Journal of Biotechnology 150 (2010) 428–437

Contents lists available at ScienceDirect

Journal of Biotechnology journal homepage: www.elsevier.com/locate/jbiotec

Discovery of a steroid 11␣-hydroxylase from Rhizopus oryzae and its biotechnological application ˇ snar a,∗ ˇ Petriˇc a , T. Hakki b , R. Bernhardt b , D. Zˇ igon c , B. Creˇ S. a b c

Institute of Biochemistry, Faculty of Medicine, University of Ljubljana, Ljubljana, Slovenia Department of Biochemistry, Saarland University, Saarbruecken, Germany J. Stefan Institute, Ljubljana, Slovenia

a r t i c l e

i n f o

Article history: Received 19 March 2010 Received in revised form 18 August 2010 Accepted 5 September 2010

Keywords: Rhizopus oryzae Cytochromes P450 Corticosteroids 11␣-Steroid hydroxylation Schizosaccharomyces pombe Heterologus expression

a b s t r a c t To overcome the chemically laborious stereo- and regioselective hydroxylation steps in the pharmaceutical production of corticosteroids and progestogens, certain fungal species, e.g. Rhizopus spp. and Aspergillus spp., are employed to perform the 11␣-hydroxylation of the steroid skeleton, thereby significantly simplifying steroid drug production. Here we report for the first time the identification and expression of a fungal 11␣-steroid hydroxylase, CYP509C12. The newly identified cytochrome P450, which is one of the 48 putative CYP genes in Rhizopus oryzae, was induced in the fungus by progesterone. By functionally expressing CYP509C12 in recombinant fission yeast, we were able to determine that its substrate spectrum includes progesterone as well as testosterone, 11-deoxycorticosterone, and 11-deoxycortisol, with the hydroxylations taking place predominantly at 11␣ and 6␤ positions of the steroid ring system. To increase the 11␣-hydroxylation activity of CYP509C12 in recombinant fission yeast, its natural redox partner, the R. oryzae NAD(P)H-dependent reductase, was coexpressed. The coexpression improved electron transfer to CYP509C12 and thus an increase in productivity from 246 to 300 ␮M hydroxyPg d−1 was observed, as well as a 7-fold increase of rate of hydroxyprogesterone formation within the linear phase of transformation. This newly developed strain displayed total bioconversion of progesterone into 11␣-hydroxyprogesterone and small amounts of 6␤-hydroxyprogesterone within the first 6 h of incubation with progesterone as substrate, hence demonstrating its potential for biotechnological application. © 2010 Elsevier B.V. All rights reserved.

1. Introduction The 11␣-hydroxylation of progesterone performed by Rhizopus spp. and Aspergillus spp. and the 11␤-hydroxylation catalyzed by Curvularia spp. and Cunninghamella spp. are commonly used reactions in the steroid industry. It has been reported for several species of filamentous fungi including Phycomyces bakesleeanus, Cochliobolus lunatus, Cunninghamella elegans, Aspergillus fumigatus, A. ochraceus, Rhizopus nigricans, and Penicillium raistrickii that the hydroxylations of the steroid skeleton structure are catalyzed by a family of enzymes, the cytochromes P450 (CYPs) (Ahmed et al., 1995; Breskvar and Hudnik-Plevnik, 1981; Dlugonski et al., 1991; Irrgang et al., 1997; Samanta and Ghosh, 1987; Smith et al., 1994).

Abbreviations: DOC, 11-deoxycorticosterone; hyroxyPg, hydroxyprogesterone; RSS, 11-deoxycortisol; DMSO, dimethylsulfoxide; HPLC, high-performance liquid chromatography; LC–MS, liquid chromatography–mass spectrometry. ∗ Corresponding author at: Institute of Biochemistry, Faculty of Medicine, University of Ljubljana, Vrazov trg 2, SI-1000 Ljubljana, Slovenia. Tel.: +386 1 543 76 68; fax: +386 1 543 76 41. ˇ snar). E-mail address: [email protected] (B. Creˇ 0168-1656/$ – see front matter © 2010 Elsevier B.V. All rights reserved. doi:10.1016/j.jbiotec.2010.09.928

The steroid hydroxylation systems in fungi studied so far are typical eukaryotic two-component systems consisting of a NAD(P)H-cytochrome P450 reductase (CPR) and a cytochrome P450 monooxygenase which are localized in the membrane of the endoplasmic reticulum (reviewed in Hannemann et al., 2007), although cytochrome b5 as an alternate electron donor can also be involved. One of the most extensively studied fungal 11␣-steroid hydroxylation systems is that of the zygomycete fungus R. nigricans. The microsomal enzyme activity is substrate-inducible shortly after exposure of the fungus to steroids and is most likely its main defense mechanism against the toxic effects of steroids (Breskvar et al., 1995; Breskvar and Hudnik-Plevnik, 1981). One component of the system, the R. nigricans CPR, has been purified, characterized and its involvement in progesterone 11␣-hydroxylation confirmed (Makovec and Breskvar, 1998). However, in contrast to CPR, whose cDNA has also been functionally cloned (Kunic et al., 2001), the efforts to functionally characterize purified and/or cloned steroid monooxygenases of R. nigricans have so far been unsuccessful. In general, recombinant expression of steroid- and other CYPdependent hydroxylases and their redox partners in yeast is a highly promising approach for the biotechnological application

