [10] L. Mesa, E. González, C. Cara, M. González, E. Castro, S.I. Mussatto, The effect of organosolv pretreatment variables on enzymatic hydrolysis of sugarcane bagasse, Chemical Engineering Journal 168 (3) (2011) 1157-1162. [11] I. Celus, K. Brijs, J.A. Delcour, The effects of malting and mashing on barley protein extractability, Journal of Cereal Science 44 (2) (2006) 203-211.

Journal of Life Sciences 6 (2012) 1237-1250

Enhancing Rice Productivity and Soil Nitrogen Using Dual-Purpose Cowpea-NERICA® Rice Sequence in Degraded Savanna Sylvester O. Oikeh1, Abibu Niang2, Robert Abaidoo3, Pascal Houngnandan4, Koichi Futakuchi2, Brahima Koné2 and Amadu Touré2 1. Africa Agricultural Technology Foundation (AATF), Nairobi, PO Box 30709-00100, Kenya 2. Africa Rice Center (AfricaRice), Cotonou 01 BP 2031, Benin Republic 3. Department of Biological Sciences, Kwame Nkrumah University of Science and Technology (KNUST), Kumasi, Ghana 4. Laboratory of Microbial Ecology, Faculty of Agronomy, University of Abomey-Calavi (FSA/UAC), Cotonou 01 B.P. 526, Benin Received: May 14, 2012 / Accepted: July 12, 2012 / Published: November 30, 2012. Abstract: ISFM (integrated soil fertility management) involving annual sequencing of dual-purpose early-maturing first crop of cowpeas with biomass incorporation before seeding second crop of early-maturing NERICA® (New Rice for Africa) was evaluated to enhance rice productivity and soil-nitrogen. Five dual-purpose early-maturing cowpea cultivars and local cultivar (Katchè) were seeded early in the wet season in five farmers’ fields at Ouake (9°46' N, 1°35' E, highly degraded-savanna), Benin. After pod harvest, cowpea residues were minimally worked into the soil using minimum tillage with hand-hoe and seeded with early-maturing, resilient NERICA8 rice that received either 20 kg N/ha or zero-N. Cowpea grain yield averaged 0.1-0.3 Mg/ha, and mean aboveground cowpea biomass produced and recycled was 0.54-0.64 Mg/ha among best cultivars (IT97-568-11 and IT89KD-288). NERICA8 seeded after cowpea cv. IT97-568-11 and supplied with 20N gave the greatest grain yield of about 2.0 Mg/ha, accounting for 500% heavier grains than fallow-rice rotation with zero-N. Mineral-N dynamics monitored under NERICA8 in year 2 showed that previous IT97-568-11 plots had the highest mineral-N at tillering which persisted till panicle initiation stage. The adoption of an ISFM comprising annual cowpea–NERICA sequence by smallholder rice farmers could enhance productivity and improve N-supply in fragile savannas. Key words: Degraded savanna, dual-purpose cowpea, ISFM, NERICA® rice, rice productivity, soil nitrogen, West Africa.

1. Introduction Soil nutrients depletion is a major constraint to crop production in Africa. In West Africa, because of land-use intensification and limited use of fertilizers, the fragile upland rice production systems that contribute 33% of the total rice production, are experiencing severe soil degradation, nutrient depletion and low rice productivity [1, 2]. Thus rice yields in the upland production systems are seldom Corresponding author: Sylvester Oikeh, Ph.D., scientist/project manager, research fields: agronomy, soil fertility management and plant nutrition. E-mail: [email protected].

above 1 Mg/ha despite the reported potential for up to 4 Mg/ha from on-station researcher-managed fields [3]. A number of solutions had been proposed to address this declining productivity. Studies have been carried out on biological management of soil fertility to enhance upland rice productivity. Becker et al. [2] reported that the use of N2-fixing

legumes

including

Mucuna

spp.,

Stylosanthesguianensis, Canavaliaensiformis, grown as preceding fallow cover crops increased upland rice productivity and suppressed weed growth under intensified land use in Côte d’Ivoire, West Africa.

1238

Enhancing Rice Productivity and Soil Nitrogen Using Dual-Purpose ® Cowpea-NERICA Rice Sequence in Degraded Savanna

Further, the combined use of legume cover crops and sparingly-soluble indigenous phosphate rock has been recommended as a low-cost technology to increase the supply of both N and P and enhance upland rice productivity on acid soils in Côte d’Ivoire [4, 5]. However, some of these proposed solutions for regenerating soil fertility have been adopted only in limited cases. Farmers in West Africa are often reluctant to adopt legume cover crops that are not for human consumption or without a direct economic gain, despite the benefits in restoring soil fertility [6, 7]. But the grain legumes are infinitely more adoptable when integrated into cereal-based systems [8] for household food security and cash income. Other strategies to address the declining upland rice productivity included the development of high yielding resilient varieties such as NERICA® (New Rice for Africa). NERICA varieties are lowmanagement rice plant types for resource-limited, smallholder production systems [9] developed from interspecific crosses between high yielding Oryza sativa (Asian rice) and low-yielding resilient Oryza glaberrima (African rice) [10]. Their importance had earlier been documented [3, 11]. However, innovative strategies are needed to intensify upland rice production and increase yields in the fragile upland production systems. The authors therefore, hypothesized that sustainable intensification of upland rice production can be achieved from an ISFM (integrated soil fertility management) option involving an annual sequencing of dual-purpose early-maturing first crop of cowpea with biomass incorporation before seeding a second crop of early-maturing NERICA® plus a minimal use of mineral N to enhance rice productivity and nitrogen supply. The cowpea will contribute residual N from BNF (biological N2-fixation) to the soil, and other non-N effects. Seeding cowpea early in the season has the advantage of the crop escaping yield losses caused by insect-pests such as flower thrips (Megalurothrips

sjostedti) whose population are usually low at this period of the year [12]. A similar integrated soil fertility management (ISFM) strategy involving the integration of some dual-purpose promiscuously nodulating soybean varieties (Glycine max L.) combined with a low-level of mineral N and a resilient NERICA variety was reported to give 1.5 Mg/ha yield advantage over the control (0.2 Mg/ha) comprising one-year fallow followed by farmer’s variety in the savannas of Benin [13]. However, in this study the soybean biomass was removed from the field as practiced by the farmers leaving only leaf and root litter, thus limiting the benefits of the technology in enhancing soil nitrogen. Earlier studies in which cowpea was used in rotation with maize in maize-based cropping systems revealed that the cowpea plays an important role in nutrient economies of the cropping systems by reducing the need for N fertilizers through BNF [14, 15].The benefits of cowpea to N supply in the savanna through BNF have been estimated in the range of 60-80 kg/ha [16-18], depending on how the residues were managed. In some cases however, lower or even negative values have been reported [14, 18, 19]. Unlike the maize-based systems, the contribution of N from cowpea to enhancing the productivity of upland rice-based systems has not been extensively studied in West Africa. The objectives of the study were to identify dual-purpose cowpea variety most suitable for developing an annual cowpea-NERICA rotation system (an ISFM option); and to evaluate the contribution of this ISFM option to enhancing N supply and upland NERICA rice productivity in degraded savannas.