Sˇ . Petriˇc et al. / Journal of Biotechnology 150 (2010) 428–437

of these systems (Bernhardt, 2006; Dumas et al., 2006; Duport et al., 1998; Pompon et al., 1995; Ro et al., 2006; Sakaki et al., 2002; Szczebara et al., 2003). So far, a designer Saccharomyces cerevisiae strain containing several mammalian steroid hydroxylases has been developed which can produce hydrocortisone from glucose (Kelly and Kelly, 2003; Szczebara et al., 2003). The fission yeast (Schizosaccharomyces pombe) has also been used as a host microorganism in the bioconversion of 11-deoxycorticosterone to aldosterone and of 11-deoxycortisol to hydrocortisone involving human mitochondrial CYP11B2 and CYP11B1, respectively (Bureik et al., 2002; Dragan et al., 2005). The production of hydrocortisone in this recombinant fission yeast was considerably higher than in S. cerevisiae expressing bovine CYP11B1. Recently, the 11␤-hydroxylation of 11-deoxycortisol in fission yeast was further improved by coexpression of the natural redox partners of CYP11B1, adrenodoxin and its reductase (Hakki et al., 2008). The capability of mammalian CYPs to perform steroid hydroxylation, however, is limited to a few positions (Bernhardt and Waterman, 2007). Fungi, which possess CYPs that hydroxylate steroids at various positions, present a most interesting alternative for regio- and stereospecific steroid modification. The enzymatically catalyzed reactions can replace several separate chemical steps in the synthesis of natural hormones and steroidal drugs such as corticosteroids and progestogens (reviewed in Fernandes et al., 2003). Specifically, the 11␣-hydroxyl derivatives of steroids represent commercially important intermediates in the production of contraceptive drugs (Jekkel et al., 1998) and synthetic glucocorticoid steroids used as anti-inflammatory, immunosuppressive, and anti-allergic drugs (Fernandes et al., 2003; Mahato and Garai, 1997) by offering access to the otherwise inaccessible site of the steroid molecule, which can then be chemically converted to the active form (Hogg et al., 1955). Our aim was to identify amongst the repertoire of putative Rhizopus oryzae CYPs the 11␣-steroid hydroxylase. Based on CYP mRNA expression profiles after exposure of the fungus to progesterone, we cloned likely candidates and expressed them in fission yeast. The enzyme’s functional expression provided a suitable model for in vivo substrate analysis and product determination along with grounds to improve the system for its biotechnological application in the conversion of steroids to 11␣-hydroxysteroid derivatives.

429

tion of 0.1 g l−1 . 10 ml liquid pre-cultures were grown over night using Eppendorf centrifuge tubes. To obtain main cultures, 100 ml EMM in 250 ml Erlenmeyer flasks were inoculated with the whole volume of the pre-cultures. After approximately 18 h of growth, densities of log phase cells were determined using a haemocytometer and harvested by centrifugation at 4 ◦ C and 4000 × g for 5 min. All subsequent experiments were performed with cultures of 108 –5 × 108 cells ml−1 . 2.3. Protein sequence alignments and phylogenetic analyses Putative CYP sequences were manually annotated from the genome of R. oryzae. The genome sequence of R. oryzae (assembly 3) was downloaded from the Broad Institute Database (http://www.broad.mit.edu/annotation/genome/rhizopus oryzae/ MultiHome.html, 7.9.2009). To account for high variability of the primary sequences of CYPs, screening for putative R. oryzae CYP genes involved comparison of deduced amino acid sequences of all six reading frames to a collection of 956 CYP amino acid sequences from various organisms using blastall 2.2.12 (tblastn 2.2.12). These included 110 Fusarium graminearum, 289 Arabidopsis thaliana, 126 human, and 43 bacterial cytochromes P450, all obtained from Dr. Nelson’s Cytochrome P450 homepage (http://drnelson.utmem.edu/CytochromeP450.html, 4.5.2009). With the E value set at 10, 29,473 hits were generated and visualized on the R. oryzae genomic map, revealing 50 potential CYP loci. Further, a process of ORF identification was carried out on each locus, starting from the conserved heme-binding domain (GxxxCxG) and extending in both directions. Intron positions were predicted according to the conserved GT/AT splice junction sequence. The predicted 5 and 3 ends of genes, signified by Met or the stop codon, respectively, were verified by aligning them to CYPs deposited in GenBank. To improve the quality of the putative sequences, the process was repeated several times. The intron–exon boundaries as well as structural compliance to fungal clans were used to check the accuracy of the final alignments. Alignments were performed with Vector NTI Advance 9.1.0 (Invitrogen). The putative CYPs were grouped into families according to 40% amino acid sequence identity. Phylogenetic analyses and tree construction was conducted using MEGA version 3.1, generating a bootstrapped (N = 1000) neighbor-joining tree.

2. Materials and methods 2.1. General Chemicals were purchased from Sigma Aldrich unless otherwise indicated. Gene-specific primers, designed with Primer Express (Applied Biosystems), were obtained from Invitrogen. All sequencing was carried out by Sequiserve. 2.2. Strains and culture growth conditions The filamentous fungus R. oryzae strain RA 99-880, obtained from the FGSC (Fungal Genetics Stock Center, University of Missouri), was cultivated for 18 h at 28 ◦ C as described previously (Breskvar and Hudnik-Plevnik, 1977). Where required, the mycelium was exposed to 300 ␮M final concentration of progesterone dissolved in DMSO (Merck) or DMSO alone for up to 2 h. The cultivation of Schizosaccharomyces pombe strain 1445 (Andreadis et al., 1984), designated Spo in this work, has been described in (Moreno et al., 1991). Briefly, fission yeast (genotype h− ade6.M210 ura4.dl18 leu1.32 his3.1) was cultivated at 28 ◦ C and 180 rpm in Edinburg minimal medium (EMM) supplemented with leucine, histidine, uracil, and adenine at a final concentra-

2.4. RT-PCR and real time RT-PCR Total RNA was isolated from R. oryzae treated with progesterone for 20, 40 or 120 min and the mycelium exposed to DMSO alone as described previously (Breskvar et al., 1991). An aliquot of RNA (2 ␮g) was treated with DNAse I and reverse-transcribed with random hexamers using RevertAidTM H Minus First Strand cDNA Synthesis Kit (Fermentas) in a total volume of 20 ␮l following the manufacturer’s instructions. PCR amplification of putative CYP genes and the gene coding for CPR was carried out in a total volume of 50 ␮l using 1 ␮l of the reverse transcription reactions, 0.5 ␮l of Taq polymerase (Biotools) and 1 ␮l (10 ␮M) of gene specific primers (please see additional Table 1) under conditions as follows: denaturation (94 ◦ C, 3 min), 30 cycles consisting of denaturation (94 ◦ C, 30 s), annealing (60 ◦ C, 40 s), and extension (72 ◦ C, 40 s). The specificity of each primer pair was verified by sequencing of the amplified fragments. In addition, following the same procedure, the expression of two putative R. oryzae CPR genes, RoCPR1 and RoCPR2 was assessed in the non-treated and the 40 min progesterone-treated mycelium. Real time RT-PCR for putative CYP genes was performed on an ABI Prism 7500 Real Time System (Applied Biosystems). All