2. Materials and Methods 2.1 Location and Site Characterization On-farm field experiment of two-year duration was conducted at Ouake (9°46' N, 1°35' E) in NGS (the

Enhancing Rice Productivity and Soil Nitrogen Using Dual-Purpose ® Cowpea-NERICA Rice Sequence in Degraded Savanna

northern Guinea savanna) of Benin Republic. The location is characterized by a subhumid climate with annual rainfall of 1,108 mm (monomodal) that extends 150-180 days growing season. The experimental sites were located on Typic Haplustult (Chromic Luvisols–FAO classification system) from the medium to lower slope of the landscape. The soils were highly depleted of nutrients, moderately acidic, and sandy (Table 1). 2.2 Experimental Description: Legume Cropping Five farmers’ fields (sites) were selected at random within 2 km of the homestead and used for the experiment. Most farmers of Ouake had compound fields. However, one of the farmers withdrew from the study in 2007 bringing the number of sites to four. Five dual-purpose early-maturing (< 80 days) semi-erect cowpea cultivars (IT89KD-288, IT90-277-2, IT97-568-11, IT97K-1069-6, IT93452-1), and popular local cultivar (Katchè) were seeded early in the wet seasons in 2006 and 2007 in a randomized complete block design with two replications per site. Farmers’ practice of minimum tillage using hand hoe was used in both seasons. Cowpea seeds were sown at a spacing of 75 cm between row and 20 cm within rows on flat (no ridges). Plot size was 5 m wide and 6 m long (30 m2). Table 1 Physico-chemical characterization of topsoil (0-20 cm) of the experimental sites, Ouake, Benin, 2006. Properties

1239

Seedlings were thinned to 2 plants per stand at 18-21DAS (days after seeding) to a final population of 133,333 plants/ha. All plots received basal application of 13 kg P/ha as triple super phosphate and 25 kg K/ha as KCl just before the seeds were sown. No nitrogen fertilizer was applied to the cowpea. To mimic farmers’ practice, the crop was sprayed twice at 28-35 and 56 DAS with Shepard-Plus at the rate 1/l a.i./ha by the farmers under the supervision of the research team to protect it from insect-pests. Plots were weeded manually, and managed by the farmers with the guidance of the research team. At maturity, the cowpea pods were harvested from a net plots size of 15 m2. The dry pods were threshed to estimate grain yield. All the plants were slashed to the ground level and sub-samples were collected and oven-dried at 65 °C for 72 hr for dry biomass evaluation. The stovers were left on the field for three days before recycled by incorporating into the soil using minimum tillage with hand hoe before seeding upland rice (NERICA8) in both years. 2.3 Estimation of BNF and Nodules Production by Cowpea In 2006, at 50% podding stage (R3.5) of cowpea [20] xylem sap samples were taken from four plants cut at the first node above soil level. A sterile syringe was used to collect the sap. Extracts were stored in vials with an equal volume of ethanol and kept at 4 °C

Sites 1

2

3

4

0.2

0.3

0.6

> 0.1 1.0

derived from N2 fixation (%Ndfa) was estimated as

6.4

6.0

6.0

6.4

5.9

described by Peoples et al. [21].

5.4

5.1

5.3

5.7

5.2

Whole roots of the same four plants used for sap

Organic C (g/kg)

1.0

2.5

4.6

3.3

3.9

collection were excavated and the nodules were

Available N (mg/kg)

31.6 22.9 21.4 16.4 25.2

carefully extracted and washed. The rooting zones of

Mehlich III-P (mg/kg)

0.1

0.1

3.6

4.5

6.0

Sand (g/kg)

920

910

920

930

900

the harvested plants were further examined for

Clay (g/kg)

40

50

60

50

70

Distance from homestead (km) pH (water) pH (KCl)

Soil texture

5

Sandy soil Typic Haplustult (Chromic Soil classification (USDA) Luvisols; FAO)

until they were ready for analysis. The percentage N

detached nodules. The number of all the visible nodules extracted were counted and expressed per plant. The nodules were placed in an oven at 65 °C for 48 hr and dry biomass was estimated per plant.

1240

Enhancing Rice Productivity and Soil Nitrogen Using Dual-Purpose ® Cowpea-NERICA Rice Sequence in Degraded Savanna

2.4 Experimental Description: Subsequent Rice Cropping To assess the effects of the different previous cowpea cropping on the performance of upland NERICA rice, during the normal rice seasons of both years, each of the previous cowpea plots was subdivided into two sub-plots of 5 m × 3 m each. An early-maturing (85 days) resilient NERICA8 cultivar was used in all plots. The experimental design was a split-plot with previous cowpea in the main plots and sub-plots were two N levels of 0 and 20 kg/ha. Five to seven seeds of NERICA8 were dibble-seeded on a flat surface at a spacing of 0.20 m × 0.20 m and later thinned to four per stand at 14-18 DAS to maintain a plant population of 106 plants/ha [22]. Basal application of 26 kg P/ha as triple superphosphate (46% P2O5) and 25 kg K/ha as muriate of potash (KCl, 60% K2O) were given to all plots before seeding NERICA8. The N fertilizer in the form of urea (46% N) was applied in two splits of one-third at 21 DAS and two-thirds at 40-45 DAS as previously recommended for upland NERICAs [3]. At physiological maturity, data on grain and dry biomass yields were collected. Grain (paddy) yield was corrected to a 140 g/kg moisture basis. Yield components including number of tillers and panicles per m2, and 1,000-grain weight were also collected. Unfortunately, the 2007 rice crop following the cowpea failed at all sites due to the severe drought stress that set in before flowering in September and October in 2007 (Fig. 1). 2.5 Estimation of NFRV (N-Fertilizer Replacement Value) of Cowpea In late-seasons of 2006 and 2007 N response trials were carried out adjacent to the cowpea plots using NERICA8 to estimate the benefit of the cowpea cultivars to the farmers in the form of NFRV. The experiment was a randomized complete block design with each site considered as a replication. The treatment was N levels: 0, 20, 40, and 60 kg/ha (0N,

Fig. 1 Rainfall distribution during in 2006 and 2007 versus long-term mean at Ouake, Benin Republic.

20N, 40N, and 60N, respectively). Nitrogen, P and K fertilizer application, seeding rate, spacing, and crop management were as previously explained. Yield data were collected and grain yield was corrected to a 140 g/kg moisture basis. The NFRV of the legumes was estimated from the N linear response curve. The second rice crop from this experiment also failed at all sites due to the severe drought stress that set in before flowering in September and October in 2007. 2.6 Soil Sampling and Measurement At the beginning of the experiment in 2006, soil samples were taken to a depth of 20 cm from all plots, bulked for each site; air dried, sieved and analyzed for the characterization of the sites according to the analytical procedures of the International Institute of Tropical Agriculture [23]. Some of the physicochemical properties of topsoil (0-20 cm) are presented in Table 1. In 2007, to assess the contribution of the two-year cowpea cropping to mineral N (N-min) dynamics under NERICA rice, soil samples were taken to two depths, 0-15 and 15-30 cm from previous cowpea plots, and the adjacent fallow plots. Samples were taken just before seeding (T0), within three days after the incorporation of the cowpea stovers, at the beginning of tillering at 21 DAS (T21), and at about panicle initiation, 42 DAS (T42). The first two samples were taken only in the main plots of previous cowpea

Enhancing Rice Productivity and Soil Nitrogen Using Dual-Purpose ® Cowpea-NERICA Rice Sequence in Degraded Savanna

1241

and bulked by replications to have a composite sample per previous cowpea cultivar/fallow plot. But the T42 samples were taken from the two replications in all the rice subplots. These subplots had only received the first split of N before sampling. However, because of the drought and crop failure subsequent sampling could not be done before the experiment was terminated. Soil samples were extracted with 1:2 (w/w) soil:1N KCl solution and analyzed for nitrate and ammonium using a Technicon AAII auto-analyzer as described in IITA [23]. Mineral N was a summation of nitrate and ammonium concentration, although there was minimal NH4-N contribution.

Added benefits (Mg·ha-1) = Ycomb – (Y20N – Y0N) – (Yrot – Y0N) – Y0N (1) where, Ycomb was the rice yield in cowpea rotation plus 20N urea (Mg/ha); Y20N was rice yield in 20N urea (Mg/ha); Y0N was rice yield in 0N (control) (Mg/ha); Yrot was rice yield in cowpea rotation without urea (Mg/ha).