Sˇ . Petriˇc et al. / Journal of Biotechnology 150 (2010) 428–437

430 Table 1 A list of oligonucleotide primers used in this study. Target gene

RT PCR primers CYP5204A1 RO3G 00859.1 CYP5206A1 RO3G 00866.1 CYP5207A1 RO3G 01533.1 CYP5206A4 RO3G 01667.1 CYP5209A1 RO3G 03451.1 CYP5207B1 RO3G 04485.1 CYP509C12 RO3G 05077.1 CYP509B1 RO3G 05802.1 CYP5206A3 RO3G 06830.1 CYP5206A5 RO3G 06895.1 CYP509C11 RO3G 06942.1 CYP5207A2 RO3G 06941.1 CYP5206A2 RO3G 08351.1 CYP5211A1 RO3G 09819.1 CYP5213A1 RO3G 10623.1 CYP509C6 RO3G 10668.1 CYP509C3 RO3G 10670.1 CYP509C4 RO3G 10674.1 CYP509C1 RO3G 10680.1 CYP509C2 RO3G 10685.1 CYP509C5 RO3G 10705.1 CYP5207A3 RO3G 10904.1 CYP509C9 RO3G 11017.1 CYP5207A4 RO3G 11021.1 CYP5206A6 RO3G 11042.1 CYP509C8 RO3G 11042.1 CYP509C10 RO3G 12495.1 CYP5208A1 RO3G 15771.1 CYP5212A1 RO3G 16456.1 CYP5206A7 RO3G 16665.1 CYP5206A8 RO3G 16678.1 RoCPR2 RO3G 02475.3 RoCPR1 RO3G 14252.3 Real time PCR primers CYP5204A1 RO3G 00859.1 CYP5206A4 RO3G 01667.1 CYP509C12 RO3G 05077.1 CYP509B1 RO3G 05802.1 CYP5206A5 RO3G 06895.1 CYP5205A1 RO3G 10623.1 CYP509C10 RO3G 12495.1 CYP5208A1 RO3G 15771.1 CYP5204A10b RO3G 06941.1 RoSsb1 RO3G 01864.1 Primers for plasmid constructs CYP509C12 RO3G 05077.1 CYP509C10 RO3G 12495.1 CYP5204A1 RO3G 00859.1 RoCPR1 RO3G 14252.3 a b

Forward primer (5 -3 )

Locusa

Reverse primer (5 -3 )

Amplicon (bp) 201 643 532 410 183 411 479 260 414 557 584 373 552 201 201 425 222 391 499 672 620 577 270 393 865 397 347 210 369 266 475 2143 2157

2F1 3F1 4F1 5F1 6F1 9F1 12F 15F1 18F1 19F1 20aF 20bF1 23F1 25F1 28F1 29F 30F 31F 32F 33F 34F 35F1 36F 37F1 38F1 39F 42F 44F1 45F1 47F1 48F1 CPR2F CPR1F

GCCACCATGTCGCTCAATG GCTCTTCTTTCTTGTTATTATTTATTGAC CCGCCAGTGTAGATACAACTTCATTA GGAAAGCCTTATTGATGATGACGATG ACACTTTTGAAAGTACACTTACTGACAGAGCCAA CAAGAGCTAGGACCTATCTTTAGAATCAAGGTG CTTGGGTTATGATTCTGTTGGCTTGA CCTCAGTGGACCTGACTGGAAG GTTGGCTTGGATAGATATGTTTACAGGTG ATCTATTCGCATTAGGAAGTTGTCCATCT GTATCCAAAGTCGCATGACATGTTAAC GTGAGCAAAGGATCTATAAGTTCTGGC CATACAAGATGCTCTAAACAGAGAGGAGGT AGTACGCTCAAGGGCATCAAG AAGAGCAGCAAGAGGTCCTGAAG CCTAAATCACACTTTGGACTTGACG CATGCTAGTACCTCTAGCGCAG GTAGAATTGATACCCTTGGTGAGAAATA CTATATTTGACCCTATCTCCTATGTATTTT CGGCTATTGAAGAAGCAAATGGTAA CCTAAATCACACTATGGGCTTGACT TTTCGGATTAAGATGGGAGTACAGG CAAGACCATGGCTAGTGTTGTCAA ATTCAACTTGCCCGTCAGAGC TGGCAGCAACTCGCTTTGATGAC CCTTAGGAAAGAATAGCCCACTTTTTA CCCGTTTCTTCAGTTTATAGGTCTCA GAGTCTCCAAGTAGGACCTGTGTTTAC ACAAGTCGCCATGGATCCTGATT CCTATCACTATCGCTTTGTATTGGACCC TGCTATCCTCTCTCAACAGCCTAAAGTG GGAATTCCATATGATTCGCAATAATACACAAC ACAGTCGACATGACTCGAAACAACTCTC

2R1 3R1 4R1 5R1 6R1 9R1 12R 15R1 18R1 19R1 20aR 20bR1 23R1 25R1 28R1 29R 30R 31R 32R 33R 34R 35R1 36R 37R1 38R1 39R 42R 44R1 45R1 47R1 48R1 CPR2R CPR1R

CAAGTCGCCATGGAGTGTCTTC CCTATGTCTCCCGCTGCACCTA CCGTCCACTAAAATAGGCTCCAC GCTCTGGTATAAATTCATCTGGGTCTTT TTAGCGATTCTCCAATACAAAATGAAAGTGT ATCACACTAAAGTCCTCAGAGGGACTCG CTACCAAGTCTTTTTCATTTTCCGGTG GCATCACCGATTCATAATACTCTACCC GTCGCTGGACGAAATCGCATT CCAAGCTAAGCTGGGAAGATATGAACT CATTAGTTATTCCTTCACCTCTGCG GTTCAACATGCCGTTCCATTG CATCCAAAGCCCAAATGGTCTCG TGGCTGAAAAGGTGGTAAAAGAAC CATTTTCTCCTGGATGGACGATAG TTAAAGCCTTTTCTTTTTGTGGGATATG TTTGCGTGGTAATAACAAGTCAAGAAC GGATACACATAAACTAATAAGGGTTCTAAA GGTGTTAACAAGTCAAGAGGCATAC CTTCAGCTGTTTTACGGGGTAATAG CTATCATCTCCGGCCAAAAATAAAAG GACGGTAAAGAGGACGACTGCTG CATTCTCTTCGTTTAGGATAAACCC GGAGGCACTACCAATCAGCAGA GCTTGAGAATCCAACTCTGGTGCC GCAGCTTTTCTTCTTTTAGGCACG GCAGAGCACCCATTGAAGGG TGACGCCATCTAGGTCCATAAGTC ATGCGTGTGTATGCAGGGAAGAGATAA CGAGCCCTTAGCAACAAAGTAGCCT CGGTAAACTTGGAAAAGAAACGAACG GATGGATCCACTCCAAACATCTTCTTGGT GATGGATCCACTCCAAACATCTTCTTG

2F1 5F1 12F 15F1 19F2 28F1 42F2 44F2 20bF1 SSBF1

GCCACCATGTCGCTCAATG GGAAAGCCTTATTGATGATGACGATG CTTGGGTTATGATTCTGTTGGCTTGA CCTCAGTGGACCTGACTGGAAG TTCCCAGCTTAGCTTGGACTGATAC’ AAGAGCAGCAAGAGGTCCTGAAG GCAGAGAATAACGGAGAAGGATTACTC GATACGACTGCTTCTACGATAGAATGG GTGAGCAAAGGATCTATAAGTTCTGGC GATGCTGGTGTTATTGCTGGTCTC

2R1 5R1 12R 15R1 19R2 28R1 42R2 44R2 20bR1 SSBR1

CAAGTCGCCATGGAGTGTCTTC GCTCTGGTATAAATTCATCTGGGTCTTT CTACCAAGTCTTTTTCATTTTCCGGTG GCATCACCGATTCATAATACTCTACCC TTGGCTTGAACCTCAGGCATC CATTTTCTCCTGGATGGACGATAG GATAGCATACAGATCGATATTGGCAC TCTTCACTGGTAGCATGTGGTATAGC GTTCAACATGCCGTTCCATTG TCCTTCTTGTGCTTACGCTTGATT

P45012F P45042F P4502F CPR1Fb

AAGCTTATGATGGAAATAGCTGAATTTGCG CATATGGAATTGGTTCAATTCGTGGACAAATCTTAC CATATGACACATAATAAGTATTTGACATTATCTGCAG ACAGTCGACATGACTCGAAACAACTCTC

P45012R P45042R P4502R CPR1Rb

ATAACGCTTTTTGAATGTTAATTCAAGAGAATTAGG GGATCCATGCCTCTTTGTAAATTTCAATTTAAGTG GGATCCAATATCATCCTCTTTGTTACAAAATATTAAG GATGGATCCACTCCAAACATCTTCTTG

201 410 334 260 256 201 372 221 373 334 1581 1587 1494 2157

Corresponding locus names of genes assigned at the Broad Institute (http://www.broad.mit.edu/annotation/genome/rhizopus oryzae/MultiHome.html 7.9.2009). Restriction enzyme sites in primers are underlined.

experiments were carried out using 1/40 of the reverse transcription reaction and 600 nM gene specific primers (Table 1) with SYBR green PCR Master Mix (Applied Biosystems) according to instructions of manufacturer. Fluorescent signals of amplified CYP cDNAs were analyzed during each of 45 cycles consisting of denaturation (95 ◦ C, 10 s), annealing (55 ◦ C, 10 s) and extension (72 ◦ C, 12 s). Following amplification, a dissociation curve was performed on all PCR products to ensure their specificity. The relative quantity of cDNA was calculated with the standard curve method and calibrated with the R. oryzae housekeeping Rossb1 gene (Broad ref. RO3G 01864.1), a homologue of the Saccharomyces cerevisiae ribosome-associated Hsp70 (SSB1), whose expression is not affected by steroid treatment. The expression levels of each gene in the treated fungus were then normalized to those in the untreated control. The statistical significance of upor down-regulation was evaluated using Wilcoxon’s test with a P value = 0.031.

2.5. Construction of the cDNA library and amplification of cDNAs of the CYPs and CPR For the construction of the cDNA library, messenger RNA was prepared from total RNA of R. oryzae exposed to progesterone for 20 min by oligo(dT) column (Stratagene) and cDNA was synthesized using a ZAP Express cDNA Synthesis kit (Stratagene). The library was constructed in the ZAP ExpressTM expression vector (Stratagene). All procedures were performed according to the instructions of manufacturer. Full length cDNAs of CYP509C10, CYP509C12 (Fig. 3A), and the steroid inducible RoCPR1 (Fig. 5A) were amplified in total volumes of 50 ␮l using 1 ␮l of cDNA library, 1 ␮g of 10 ␮M gene specific primers (Table 1) and 0.25 ␮l of Phusion Hot Start DNA polymerase (Finnzymes) under the following conditions: denaturation (98 ◦ C, 1 min) and 35 cycles consisting of denaturation (98 ◦ C, 10 s), annealing (60 ◦ C, 35 s), and extension (72 ◦ C, 75 s).