2.7 Statistical Analyses

cowpea cultivars (Fig. 2). Sites 2 and 3 in 2006 were

Statistical analyses were conducted using the mixed model procedure with REML (the restricted maximum likelihood method) for variance estimates [24]. Cowpea dry matter accumulation was analyzed by combining the sites and years as environments; example, site 1 in 2006 was regarded as S106 environment, site 1 in 2007 as S107 environment, and so on, to give a total of 9 site-years (environments). Rice data after cowpea rotation were analyzed across sites. For cowpea and rice agronomic data, sites and varieties were considered as fixed effects. Where three-way interactions were significant (P < 0.05) between main effects, simple effect differences were evaluated among treatments using LSMEANS (the least square means) SLICE option in PROC MIXED [24]. Mean separation was performed using the SAS LSMEANS test (probability of difference [PDIFF]) at P ≤ 0.05 and standard errors of the mean are presented. The impact of the combined used of cowpea rotation and applied urea-N on rice grain yield or added benefits in terms of grain yield were calculated for the most promising rotation systems using the following equation [7]:

3. Results 3.1 Dry Matter Yields in Dual-Purpose Cowpea Cultivars There were significant influences of environment (site-year) and cultivar, but no significant interaction of these factors on dry matter yields among the the best grain yielding environments, while sites 2 and 5 in 2006 gave the best stover yields. Averaged across environments, the dual-purpose cultivars gave 19-48% greater (P = 0.08) stover yield than the farmers’ cv. Katchè, while cv. IT93K-452-1 gave the highest grain yield. The cultivars IT93K-452-1 and IT97-568-11 ranked among the highest in stover production (Fig. 2). Yields were significantly depressed in 2007 compared with 2006 (Fig. 2). There were little or no grains and limited stover yields produced at sites 1 and 2 in 2007. 3.2 Biological Nitrogen Fixation and Nodulation by Cowpea Cultivars There was no significant influence (P = 0.099) of cultivars and sites on number of nodules produced per plant (Table 2). However on average, among the improved cultivars, IT97-568-11 produced heavier (P < 0.06) nodules than the check, cv. Katchè. The significant interaction of site × cultivar on nodule production (Fig. 3) showed that cv. IT89KD-288 at site 3 and cv. IT97K-1069-6 at site 4 ranked among the highest in nodule dry biomass. Site 5 which is the farthest from the homestead (Table 1) had the poorest nodule production for all cultivars.

1242

Enhancing Rice Productivity and Soil Nitrogen Using Dual-Purpose ® Cowpea-NERICA Rice Sequence in Degraded Savanna Table 2 Influence of cultivar and site on number of nodules, nodule biomass, and proportion of N derived from the atmosphere by N2 fixation (%Ndfa) of dual-purpose cowpea in NGS, Benin, 2006. Nodules g·plant-1 No plant-1 Site 1 56.3 6.66 8.4 Site 2 NA1 6.46 7.7 Site 3 41.6 6.30 4.2 Site 4 49.2 6.66 6.4 Site 5 NA 4.62 4.3 Mean 49.03 6.14 6.2 S.E. 4 0.42 0.993 IT89KD-288 NA 6.11 8.0 IT90-277-2 52.1 5.67 5.3 IT97-568-11 51.7 7.4 7.6 IT97K-1069-6 55.2 6.09 6.4 IT93K-452-1 57.1 6.36 4.5 Katchè (Local) 51.6 5.30 5.2 Mean 53.5 6.33 6.4 S.E. 4.24 0.465 1.09 2 Source NDF DDF Probability level of F Site (S) 4 4 0.037 0.099 0.111 Cultivar (C) 5 25 0.859 0.060 0.184 S×C 20 25 0.332 0.031 0.725 1 2 NA = not available; NDF = numerator degree of freedom; DDF = denominator degree of freedom of covariance parameters. Treatment

Fig. 2 Grain and stover yields of dual-purpose cowpea cultivars and a check as influenced by (a) environments (site-year); and (b) cultivars, 2006 and 2007. S106 = Site1, 2006; S206 = Site 2, 2006; S306 = Site 3, 2006; S406 = Site 4, 2006; S506 = Site 5, 2006; S107 = Site1, 2007; S207 = Site 2, 2007; S307 = Site 3, 2007; and S507 = Site 5, 2007. The farmer in Site 4 withdrew from the study in 2007.

Ndfa (%)

Fig. 3 Influence of site × cowpea cultivar on nodule dry biomass production at five sites, 2006. V1 = IT89KD-288; V2 = IT90-277-2; V3 = IT97-568-11; V4 = IT97K-1069-6; V5 = IT93-452-1; V6 = Katchè (Local); Standard error of the mean = 1.04.

There was no significant effect of cultivar and interaction of cultivar × site on percentage N derived from the atmospheric (%Ndfa) (Table 2). Values

ranged between 52% and 57%. However, differences between sites were significant (P = 0.037) with the highest mean recorded at site 1 which is among the

Enhancing Rice Productivity and Soil Nitrogen Using Dual-Purpose ® Cowpea-NERICA Rice Sequence in Degraded Savanna

closest to the homestead. 3.3 Succeeding Rice Yield and Yield Components Sites, N levels and the interaction of site × rotation × N level significantly influenced rice grain yield (Table 3). Without N application to the succeeding rice, a rotation with cv. IT97-568-11 ranked the best in grain yield at two of the sites and among the three best at the other sites (Table 4). At most sites, with application of 20N to the succeeding rice, rotations

1243

that involved cvs. IT97-568-11 and IT89KD-288 gave the highest grain yield of 1.6-1.9 Mg/ha, two to three times heavier grains than the previous fallow plots supplied with 20N; and five to six times greater yields than the farmers’ practice of previous fallow plots without N (Table 4). This means that it will require only 10-12 kg N to produce 1.0 Mg of rice grain with the use of these two cowpea cultivars grown as first crop early in the season prior to a second cropping with rice. Furthermore, the mean added benefits in

Table 3 Analysis of variance from Mixed Model procedures for NERICA rice yields and some components of yield as influenced by site, rotation and N levels, 20061.

Source of variation

NDF

DDF

Grain yield (Mg/ha)

Probability level of F Yield components Tillers Panicles 1000-kernel (g) (No./m2)

Site 4 5 0.035 0.033 0.039 0.467 Rotation 6 30 0.129 0.196 0.049 0.783 Site × Rotation 24 30 0.493 0.069 0.033 0.492 N level 1 35 < 0.0001 < 0.001 < 0.001 < 0.0001 Site × N level 4 35 0.368 0.748 0.467 0.978 Rotation × N level 6 35 0.535 0.999 0.502 0.034 Site × Rotation × N level 24 35 0.046 0.765 0.777 0.476 -2 Res Log Likelihood 981 697 666 370 CV (%) 18 11 12 7 1 Probability levels are for fixed effects. NDF = numerator degree of freedom; DDF = denominator degree of freedom of covariance parameters. Table 4

Influence of site, rotation and N application on grain yield (Mg/ha), 2006.

Sites 1 2 3 4 5 1 2 0 IT89KD-288 0.40a A 1.30aA 1.22aA 0.90aA 0.84aA 0 IT90-277-2 0.36aA 0.83aA 0.94bA 0.95aA 0.46aA 0 IT97-568-11 0.51aC 0.79aB 1.53aA 1.58aA 0.73aB 0 IT97K-1069-6 0.65aA 1.16aA 0.67cA 0.97aA 0.71aA 0 IT93K-452-1 0.64aA 0.67aA 0.49cA 1.33aA 0.27aA 0 Katchè (Local) 0.39aA 0.44aA 1.05bA 1.10aA 0.61aA 0 Fallow 0.29aA 0.28aA 0.31dA 1.08aA 0.26aA 20 IT89KD-288 0.68aD 1.59aB 1.93aA 1.77aAB 1.00aC 20 IT90-277-2 0.68aA 1.00bA 1.53aA 1.47aA 0.85aA 20 IT97-568-11 0.68aD 1.65aB 1.87aA 1.75aAB 1.00aC 20 IT97K-1069-6 0.96aA 1.16bA 0.81bA 1.52aA 1.42aA 20 IT93K-452-1 1.10aB 1.18bB 0.95bB 1.75aA 0.35aC 20 Katchè (Local) 0.72aA 0.94bcA 1.55aA 1.71aA 1.38aA 20 Fallow 0.70aBC 0.57cC 0.83bB 1.49aA 1.46aA 1 Means within a column in a given N level and site followed by the same lowercase letter are not significantly different at P < 0.05. Test effects of SLICING by N level × site. 2 Means within a row followed by the same uppercase letter are not significantly different at P < 0.05. Test effects of SLICING by N level × rotation. N level (kg·ha-1)

Rotation

1244

Enhancing Rice Productivity and Soil Nitrogen Using Dual-Purpose ® Cowpea-NERICA Rice Sequence in Degraded Savanna

terms of extra grains produced by integrating these two cowpea cultivars plus only 20 kg N/ha urea in cowpea-NERICA rotation system were calculated from Eq. (1) and Table 4 as 0.7-0.8 Mg/ha. At three of the sites, previous fallow plots with application of only 20N gave two to three times significantly greater yield than fallow plots without N (Table 4), underscoring the need to supply mineral N to these highly degraded savanna soils to restore their fertility. Also, at almost all the sites, rice grown in most previous cowpea plots combined with 20N gave significantly greater yield than the rice grown in similar plots without N (Table 4). The ranking of sites for tiller production was: site 4 (171 m-2) > site 3 (140 m-2) > site 2 (127 m-2) > site 5 (120 m-2) > site 1 (93 m-2). The ranking of sites for panicle production followed a similar trend as tillers: site 4 (125 m-2) > site 3 (103 m-2) > site 5 (99 m-2) > site 2 (89 m-2) > site 1 (63 m-2). The interaction of site × rotation on panicle production (Table 5) indicated that rotations involving both cvs. IT97-568-11 and IT89KD-288 produced more panicles at most sites than the other rotations. However, there was no significant difference between cowpea-rice and fallow-rice rotation in panicle production at sites 4 and 5. Further, there was no effect of sites on kernel size as measured by thousand-kernel weight, but the interaction of rotation × N level on kernel size was significant (Table 3). The application of 20N to the previous legume rotation plots enhanced kernel size

by about 10% over legume rotation plots without N (Fig. 4). Without N, kernel sizes were similar among the rotation plots. However, kernel size was the highest (25 g/1,000-kernel) with 20N supplied to the previous cvs. IT90-277-2 and IT97-568-11 plots. 3.4 N-Fertilizer Replacement Value of Dual-Purpose Cowpea In 2006, in the second cropping season, at different sites but adjacent to each other, NERICA8 responded significantly to N application (Fig. 5). With application of only 40 kg N/ha grain yield tripled (0.5-1.4 Mg/ha) demonstrating the responsiveness of NERICAs to N application. Under the conditions of the experiment, it would require 21-25 kg N to produce 1.0 Mg of NERICA8 without the integration of legumes into the production system compared with 10-12 kg N needed to produce 1.0 Mg of rice grain when cowpea cvs. IT97-568-11 and IT89KD-288 were grown before the cultivation of NERICA8 plus 20N urea. On the basis of the N-response curve (averaged across sites) (Fig. 5), using the corresponding equation, the mean grain yield of 1.0 Mg/ha obtained with the two best cowpea-rice rotation with cvs. IT97-568-11 and IT89KD-288 without N (Table 4) was equivalent to the application of 26 kg N/ha to the rice crop. Therefore, the NFRV (N savings) of growing these cowpea cultivars prior to NERICA8 was 26 kg N/ha.

Table 5 Interaction of rotation × site on panicle production, 2006. Rotation IT89KD-288 IT90-277-2 IT97-568-11 IT97K-1069-6 IT93K-452-1 Katchè (Local) Fallow S.E.

1 64 60 75 64 75 50 52 17.2

Site (No./m2) 2 3 4 130.0 119 119 67 126 119 117 121 141 113 77 118 59 70 134 99 104 126 37 98 114

5 133 100 74 104 63 88 133

Fig. 4 Influence of rotation × N level on thousand-kernel weight of NERICA8, 2006. Vertical bar indicates standard error of the mean.

1245

Enhancing Rice Productivity and Soil Nitrogen Using Dual-Purpose ® Cowpea-NERICA Rice Sequence in Degraded Savanna

topsoil was 11%-62% higher (P < 0.05) in previous cv. IT97-568-11 plots than in the other cowpea or fallow plots (Table 7). On average, there was 35% more

3.5 Soil N in NERICA8 Plots in 2007 Soil nitrate-, ammonium- and mineral-N sampled just before seeding NERICA8 (T0) in 2007 were significantly influenced by soil depth but not by the rotation system. As expected, all these soil N parameters were significantly higher in the topsoil 0 to 15 cm than at 15-30 cm depth, except ammonium-N which was not significantly influenced by soil depth (Table 5). At 21 DAS, only nitrate-N was significantly influenced by depth and its interaction with rotation system (Table 5). The interaction effect (Table 6) showed that at both soil depths, previous plots of cv. IT97-568-11 had the highest amounts of nitrate-N, ranging from 15 to 21 kg/ha.

Fig. 5 Response across five sites of NERICA8 to N application in second season, 2006. The regression equation was used for the estimation of NFRV (N fertilizer replacement value) of the best performing rotation systems.

Rotation × soil depth interaction on mineral-N sampled at T42 indicated that the mineral-N in the

Table 6 Analysis of variance from Mixed Model procedures for soil nitrate-, ammonium- and mineral-N at three sampling periods, 20071. Probability level of F Source1 Fixed effects Rotation (R) Depth (D) R×D Covariate (km) Cov. Parm2 Block (Site; S) S×R Residual Source

NO3-

NH4+

Nmin

NO3-

T21 NH4+

Nmin

0.455 0.001 0.396 0.587

0.423 0.204 0.423 0.585

0.350 0.009 0.352 0.417

0.325 0.025 0.044 0.559

0.609 0.775 0.478 0.046

0.598 0.137 0.793 0.235

0.267

-

-

0.355 0.001

0.290 0.001

0.197 0.137 0.001

0.099 0.002

0.321 0.136 0.001

< 0.001

T0

NO3-

Fixed effects Rotation (R) 0.161 N rate (N) 0.036 R×N 0.049 Depth (D) < 0.0001 R×D 0.431 N×D 0.403 R×N×D 0.475 Covariate (km) 0.786 Cov. Parm Block (Site; S) 0.193 S×R 0.032 S×N×R 0.464 Residual < 0.0001 1 Sampling periods were: T0 = at seeding; T21 = 21 DAS; T42 = 42 DAS. 2 Cov. Parm = covariance parameters.

NH4+

T42 Nmin

0.445 0.315 0.529 0.217 0.133 0.337 0.1000 0.329

0.122 0.681 0.722 < 0.0001 0.049 0.514 0.113 0.629

0.322 0.456 0.226 < 0.0001

0.222 0.335 0.092 < 0.0001

1246

Enhancing Rice Productivity and Soil Nitrogen Using Dual-Purpose ® Cowpea-NERICA Rice Sequence in Degraded Savanna

Table 7 Interactions of rotation × N rate on soil nitrate-N (averaged across depths) at 42 DAS, and rotation × soil depth on soil nitrate-N at 21 DAS and mineral-N at 42 DAS at two soil depths, 2007. N rate1 Rotation

0N

20N NO3- (T42) (kg/ha) 10.9 13.5 16.4 15.5 11.7 9.7 13.1

0-15

15-30 NO3- (T21) (kg/ha) 12.8 8.6 15.1 14.3 13.9 8.5 10.4

Soil depth (cm) 0-15

15-30 Nmin (T42) (kg/ha) 26.2 22.7 25.7 28.2 23.5 27.0 22.7

IT89KD-288 14.3 11 31.0 IT90-277-2 11.4 17.7 33.1 IT97-568-11 12.1 20.6 40.5 IT97K-1069-6 15.4 11.6 36.4 IT93K-452-1 9.3 15.6 28.0 Katchè (Local) 10.7 12.7 25.0 Fallow 8.2 12.6 24.9 S.E. 2.41 2.78 3.31 1 N rates: 0N = 0 kg N/ha; 20N = 20 kg N/ha; Nmin = Mineral-N; T21 = Sampling at 21 DAS; T42 = Sampling at 42 DAS.