Sˇ . Petriˇc et al. / Journal of Biotechnology 150 (2010) 428–437

2.6. Heterologus expression of CYPs in fission yeast The cDNAs of CYP509C10 and CYP509C12 were cloned into pNMT1-TOPO (Invitrogen) C-terminal hexahistidine tag expression vector under the control of the thiamine-repressible nmt1 promoter to produce vectors pNMT1C10 and pNMT1C12, respectively. The electrocompetent cells of E. coli strain Top10 (Invitrogen) were transformed with the vectors, cultivated in Luria-Bertani medium over night at 37 ◦ C, and the plasmids were purified. Plasmid constructs were verified by sequencing and used for fission yeast transformation by the lithium acetate method (Ito et al., 1983). During transformation the nmt1 promoter was repressed by 5 ␮M thiamine. Fission yeast strains containing vectors pNMT1C10 and pNMT1C12 were designated as SpoC10 and SpoC12, respectively. Constitutive gene expression was achieved by cultivating fission yeast in the absence of the promoter repressor as described in Section 2.2. 2.7. Immunodetection assay To detect CYP509C10, CYP509C12, and RoCPR1 and estimate their molecular weight a total amount of 109 cells of fission yeast strains Spo, SpoC10, SpoC12, and SpoC12R (see Section 2.8), respectively, were washed twice with 50 ml of water and suspended in 500 ␮l of 20 mM Tris/Cl (pH 7.5) buffer containing 5 mM MgCl2 , 2 mM EDTA, 0.1% (wt/vol) Triton x-100, 1 mM DTT, 1 mM PMSF, and 10 ␮g/ml of each of proteinase inhibitors (antipaine, pepstatine, leupeptine, chimotrypsine) as well as 10 ␮l of protease inhibitor cocktail for use with fungal and yeast extracts. The cells were then broken by vortexing with glass beads for 3 min. The suspension was centrifuged at 4 ◦ C and 13,500 × g for 10 min and protein concentration of the resulting supernatant was determined by the Bradford method (Bradford, 1976) with Nanoquant reagent (Roth) and bovine serum albumin as a standard. 30 ␮g of whole cell lysate proteins were separated by 10% SDS polyacrylamide gel electrophoresis (Laemmli, 1970) and electro-blotted onto Hybond+ nitrocellulose membranes (Amersham Bioscience). Prior to detection, the membranes were reversibly stained with Ponceau and scanned. Detection of CYP509C10 and CYP509C12 was performed using primary antibodies against the hexahistidine tag (Santa Cruz Biotechnology, 1:1000 dilution), horseradish peroxidase-conjugated secondary antibodies (Santa Cruz Biotechnology, 1:20,000 dilution) and chemiluminescent (SuperSignal West Pico, Pierce) exposure of BioMax film (Kodak). Detection of RoCPR1 was carried out using primary antibodies against the Pk epitope tag (Abcam, 1:10,000 dilution) and horseradish peroxidase-conjugated secondary antibodies (Abcam, 1:50,000 dilution). The chemiluminescent signal (SuperSignal West Pico, Pierce) was captured by a luminescent image analyzer (LAS-4000, Fujifilm) and the image was analyzed by Multi Gauge ver. 3.2 (Fujifilm). The amounts of expressed CYP509C12, CYP509C10, and RoCPR1 proteins were estimated semi-quantitatively by densitometric measurements of immunoreactive band area in proportion to the densities of the whole cell lysate proteins on the same blot, which were visualized by Ponceau staining prior to Western blot analysis. The resulting ratio (xtp ) represented mg of immunoreactive protein per g of total cell lysate protein. The estimation of CYP509C12 protein concentration in SpoC12 and SpoC12R cultures used in biotransformation experiments was calculated as follows: cCYP =

xtp × Cprot × cS.pombe MCYP

,

where cprot represented average protein content in fission yeast (10 pg cell−1 , Paul Nurse Lab Fission Yeast Handbook,

431

http://www.sanfordburnham.org/labs/wolf/Protocols/Protocols. html, 12.8.2010), cS. pombe concentration of fission yeast cells (108 cells ml−1 ), and MCYP calculated molecular weight of CYP509C12 (60,173 g mole−1 ). 2.8. Coexpression of CYP509C12 and RoCPR1 The cDNA of RoCPR1 was cloned into SalI/BamHI restriction sites of pREP42PkC expression vector (Craven et al., 1998). In the resulting construct (pREP42R) the RoCPR1 cDNA was under the control of the nmt1 promoter and tagged with a sequence coding for the Pk epitope tag. Subsequent procedures, yielding strain SpoC12R as well as achieving gene expression, were performed as described in Section 2.6. 2.9. Steroid biotransformation assays 2.9.1. Biotransformation conditions and steroid extract preparation Fission yeast strains Spo, SpoC10, SpoC12 and SpoC12R, grown as described in Section 2.2, were washed once with EMM, centrifuged at 4000 × g and 4 ◦ C for 5 min and suspended in 10 ml of fresh medium to a final density of 108 cells ml−1 . Steroids progesterone, testosterone, DOC, or RSS were added to 300 ␮M final concentration and the cultures were incubated in 100 ml Erlenmeyer flasks at 28 ◦ C and 180 rpm for up to 48 h. After 24 h 500 ␮l culture samples of each fission yeast strain were taken and the steroids were immediately extracted twice with the same volume of chloroform (Merck), evaporated, solved in acetonitrile, and analyzed by HPLC. The same approach was used when biotransformation after different time periods (1, 2, 4, 6, 12, 24 and 48 h) was followed in SpoC12 and SpoC12R. The steroid extracts from 5 ml of SpoC12 cultures exposed to steroids for 24 h were also prepared as above and analyzed by LC–MS. 2.9.2. HPLC measurements Reverse phase HPLC using an isocratic solvent system of acetonitrile:H2 O 60:40 (v/v) as mobile phase, flow rate 1 ml min−1 , was carried out on a WellChrom system (Knauer, Berlin, Germany) equipped with a C18 ODS Hypersil 250 × 4.6 mm, 5 ␮m column (Thermo, USA). Steroids were detected at 240 nm. Steroid standards were used to identify the peaks on HPLC and to construct calibration curves (please see additional material for online publication). Hydroxyprogesterone production in fission yeast strains was evaluated as biotransformation yield, which was calculated as the ratio between the peak area (A) (mV min) of the chromatogram between hydroxylated products and progesterone: Yield =

A(hydroxyPg) × 100. A(Pg) + A(hydroxyPg)

The productivity was defined as the molar concentration of progesterone converted to hydroxylated products within 24 h (␮M hydroxyPg d−1 ). The specific activity was defined as micromoles of progesterone which were converted to hydroxylated products by 1 micromole of CYP509C12 per day (␮M hydroxyPg ␮M CYP−1 d−1 ). 2.9.3. LC–MS measurements Mass measurements were run on a hybrid quadruple time of flight mass spectrometer (Q-TOF) provided with an orthogonal Z-spray ESI interface (Waters Micromass, Manchester, UK). Mass spectrometer was interfaced to an ultra performance liquid chromatography (UPLC) system based on a Waters Acquity (Waters, Milford, USA) binary pump with a BEH C-18 column (1.7 ␮m, 50 mm × 2.1 mm i.d.). The mobile phases consisted of water and acetonitrile with mixture of 0.1% of formic acid in water. The

Sˇ . Petriˇc et al. / Journal of Biotechnology 150 (2010) 428–437

432

Table 2 List of manually annotated CYP genes and pseudo-genes of R. oryzae. Pseudo-genes are shown in bold. #

Internal reference

Nomenclature

BROAD reference

#

Internal reference

Nomenclature

BROAD reference

01. 02. 03. 04. 05. 06. 07. 08. 09. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23.

P450-1 P450-2 P450-3 P450-4 P450-5 P450-6 P450-7 P450-8 P450-9 P450-10 P450-11 P450-12 P450-13 P450-14 P450-15 P450-16 P450-17 P450-18 P450-19 P450-20a P450-20b P450-21 P450-22

CYP5210A1 CYP5204A1 CYP5206A1 CYP5207A1 CYP5206A4 CYP5209A1 CYP509C7P CYP61A9 CYP5207B1 CYP61A1 CYP5210A2 CYP509C12 CYP5210A3 CYP5210A4 CYP509B1 CYP5203A1 CYP5203A2 CYP5206A3 CYP5206A5 CYP509C11 CYP5207A2 CYP5203A4 CYP509C13P

26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. 37. 38. 39. 40. 41. 42. 43. 44. 45. 46. 47. 48.