mineral N in the topsoil of the previous dual-purpose cowpea plots than in the fallow plots or previous farmer’s cowpea plots. However, at the subsoil (15-30 cm), none of the previous cowpea cultivars gave significantly higher mineral-N than the fallow. The ANOVA presented in Table 5, showed that at 42 DAS (T42), N level and interaction with rotation system, and soil depth significantly enhanced the release of nitrate-N, but there was no effect on ammonium-N. Also, soil depth and its interaction with rotation system significantly influenced mineral-N. With 0N, nitrate-N released from the previous plots of cvs. IT89KD-288 and IT97K-1069-6 was 74%-88% higher (P < 0.05) than the amount released from the previous fallow plots (Table 7). While, with application of 20N (only one-third applied before T42 sampling), mean nitrate-N was enhanced by 12%, and previous cvs. IT97-568-11 and IT97K-1069-6 plots had the highest value of 16 kg N/ha (Table 7). Furthermore, the interaction of rotation × site on nitrate-N (Fig. 6) showed that the previous plots of cv. IT97-568-11 gave the highest nitrate-N (19-22 kg/ha) in half of the fields evaluated, while the previous plots of cv. IT97K-1069-6 gave 1.7-2.7 times more nitrate-N than the previous plots of the other cultivars in Site 4. Rotation × soil depth interaction on mineral-N sampled at T42 indicated that the mineral-N in the topsoil was 11%-62% higher (P < 0.05) in previous cv.

Fig. 6 Influence of rotation × site on soil nitrate-N at 42 DAS in the second season, 2007.

IT97-568-11 plots than in the other cowpea or fallow plots (Table 7). On average, there was 35% more mineral N in the topsoil of the previous dual-purpose cowpea plots than in the fallow plots or previous farmer’s cowpea plots. But, at the subsoil (15-30 cm), none of the previous cowpea cultivars gave significantly higher mineral-N than the fallow.

4. Discussion The identification of appropriate dual-purpose cowpea cultivars for the development of annual cowpea-NERICA rice rotation system could be a beneficial component of an integrated soil fertility management option to restore soil fertility to the degraded fragile upland West African savanna ecosystems and enhance rice productivity. The mean cowpea grain yields (0.1-0.3 Mg/ha) obtained during the two-year study were within the range of 0.1-0.7 Mg/ha reported for improved cowpea cultivars grown in the NGS of Nigeria [14, 15, 25], but slightly lower

Enhancing Rice Productivity and Soil Nitrogen Using Dual-Purpose ® Cowpea-NERICA Rice Sequence in Degraded Savanna

than the values of 0.3-0.4 Mg/ha reported for the more fertile southern Benin Republic [26]. Average yields of 0.1 Mg/ha are often obtained for wet season cowpea by farmers. However, in the wetlands, during the dry season when there is minimal insect pressure, higher grain yields of 0.5-0.7 Mg/ha have been reported [25]. The authors’ results showed that two-year mean aboveground shoot biomass of 0.42-0.68 Mg/ha were recycled by the dual-purpose cowpea cultivars, much lower than the 3.5 Mg/ha previously reported for southern Benin Republic [26]. Although the N concentration of the stovers were not determined, if the authors assume a concentration of 18 g/kg as earlier reported for cowpea cultivars of similar duration in the NGS of Nigeria [14], the amount of N returned to the soil would range from 8 to 16 kg/ha. These values were, however, lower than those previously reported [14]. The difference could be attributed to the highly degraded sandy soils of the experimental sites used in this study. Despite the highly degraded and sandy nature of the soils of the experimental sites used in this study, the values of percentage Ndfa by these early maturing dual-purpose cowpea cultivars were within the range of levels reported elsewhere [14, 15, 27]. However, the values were generally lower than the maximum reported for cowpea [28]. The differences in values could be attributed to the differences in population and effectiveness of the indigenous rhizobia, and the level of fertility of the sites used by the different research groups. The significantly greater yield in most previous cowpea plots combined with 20N than the rice grown in similar plots without N suggests synergistic effects of the legume residues including roots and mineral N fertilizer on grain yield as also reported for cowpea-sorghum rotation in the Guinea savanna of Burkina Faso [28]. The enhanced grain yield of rice obtained in the previous plots of IT97-568-11 and IT89KD-288 with

1247

or without N compared with the fallow-rice plots might have been due to the greater panicle production and to some extent increased in kernel size particularly when N was applied to the rice in these previous cowpea plots. The authors’ results are consistent with other studies that reported increments of 45% to 95% in grain yields of other cereal test crops such as maize, millet and sorghum following cowpea in a rotation sequence [14-18]. The differences in responses reported by the different authors may be attributed to differences in N supplied by the cowpea residues, the testing environments, and the test crop responsiveness to N. The cowpea cvs. IT97-568-11 and IT89KD-288 were estimated to have 26 kg N/ha NFRV. This estimate of NFRV includes the effects of Ndfa by the two cultivars in addition to the apparent N effect, commonly referred to as “N sparing effects”, and in some cases non-N effects. The authors’ estimate of 26 kg N/ha NFRV by these cultivars was about thrice the value previously estimated in northern Nigeria for early-maturing cowpea-maize rotation system in a two-year cycle separated by a long dry season [29]. In the authors’ study, cowpea residues were returned just before the seeding of rice in the same year, which may have enhanced the benefit to the rice. In contrast, higher NFRV estimates of 35 kg/ha was reported for cowpea-sorghum system in Burkina Faso [27], 40 kg/ha for cowpea-millet system in Mali [30], and 80 kg/ha for cowpea-maize system in northern Ghana [17]. In the study of cowpea-millet system in Mali [30], the control was continuous millet which was likely to give higher estimates of NFRV because of N export by the millet compared with the fallow control plots used in the present study. While in the study of cowpea-maize system in northern Ghana [17], two crops of cowpea were grown in one year before the maize test crop which may have contributed to the higher NFRV reported. Also, the duration of cowpea cultivars could influence the estimate of NFRV. The longer the

1248

Enhancing Rice Productivity and Soil Nitrogen Using Dual-Purpose ® Cowpea-NERICA Rice Sequence in Degraded Savanna

growing season of the cowpea, the greater the positive effects on grain yield of the subsequent millet crop [31]. Early-maturing cowpeas were used in the present study which might have reduced the benefit. Despite the limited estimated N content of 8-16 kg in the aboveground residues recycled, the NFRV of the best rotation was 26 kg/ha, suggesting other sources of N or benefits may be involved. The high estimate of NFRV could be attributed to N-sparing effect of the cowpea crop that might have resulted in more N in the soil for the subsequent NERICA rice as earlier reported for cowpea-maize rotation system [14]. In addition, some cowpea cultivars have been reported to have additional positive non-N benefit of reducing noxious parasitic weed (Striga hermonthica) seed bank to the advantage of the succeeding cereal crop in rotation [26]. But Striga control was not evaluated in the current study. The lack significant influence of the treatments on NH4-N, the minimal contribution NH4-N to mineral-N, and the flush of mineral-N in the topsoil (0-15 cm) early in the season had been reported for cereal-based cropping systems in both the forest and savanna agroecosystems without legume rotation [32, 33] and with legume rotations [6, 17] in West Africa. This reveals, therefore, the need for short-duration rice varieties with rapid early root development to capture this mineral-N before it is lost into the subsoil. The better performance of rice in the previous plots of cv. IT97-568-11 could be attributed to the high supply of N as recorded at the beginning of tillering (21 DAS) which remained in the rice root zone within the growing period up to about the panicle initiation growth stage (42 DAS). It is likely that, the relatively high recycled aboveground biomass of this cultivar might have slowed down the release of N into the season. Several other studies had reported that, net N mineralization was enhanced by high quality legume residues, high N, and low lignin and polyphenol concentrations [34, 35]. The continuous cultivation of IT97-568-11 in rotation with short-duration NERICA,

example NERICA8 can in the long-term improve soil nitrogen supply [17] and enhance NERICA rice productivity.

5. Conclusions The study showed that cowpea cvs. IT97-568-11 ranked among the best in grain yield, and also in aboveground biomass and stover-N yields produced and recycled in the first rain-fed cropping season in both years of the study. Previous plots of this cultivar seeded to early-maturing resilient upland NERICA8 rice supplied with 20N gave the greatest grain yield of about 2.0 Mg/ha, 500% greater yields than the farmers’ practice of previous fallow-rice rotation without N. Farmers adopting this technology using cv. IT97-568-11 would save an equivalent of 26 kg N/ha (NFRV) per cropping season. The added benefits in terms of extra grain produced by growing cv. IT97-568-11 prior to rice supplied with only 20N urea was estimated as 0.75 Mg/ha, probably due to an improvement in the utilization of N. Whereas it required 25 kg N to produce 1.0 Mg of rice using only urea-N, it will require only half this amount (10-12 kg N) to produce the same 1.0 Mg of rice grains from rotation with this cultivar plus 20N urea. Further, the better performance of rice in the previous plots of cv. IT97-568-11 could also be attributed to the enhanced supply of N at the beginning of tillering that was sustained in the topsoil close to the panicle initiation growth stage for possibly better synchronization of mineral-N released with N uptake by the succeeding rice. Therefore, the adoption of annual cowpea-NERICA rice rotation system with the appropriate cowpea cultivars by smallholder farmers in addition to enhancing upland NERICA rice grain yield could improve soil N supply in the long-term in West African fragile upland soils.

Acknowledgments The authors gratefully acknowledge financial

Enhancing Rice Productivity and Soil Nitrogen Using Dual-Purpose ® Cowpea-NERICA Rice Sequence in Degraded Savanna

support from UNDP-IHP Phase II Project. Thanks go to Ms. Mariame Mariko for assistance in data collection.

References [1]

R.J. Buresh, P.C. Smithson, D.T. Hellums, Building soil phosphorus capital in Africa, in: R.J. Buresh, P.A. Sanchez, F. Calhoun (Eds.), Replenishing Soil Fertility in Africa, SSSA Special Publication 51, Madison, WI, USA, 1997, pp. 111-149. [2] M. Becker, D.E. Johnson, The role of legume fallows in intensified upland rice-based systems in West Africa, Nutrients Cycling in Agroecosystems 53 (1999) 71-81. [3] S.O. Oikeh, F. Nwilene, S. Diatta, O. Osiname, A. Touré, K.A. Okeleye, Responses of upland NERICA rice to nitrogen and phosphorus in forest agroecosystems, Agronomy Journal 100 (3) (2008) 735-741. [4] E.A. Somado, M. Becker, R.F. Kuehne, K.L. Sahrawat, P.L.G. Vlek, Combined effects of legumes with rock phosphorous on rice in West Africa, Agronomy Journal 95 (2003) 1172-1178. [5] S.O. Oikeh, E.A. Somado, K.L. Sahrawat, A. Toure, S. Diatta, Rice yields enhanced through integrated management of cover crops and phosphate rock in P-deficient Ultisols in West Africa, Communication in Soil and Plant Analysis 39 (2008) 2894-2919. [6] S.O. Oikeh, V.O. Chude, R.J. Carsky, G.K. Weber, W.J. Horst, Legume rotation in the moist tropical savanna: Managing soil N dynamics and cereal yield in farmers’ fields, Experimental Agriculture 34 (1998) 73-83. [7] B. Vanlauwe, K. Aihou, S. Aman, E.N.O. Iwuafor, B.K. Tossah, J. Diels, et al. Maize yields as affected by organic inputs and urea in the West African moist savanna, Agronomy Journal 93 (2001) 1191-1199. [8] N. Sanginga, K.E. Dashiell, J. Diels, B. Vanlauwe, Sustainable resource management coupled to resilient germplasm to provide new intensive cereal-grain-legume livestock systems in the dry savanna, Agriculture Ecosystem and Environment 100 (2003) 305-314. [9] M. Dingkuhn, M.P. Jones, D.E. Johnson, A. Sow, Growth and yield potential of O. sativa and O. glaberrima upland rice cultivars and their interspecific progenies, Field Crops Research 57 (1998) 57-69. [10] M.P. Jones, M. Dingkuhn, K. Aluko, S. Mande, Interspecific Oryza sativa L. × O. glaberrima Steud. progenies in upland rice improvement, Euphytica 92 (1997) 237-246. [11] Food and Agricultural Organization, FAO Rice Market Monitor [Online], Vol. X No. 1, 2007, http://www.fao.org/es/esc/en/index.html (click on “Rice”) (accessed March 20 2007).

1249

[12] M. Tamò, J. Baumgartner, D.Y. Arodokoun, The spatio-temopral distribution of Megalurothrips sjostedti (TRYBOM) (Thysanoptera, Thripidae) life stages on cowpea, and development of sampling plans, Bulletin de la Société Entemologique Suisse 66 (1993) 15-34. [13] S. Oikeh, P. Houngnandan, A. Robert, A. Niang, A. Toure, B. Kone, Contribution of promiscuous soybean (Glycine max L.) to upland rice-based cropping systems in West Africa, Journal of Agricultural Science and Technology 4 (1) (2010) 54-61. [14] R.J. Carsky, B.B. Singh, B. Oyewole, Contribution of early-season cowpea to late season maize in the savanna zone of West Africa, Biological Agriculture and Horticulture 18 (2001) 303-315. [15] R.C. Abaidoo, J.A. Okogun, G.O. Kolawole, J. Diels, P. Randall, N. Sanginga, Evaluation of cowpea genotypes for variations in their contribution of N and P to subsequent maize crop in three agro-ecological zones of West Africa, in: A. Bationo, B. Waswa, J. Kihara, J. Kimetu (Eds.), Advances in Integrated Soil Fertility Research in Sub-Saharan Africa: Challenges and Opportunities, Springer, The Netherlands, 2007, pp. 401-413. [16] F.D. Dakora, R.A. Aboyinga, Y. Mahama, J. Apaseku, Assessment of N fixation in groundnut (Arachishypogaea L.) and cowpea (Vignaunguiculata L. Walp.) and their relative N contribution to a succeeding maize crop in northern Ghana, MIRCEN Journal 3 (1987) 389-399. [17] W.J. Horst, R. Härdter, Rotation of maize with cowpea improves yield and nutrient use of maize monocropping in an alfisol in the northern Guinea savanna of Ghana, Plant and Soil 160 (1994) 171-183. [18] N. Sanginga, O. Lyasse, B.B. Singh, Phosphorus-use efficiency and nitrogen balance of cowpea breeding lines in a low P soil of the derived savanna zone in West Africa, Plant and Soil 220 (2000) 119-128. [19] K.O. Awonaike, K.S. Kumarasinghe, S.K.A. Danso, Nitrogen fixation and yield of cowpea (Vigna unguiculata) as influenced by cultivar and Bradyrhizobiumstrain, Field Crops Research 24 (1990) 163-171. [20] W.R. Fehr, C.E. Caviness, D.T. Burmood, J.S. Pennington, Stages of development descriptions for soybeans Glycine max (L.) Merill, Crop Science 11 (1971) 929-931. [21] M.B. Peoples, A.W. Faizah, B. Rerkasem, D.F. Herridge, Methods for evaluating nitrogen fixation by nodulated legumes in the field, ACIAR Monograph No. 11, ACIAR, Canberra, Australia, 1989. [22] S.O. Oikeh, A. Touré, B. Sidibe, A. Niang, M. Semon, Y. Sokei, et al., Responses of upland NERICA rice varieties to nitrogen and plant density, Archives of Agronomy and Soil Science 55 (2009) 301-314.