P450-26 P450-27 P450-28 P450-29 P450-30 P450-31 P450-32 P450-33 P450-34 P450-35 P450-36 P450-37 P450-38 P450-39 P450-40 P450-41 P450-42 P450-43 P450-44 P450-45 P450-46 P450-47 P450-48

CYP5210A5 CYP5205A1 CYP5213A1 CYP509C6 CYP509C3 CYP509C4 CYP509C1 CYP509C2 CYP509C5 CYP5207A3 CYP509C9 CYP5207A4 CYP5206A6 CYP509C8 CYP51F1 CYP5203A3 CYP509C10 CYP5203A5 CYP5208A1 CYP5212A1 CYP51F5 CYP5206A7 CYP5206A8

RO3G RO3G RO3G RO3G RO3G RO3G RO3G RO3G RO3G RO3G RO3G RO3G RO3G RO3G RO3G RO3G RO3G RO3G RO3G RO3G RO3G RO3G RO3G

24. 25.

P450-23 P450-25

CYP5206A2 CYP5211A1

RO3G 00211.1 RO3G 00859.1 RO3G 00866.1 RO3G 01533.1 RO3G 01667.1 RO3G 03451.1 RO3G 04442.1 RO3G 04483.1 RO3G 04485.1 RO3G 04913.1 RO3G 04957.1 RO3G 05077.1 RO3G 05134.1 RO3G 05127.1 RO3G 05802.1 RO3G 06009.1 RO3G 06495.1 RO3G 06830.1 RO3G 06895.1 RO3G 06942.1 RO3G 06941.1 RO3G 07774.1 Supercontig 5: 3044201-3044414 RO3G 08351.1 RO3G 09819.1

49. 50.

P450-49 P450-50

CYP61A8 CYP5205A2

RO3G 16941.1 RO3G 17132.1

nebulizer gas flow rate was set to approximately 20 l h−1 and the desolvation gas flow rate to 600 l h−1 . The mass resolution of approximately 9500 was used for determination of elemental composition with TOF mass spectrometer. MS were acquired in centroid mode over an m/z range of 50–1000 in scan time 0.25 s and inter scan time 0.05 s. The data station operating software was Mass Lynx v 4.1 (Micromass, Manchester). The peak area of a specific steroid at each time point was assessed relative to the total area of identified steroid peaks, as described in Section 2.9.2. 3. Results and discussion 3.1. The CYPs of R. oryzae From the CYP signature sequence-containing loci identified in the genome of R. oryzae, we manually annotated 48 putative CYP genes and two pseudogenes (Table 2). In all but one CYP gene the reading frames were interrupted with up to nine introns. Compared to other fungi, whose CYPome sizes range from two CYPs found in fission yeast to several tens in dimorphic fungi and over 100 found in filamentous ascomycete and basidiomycete fungi, the R. oryzae CYP repertoire is moderately diversified. The phylogenetic analysis using the primary amino acid sequence identity criterion revealed that R. oryzae CYPs group into 14 CYP families, 2 with a conserved role in fungal endogenous metabolism (i.e. CYP51 and CYP61) and 12 consisting of orphan CYPs. The families belong to 7 clusters of cross-species CYP families, i.e. clans (Fig. 1). Clan-based classification of R. oryzae CYP families show that 13 of them group into 7 previously identified fungal clans, whereas family CYP5209A1 only shows some relation to clan CYP64. 3.2. Expression of CYPs after exposure of R. oryzae to progesterone To identify amongst the putative R. oryzae CYPs the ones involved in the 11␣-hydroxylation of steroids, we performed an extensive expression analysis, a strategy similar to what has been used in Arabidopsis thaliana to predict the function of orphan CYP genes (Xu et al., 2001). A total of 31 putative genes encoding CYPs

10122.1 10498.1 10623.1 10668.1 10670.1 10674.1 10680.1 10685.1 10705.1 10904.1 11017.1 11021.1 11042.1 11042.1 11790.1 12103.1 12495.1 14322.1 15771.1 16456.1 16595.1 16665.1 16678.1

of clans CYP64 (families CYP5206, CYP5207, CYP5208, CYP5209), CYP56 (families CYP509, CYP5212), and CYP54 (families CYP5204, CYP52013) were tested for their expression in the fungus exposed to progesterone. RT-PCR demonstrated that the transcripts of two genes (CYP509C12 and CYP509C10) were expressed solely after exposure of the fungus to progesterone whereas the other seven expressed genes were detected in the control fungal mycelium as well (Fig. 2A). Further examination of expression profiles of these nine genes using real time RT-PCR showed that three of the genes (CYP5207A2, CYP5206A5, and CYP5206A4) appeared to be down-regulated during treatment of the fungus with progesterone and CYP509B1 displayed late induction after 120 min. The remaining five genes (CYP5208A1, CYP5213A1, CYP5204A1, CYP509C12, and CYP509C10) were up-regulated by progesterone within 20 min, albeit at different extent. The transcript amount of three of them (CYP5204A1, CYP509C12, CYP509C10) was increased at least 32-fold compared to the control (Fig. 2B). The results were consistent with previously published observations showing different metabolic pathways involving CYPs could either decline or increase during stress (Doddapaneni and Yadav, 2005). High levels of CYP509C12 and CYP509C10 transcripts were present in R. oryzae only after exposure to progesterone, similarly to what has been shown for the R. nigricans CPR involved in steroid hydroxylation (Kunic et al., 2001). Several data of substrate induction of fungal CYPs and their reductase activities have been reported, albeit coregulation of the enzymes is not a general feature in fungi (reviewed in Brink et al., 1998). 3.3. Comparison of CYP509C12 and CYP509C10 Primary structure analysis of R. oryzae CYP509C12 (526 amino acids) and CYP509C10 (526 amino acids) showed high amino acid identity (58%). The sequences included conserved eukaryotic CYP regions: a K-helix region with the conserved ExxR sequence, an I-helix region with the amino acid consensus sequence (A/G)Gx(D/E)T(T/S), an aromatic domain with the PERF sequence located 50 amino acids downstream of the K-helix, and the heme binding domain with the sequence (PFGNGARQCxG) at the C-terminal end of the enzymes (Fig. 3A).