1250

Enhancing Rice Productivity and Soil Nitrogen Using Dual-Purpose ® Cowpea-NERICA Rice Sequence in Degraded Savanna

[23] Selection Methods for Plant Analysis, Manual Series No. 7, International Institute of Tropical Agriculture (IITA), Ibadan, Nigeria, 1989. [24] SAS Institute, SAS Technical Report, SAS/STAT Software: Changes and Enhancements, Release 9.1. SAS Inst., Cary, NC, USA, 2002. [25] S.F. Blade, S.V.R. Shetty, T. Terao, B.B. Singh, Recent developments in cowpea cropping systems research, in: B.B. Singh, D.R. Mohan, K.E. Dashiell, L.E.N. Jackai (Eds.), Advances in Cowpea Research, Ibadan, Nigeria, IITA, 1997, pp. 114-128. [26] P.V. Vissoh, G. Gbéhounou, A. Ahanchédé, N.G. Roling, T.W. Kuyper, Evaluation of integrated crop management strategies employed to cope with Striga infestation in permanent land use systems in southern Benin, International Journal of Pest Management 54 (2008) 197-206. [27] B.V. Bado, A. Bationo, M.P. Cescas, Assessment of cowpea and groundnut contributions to soil fertility and succeeding sorghum yields in the Guinea savannah zone of Burkina Faso (West Africa), Biology and Fertility of Soils 43 (2006) 171-176. [28] M.B. Peoples, E.T. Crasswell, Biological nitrogen fixation: Investment, expectation and actual contribution to agriculture, Plant and Soil 141 (1992) 13-39. [29] R.J. Carsky, B. Oyewole, G. Tian, Integrated soil management for the savanna zone of West Africa: Legume rotation and fertilizer N, Nutrients Cycling in Agroecosystems 55 (1999) 95-105. [30] M. Bagayoko, S.C. Mason, S. Traoré, The role of

[31]

[32]

[33]

[34]

[35]

cowpea on pearl millet yield, N uptake, and soil nutrient status in millet-cowpea rotation in Mali, in: G. RenardNeef, A. Becker, K.M. Von Oppen (Eds.), Soil fertility management in West African land-use systems, Germany, Margraf-Verlag, Weikerseim, 1997, pp. 109-114. W.A. Stoop, J.P. van Staveren, Effect of cowpeas in cereal rotations on subsequent crop yields under semiarid conditions in Upper Volta, in: P.H. Graham, S.C. Harris (Eds.), Biological Nitrogen Fixation Technology for Tropical Agriculture, CIAT, Cali, Colombia 1982, pp. 653-657. G. Weber, V. Chude, J. Pleysier, S. Oikeh, On-farm evaluation of nitrate-N dynamics under maize in the northern Guinea savanna of Nigeria, Experimental Agriculture 31 (1995) 333-344. S.O. Oikeh, R.J. Carsky, J.G. Kling, V.O. Chude, W.J. Horst, Differential N uptake by maize cultivars and soil nitrate dynamics under N fertilization in West Africa, Agriculture, Ecosystems and Environment 100 (2003) 181-191. R.H. Fox, R.J.K. Mowers, I. Vallis, The nitrogen mineralization rate of legume residues in soils as influenced by their polyphenol, lignin and nitrogen contents, Plant and Soil 129 (1990) 151-259. C.A. Palm, C.N. Gatchengo, R.J. Delve, G. Cadisch, K.E. Giller, Organic inputs for soil fertility management in tropical agroecosystems: Application of an organic resource database, Agriculture, Ecosystems and Environment 83 (2001) 27-42.

Journal of Life Sciences 6 (2012) 1251-1261

Performance of Farmland Terraces in Maintaining Soil Fertility: A Case of Lake Maybar Watershed in Wello, Northern Highlands of Ethiopia Shimeles Damene1, Lulseged Tamene2 and Paul L.G. Vlek1 1. Center for Development Research (ZEF), University of Bonn, Bonn D-53113, Germany 2. International Center for Tropical Agriculture (CIAT), Chitedze Agricultural Research Station, Lilongwe, Malawi Received: July 26, 2012 / Accepted: August 10, 2012 / Published: November 30, 2012. Abstract: Soil-erosion-induced land degradation is a great challenge in the Ethiopian highlands. Consequently, the government has invested in soil and water conservation measures to tackle the problem where farmland terracing is one of the commonly implemented measures in the country. The purpose of this study was to analyze the role of farmland terracing in maintaining soil fertility and to evaluate its performance within a terrace, across terrace age and slope of terrain. The study was conducted in the Lake Maybar watershed in Wello, northern Ethiopia. Composite topsoil samples were collected from plots representing four slope categories across the terrain and three positions within a terrace. The samples were analyzed for selected soil physico-chemical properties and statistically tested using ANOVA (analysis of variance). The study revealed that soil pH (∆pH [H2O] = 0.6), exchangeable K+ (∆K+ = 0.33 cmol(+)/kg) and clay (9%) content significantly increased towards the lower terrain position. Unlike other studies, all soil properties except bulk density (∆ 0.40 g/cm3) showed non-significant differences within a terrace. Bench terrace formation reduced soil fertility gradients within a terrace for which it has been commented. Soil fertility also showed very slight change across terrace age, which indicates terracing reduced erosion-induced soil and nutrient loss. However, in order to optimize impact of farmland terracing on soil fertility maintenance, terracing should be complemented by fertility amendment considering site-specific conditions. Key words: Farmland terrace, terrain, Wello, Ethiopia, soil degradation, soil fertility.

1. Introduction Soil erosion is one of the most widespread forms of land degradation in the Ethiopian highlands [1-5]. Due to the large human and livestock pressure and rugged topography, the Ethiopian highlands (above 1500 m a.s.l.) are seriously affected by soil erosion [1, 2, 5-8]. For example, study conducted in Maybar indicated annual topsoil loss ranging from 36 t/ha on land with soil conservation practices to 110 t/ha on land with the local cultivation practices [9]. To circumvent the negative consequences of soil erosion, the government

Corresponding author: Shimeles Damene, junior researcher, research fields: ecology and natural resource management. E-mail: [email protected].

of Ethiopia implemented various mechanical and biological SWC (soil and water conservation) measures in various parts of the country [1, 5, 8-12] where farmland terracing is widely implemented practice [1, 9]. The primary objectives of the government-initiated SWC interventions were to reduce soil erosion, improve environmental conditions and stabilize or improve agricultural productivity [1, 3, 9-13]. Despite the long history of terracing in very few parts of the country and the current efforts to extend it, some farmers oppose terracing stating that it is labor intensive, harbors rodents, decreases the size of cultivable land, and leads to soil fertility and crop production gradients within a terrace [2, 9, 13, 14]. Despite the claim by some farmers, the performance

1252

Performance of Farmland Terraces in Maintaining Soil Fertility: A Case of Lake Maybar Watershed in Wello, Northern Highlands of Ethiopia

of farmland terracing, particularly with respect to soil fertility maintenance has not been sufficiently investigated and the intervention has been widely advocated [9]. On the other hand, there is a deficiency of research based empirical evidence concerning the impact of farmland terracing on soil fertility over space and time. Therefore, this study analyzed the impact of farmland terracing with respect to maintaining soil fertility, and evaluated performance variability within a terrace, across terrace age and at different terrain positions.

2. Materials and Methods 2.1 Study Area The study was conducted in MSCRS (the Maybar Soil Conservation Research Site), which is one of the six sites of the Ethiopian SCRP (Soil Conservation Research Program) established in 1982. MSCRS is located in the Lake Maybar watershed in Albuko district (Wereda), South Wello zone of Amhara National Regional State. The watershed is located between 10°58′ and 11°02′ N latitude and 39°38′ and 39°40′ E longitude covering nearly 450 ha (Fig. 1).

The lake drains to the Borchenna River in the Awash River basin. Geologically, the area is part of the Tarmaber Megezez formation originating from transitional and alkaline basalt [8]. According to the FAO classification system, the major soils of the watershed are Phaeozems, Regosols, Leptosols, Gleysols and Fluvisols [15]. The watershed is humid with a mean annual rainfall of 1,120 mm and air temperature of 16 °C. Due to the bimodal rainfall pattern, the area has two cropping seasons where the shorter rainy season is between April and May and the main rainy season is from July to September [16]. 2.2 Sampling Site Selection and Design The Lake Maybar watershed was classified into different slope categories based on the FAO system of classification [17] using a DEM (digital elevation model). The area was classified as flat to very gently sloping (< 3%), gently sloping (3%-5%), sloping (5%-8%), strongly sloping (8%-15%), moderately steep (15%-30%), and steep to extremely steep (> 30%) slopes. The research station (MSCRS) constructed terraces, established fixed plots on slopes

Fig. 1 Location maps: a) Ethiopia in Africa, b) Wello in Ethiopia, c) Maybar in Wello and d) Sampling plots in Maybar watershed.

Performance of Farmland Terraces in Maintaining Soil Fertility: A Case of Lake Maybar Watershed in Wello, Northern Highlands of Ethiopia

below 30%, and has been monitoring yields of selected crop. Terracing was omitted on less than 3% slope land as this shows little erosion [18]. Accordingly, plots were grouped into four, i.e., 3%-5%, 5%-8%, 8%-15%, and 15%-30 % and a total of 16 sampling plots were identified with each slope category represented by four plots. Three sampling positions (Fig. 2) were selected on the terraces of plots, i.e., low-terrace (A), mid-terrace (B), and up-terrace (C). The location of the sampling points was as follows: (A) low-terrace position refers to the location 50 cm in upslope of the terrace riser, (B) mid-terrace position is the middle point between two successive terraces, and (C) up-terrace position refers to the location 50 cm below the lower wall of the upper terrace. The 50 cm distance from both the lower and upper terrace wall was chosen to reduce the effect of water accumulation and splash by the overtopping water, respectively. 2.3 Soil Sampling, Analysis and Reference Data Following identification of sampling plots, composite samples were collected along the terraces at 50 cm distance from the respective terraces positions to 20 cm depth using an auger. The samples were thoroughly mixed and composited for laboratory analysis. Core ring samples were collected for bulk density determination. A total of 48 samples were collected. In order to check the soil depth, auguring was continued to 120 cm depth at the center of the

1253

sampling plot unless restricted by lithic contact. Information concerning other management practices such as fertilizer and manure use and crop residue management was obtained from the seasonal monitoring records of the research station. The composite soil samples were air dried, crushed and sieved through a 2-mm mesh. Soil texture, pH, EC (electrical conductivity), OC (organic carbon), av. P (available phosphorus), TN (total nitrogen), CEC (cation exchange capacity), and exchangeable bases, i.e., Ca2+ (exchangeable calcium), Mg2+ (magnesium), K+ (potassium), and Na+ (sodium), were determined from the composite samples and bulk density from the core ring samples. Analysis was done using standard laboratory procedures. Accordingly, pH and EC were determined using glass electrode and particle-size distribution using hydrometer [19]. Exchangeable bases and CEC were determined by the ammonium acetate method at pH 7 [20], OC was determined by the Walkley and Black method [21] and TN by the Kjeldahl method [22]. Bulk density was determined by the Black method [22]. The Olsen method [23] was used to determine available P. The analysis was done at the National Soils Testing Laboratory in Addis Ababa, Ethiopia. The soil data were statistically tested by ANOVA (analysis of variance) in SPSS version 17. A general linear model (univariate) was employed taking physico-chemical properties as dependent variables and the slope of the land and positions within a terrace as fixed factors. Data from the MSCRS soil survey conducted before the terracing in 1983 were used as a baseline [15]. Out of the profile pits of the 1983 soil survey, those on the fixed plots were selected and grouped according to the study plan.

3. Results and Discussion 3.1 Biophysical Changes Due to Farmland Terracing Fig. 2 Terrace positions (A) low-terrace, (B) mid-terrace and (C) up-terrace.

The field observations revealed that most of the terraces have become bench terraces and grasses

1254

Performance of Farmland Terraces in Maintaining Soil Fertility: A Case of Lake Maybar Watershed in Wello, Northern Highlands of Ethiopia

growing on the terraces have stabilized the structures. Measurements to estimate the slope gradient between the edges of terraces (low- and up-terrace) indicated nearly level conditions. Regular sedimentation and maintenance resulted in the development of higher terraces on steeper slopes due to great relief differences within shorter distances. Terraces over 180 cm and as short as 40 cm were observed on the upper slope and lower slope positions, respectively (Fig. 3). As reported by other authors, the terrace height differences resulted in soil depth gradients across the slope of the land [14, 24]. Closely spaced and taller structures were constructed on the steep slopes, however, such structures could also be limited as the slope becomes very steep [14, 25, 26]. Soil depth gradients were also observed within a terrace, where a deeper soil profile was measured at the down-slope positions. Terracing also resulted in soil depth improvement as compared to the depths reported in 1983 survey. More than 80% of the augers drilled in this study revealed over 120 cm soil depth at low-terrace position and the remaining 20% a minimum of 80 cm depth, while in the 1983 survey soil depths of less than 120 cm were found in less than 50% of the profiles. Active gullies and stream banks (Figs. 4a and 4c) before the SWC were well stabilized and covered by vegetation at the study time (Figs.4b and 4d). There have also been marked terrain modifications

Fig. 3

and biophysical changes (Figs. 3 and 5). The presence of different-size (very fine to medium) gravels in the soil profile indicates erosion and deposition processes within the watershed. The gravel volume and diameter change with the general slope of the land reveal that erosion and deposition patterns vary across the landscape. Coarser material was found in terraces adjacent to river courses and on upslope positions, while fine-textured soils were found in the down-slope positions. 3.2 Soil Fertility Variation on Farmland Terraces Across the Terrain The results of the study revealed that different soil physico-chemical properties were significantly different with the slope of the terrain. The pH on the farmland terraces significantly decreased with increase in slope (Table 1). Soil pH is the first parameter to be considered in soil fertility evaluation, and this was nearly neutral with a mean pH [H2O] of 6.7. Comparisons showed that the terraces on the 3% to 8% slopes had statistically significantly higher pH than those on the 8%-30% slopes. However, the pH differences were too small (∆pH [H2O] ≈ 0.6) to cause impact on plant nutrition and heavy metals toxicity [27, 28]. Similarly, soils of the terraces on gentle slopes (3%-5%) had statistically significantly higher EC than those on the terraces on moderately steep (15%-30%) slope. However, the differences were very

(a) (b) Farmland terraces: (a) terraces developed to bench and (b) terrace heights across landscape.

Performance of Farmland Terraces in Maintaining Soil Fertility: A Case of Lake Maybar Watershed in Wello, Northern Highlands of Ethiopia

(a)

1255

(b)

(c) (d) Fig. 4 Gullies and stream bank before and after SWC in Lake Maybar watershed: (a) active gully (by MSCRS, 1983), (b) stabilized gully (June 2010), (c) hysterical stream bank (by MSCRS, 1983) and (d) rehabilitated stream bank (June 2010). Table 1

Average soil properties in 0-20 cm depth on terraces across slope of the terrain.

Slope (%)

pH (H2O)

EC (ds/m)

TN (%)

OC (%)

P av. (ppm)

3 to 5 5 to 8 8 to 15 15 to 30 F-value

7.0daa 6.9aa 6.4d 6.5 22.50***

0.10bdb 0.07dd 0.08d 0.07 4.62**

0.18 0.18 0.18 0.21 1.30ns

1.45ddb 1.42db 1.47b 1.97 4.56**

15.2 10.4 6.8 16.1 2.04ns

Sand 19dbb 18bb 28d 27 6.94***

Particles size (%) Silt Clay 36bdd 45dbb 40cb 42dd d 36 36d 36 37 4.53** 5.18**

Exchangeable bases (cmol(+)/kg) Na+ K+ Ca2+ Mg2+ dbd dcb ddd 3 to 5 1.35 42.5 0.40 0.54 24.2 5.12 5 to 8 1.33 43.3bd 0.36dd 0.69bb 23.7 5.53 8 to 15 1.32 46.8b 0.24d 0.36d 24.7 5.50 15 to 30 1.41 42.3 0.22 0.38 22.8 4.90 F-value 0.39ns 5.81** 3.43** 6.52*** 1.66ns 1.04ns The superscripted letters (a, b, c, d) of columns indicate that physico-chemical soil properties of a given slope range and terraces positions are different (a) at α = 0.01, (b) at α = 0.05, (c) at α = 0.1 and (d) non-significant from the subsequent slope ranges at P