Sˇ . Petriˇc et al. / Journal of Biotechnology 150 (2010) 428–437

433

Fig. 1. Phylogenetic tree of 48 putative cytochromes P450s from R. oryzae. The bootstrapped (N = 1000) neighbor-joining tree was compiled using MEGA version 3.1. Clans are marked by brackets and the fungal genes analyzed for expression in the presence of progesterone are presented in grey boxes.

434

Sˇ . Petriˇc et al. / Journal of Biotechnology 150 (2010) 428–437

Fig. 2. Expression profiles of selected putative CYP genes of R. oryzae exposed to progesterone. (A) RT-PCR for CYP transcript determination at various time points. (B) The relative amounts of CYP mRNAs determined by real time RT-PCR. Error bars represent standard deviation of 6 independent experiments. The asterisks indicate a significant difference in expression of CYPs compared to the control. C, fungal cultures not exposed to progesterone, gDNA, genomic DNA and Rossb1, housekeeping gene of R. oryzae, a homologue of S. cerevisiae ribosome-associated Hsp70 (SSB1).

3.4. Expression of CYP509C12 and CYP509C10 in fission yeast For the heterologus expression of the enzymes in fission yeast, the full length cDNA of either CYP509C12 (1581 bp) or CYP509C10 (1587 bp), amplified from the cDNA library of R. oryzae exposed to

progesterone, was cloned into the pNMT1-TOPO expression vector and transformed into fission yeast, producing strains SpoC12 and SpoC10, respectively. After cultivation of the parental and recombinant fission yeast under conditions ensuring constitutive expression of heterologus proteins, whole cell protein lysates were

Fig. 3. Characterization of R. oryzae CYP509C10 and CYP509C12. (A) Comparison of CYP primary structures. Boxes indicate conserved regions of CYPs. Conserved amino acid sequences of each region are underlined. The identical amino acids are indicated by asterisks and similar by colons and dots. (B) Heterologus expression of fungal CYP genes in fission yeast. Western blot analysis was performed on whole cell lysate protein samples (30 ␮g). M, molecular weight markers, Spo, parental fission yeast strain, SpoC12, SpoC10 fission yeast strains expressing CYP509C12 and CYP509C10, respectively.

Sˇ . Petriˇc et al. / Journal of Biotechnology 150 (2010) 428–437

435

Fig. 4. Bioconversion of steroids with strains SpoC12 and SpoC12R. (A) The general structure of steroids used in this study. (B) HPLC analysis of hydroxyprogesterone production in strains cultures exposed to 300 ␮M initial concentration of substrate for 24 h. Pg, progesterone, 11␣Pg, 11␣-hydroxyprogesterone, 6␤Pg, 6␤-hydroxyprogesterone, Spo, parental fission yeast strain, SpoC12, fission yeast strain expressing CYP509C12, SpoC12R, fission yeast strain coexpressing CYP509C12 and RoCPR1. (C) LC–MS analyses of steroid conversions after 24 h of strain SpoC12 culture exposed to 300 ␮M initial concentration of steroid substrates. Data shown are mean values of four independent experiments. nd, not detected and ni, not identified monohydroxylated steroids.

prepared. The expression of recombinant C-terminal hexahistidine tagged CYP509C12 and CYP509C10 was verified by Western blot analysis using polyclonal rabbit anti-His6 antibodies. The molecular weight of both expressed R. oryzae enzymes of approximately 60 kDa corresponded to their predicted molecular weight (Fig. 3B). The expression levels of CYP509C12 and CYP509C10 were approximately 0.2 and 0.13 nmol mg−1 of total cell lysate proteins, respectively, as estimated by densitometric measurements of the Western blot. 3.5. Biotransformation of steroids by fission yeast cultures The steroid biotransformation activities of parental fission yeast, SpoC10, and SpoC12 were investigated after 24 h incubation with

progesterone as the substrate. HPLC analyses of the steroid extracts showed that progesterone was hydroxylated by SpoC12 (Fig. 4A and B), while the reaction was not accomplished neither by strain SpoC10 (data not shown) nor the parental strain (Fig. 4B). Without the presence of its native redox partner, electrons were evidently delivered from NAD(P)H to CYP509C12 by the host fission yeast NAD(P)H cytochrome P450 reductase (Yamazaki et al., 1993), although cytochrome b5 could also have been involved (Schenkman and Jansson, 2003). Strain SpoC12 was further investigated for its capability to transform several other steroids, which were also substrates of inducible hydroxylation enzyme(s) in fungus R. oryzae (data not shown). The extracted steroids were analyzed by LC–MS. Fig. 4C shows that SpoC12 was capable of hydroxylating progesterone, testosterone, DOC, and RSS. The effi-

Fig. 5. Characterization of R. oryzae RoCPR1. (A) RoCPR1 amino acid sequence. The three underlined regions (in order from the N to C terminus) represent the flavodoxin-like, FAD binding, and NAD(P)H binding domains. (B) RoCPR1 transcript amounts determined by RT-PCR. gDNA, genomic DNA, C, fungal cultures not exposed to 300 ␮M initial concentration of progesterone, 40 , fungal cultures exposed to progesterone for 40 min, RoCPR2, the second CPR gene of R. oryzae, Rossb1, housekeeping gene of R. oryzae, a homologue of S. cerevisiae ribosome-associated Hsp70 (SSB1). (C) Heterologus expression of RoCPR1 in fission yeast. Western blot analysis was performed on whole cell lysate protein samples (30 ␮g). M, molecular weight markers, Spo, parental fission yeast strain, SpoC12, fission yeast strain expressing CYP509C12, SpoC12R, fission yeast strain coexpressing CYP509C12 and RoCPR1.

436

Sˇ . Petriˇc et al. / Journal of Biotechnology 150 (2010) 428–437

ciency of total steroid hydroxylation, the distribution between 11␣- and 6␤-hydroxylated derivatives, and the appearance of nonidentified monohydroxysteroids depended on the substrate. The most efficiently hydroxylated substrate was DOC (96%) followed by testosterone (73%) and progesterone (61%). The hydroxylation of RSS was less efficient (30%). In contrast to progesterone and RSS, which were only hydroxylated into 11␣- and 6␤-hydroxyl derivatives, the hydroxylation of testosterone and DOC also resulted in production of so far non-identified monohydroxysteroids as shown by LC–MS. 3.6. Improvement of hydroxylation rate in fission yeast Since it has been demonstrated that the electron transfer to the cytochrome P450 can be rate limiting in various P450 systems (Bernhardt, 2006; Grinberg et al., 2000; Hannemann et al., 2007), we attempted to improve the rate of hydroxylation in fission yeast strain SpoC12 by coexpressing CYP509C12 natural redox partner. The cDNA of progesterone-inducible R. oryzae RoCPR1 with the full length of 2142 bp (Fig. 5A), was amplified from the cDNA library (Fig. 5B), cloned into the pREP42PkC expression vector and transformed into strain SpoC12. Verification of RoCPR1 expression in the resulting recombinant strain SpoC12R was performed by Western blot analysis using antibodies against Pk epitope tag. The molecular weight of RoCPR1 of approximately 80 kDa was in agreement with its predicted molecular weight (Fig. 5C). The expression levels of RoCPR1 and CYP509C12 in the strain SpoC12R, as estimated by Western blot analysis, were estimated at 0.24 and 0.19 nmol mg−1 of total cell lysate proteins, respectively, resulting in a RoCPR1:CYP509C12 ratio of approximately 1:3:1. The strain SpoC12R was compared with strain SpoC12 for progesterone hydroxylation activity. As shown in Fig. 6A, both strains presented a steady increase in hydroxylated products, resulting in a productivity of 246 and 300 ␮M hydroxyPg d−1 for strains SpoC12 and SpoC12R, respectively. A 20% improvement of the yield after 24 h was achieved in SpoC12R compared to SpoC12 (Fig. 6B). More significantly, as can be seen from the slope of the time course of hydroxylated product formation, a 7-fold improve-

ment in bioconversion rate was observed in the linear phase of the biotransformation process. After the first hour of transformation, the conversion rates were 84 ␮M hydroxyPg h−1 in strain SpoC12R compared to 12 ␮M hydroxyPg h−1 in strain SpoC12. Based on semi-quantitative estimation of CYP509C12 protein concentration in fission yeast cultures, which was approximately 0.2 ␮M CYP in both strains, specific biotransformation activities were calculated. The specific activity of strain SpoC12 was 12.3 ␮M hydroxyPg ␮M CYP−1 d−1 , while this parameter was 14.8 ␮M hydroxyPg ␮M CYP−1 d−1 in SpoC12R. Evidently, the increased productivity of strain SpoC12R was due to the coexpression of RoCPR1 rather than increased levels of CYP509C12 expression in fission yeast cells. 4. Conclusion Out of the 48 putative cytochrome P450 genes of the fungus R. oryzae, 3 were inducible by progesterone and one of them performed progesterone hydroxylation to yield 11␣hydroxyprogesterone when expressed in fission yeast. The fission yeast host was able to transfer electrons to the fungal CYP and reconstitute its functionality. Further, by coexpressing the 11␣hydroxylase and its natural redox partner we produced a fission yeast strain with improved productivity, which completely converted 300 ␮M progesterone substrate to hydroxylated products within 6 h. Also, the conversion rate in the linear phase of progesterone transformation was 7-fold higher in the improved strain. To our knowledge, this is the first report of the heterologus expression of an industrially relevant fungal hydroxylase system in fission yeast. The applied procedure of cloning inducible CYPs and expressing them together with their corresponding reductase in fission yeast can lead to the development of other recombinant host strains that can carry out efficient bioconversions on a commercial scale. Acknowledgements We thank Dr. D. Nelson of the University of Tennessee, Memphis, for his contribution to CYP nomenclature and clan assignation, and Savica Soldat for technical support. This work was supported in part by the Slovenian Research Agency, by the Fonds der Chemischen Industrie (to R.B.) and a DAAD Scholarship Grant (to S.P.). Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.jbiotec.2010.09.928. References

Fig. 6. Bioconversion of progesterone to mono-hydroxylated derivatives. (A) Time dependant hydroxyprogesterone production determined by HPLC. Results are means of six replicate measurements and error bars indicate standard error. At certain time points, the standard error was too small to be shown. (B) Comparison of biotransformation parameters of strains SpoC12 and SpoC12R.

Ahmed, F., Williams, R.A., Smith, K.E., 1995. Microbial transformation of steroids—IX. Purification of progesterone hydroxylase cytochrome P-450 from Phycomyces blakesleeanus. J. Steroid Biochem. Mol. Biol. 52, 203–208. Andreadis, A., Hsu, Y.P., Hermodson, M., 1984. Yeast LEU2. Repression of mRNA levels by leucine and primary structure of the gene product. J. Biol. Chem. 259, 8059–8062. Bernhardt, R., 2006. Cytochromes P450 as versatile biocatalysts. J. Biotechnol. 124, 128–145. Bernhardt, R., Waterman, M.R., 2007. The ubiquitous roles of cytochrome P450 proteins. In: Sigel, A., Sigel, H., Sigel, R.K.O. (Eds.), Cytochrome P450 and Steroid Hormone Synthesis. John Wiley & Sons, New York, pp. 361–396. Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248–254. Breskvar, K., Cresnar, B., Plaper, A., Hudnik-Plevnik, T., 1991. Localization of the gene encoding steroid hydroxylase cytochrome P-450 from Rhizopus nigricans inside a HindIII fragment of genomic DNA. Biochem. Biophys. Res. Commun. 178, 1078–1083. Breskvar, K., Ferencak, Z., Hudnik-Plevnik, T., 1995. The role of cytochrome P45011[alpha] in detoxification of steroids in the filamentous fungus Rhizopus nigricans. J. Steroid Biochem. Mol. Biol. 52, 271–275.

Sˇ . Petriˇc et al. / Journal of Biotechnology 150 (2010) 428–437 Breskvar, K., Hudnik-Plevnik, T., 1977. A possible role of cytochrome P-450 in hydroxylation of progesterone by Rhizopus nigricans. Biochem. Biophys. Res. Commun. 74, 1192–1198. Breskvar, K., Hudnik-Plevnik, T., 1981. Inducibility of cytochrome P-450 and of NADPH-cytochrome C reductase in progesterone treated filamentous fungi Rhizopus nigricans and Rhizopus arrhizus. J. Steroid Biochem. 14, 395–399. Brink, H.M., van Gorcom, R.F.M., Hondel, C., Punt, P.J., 1998. Cytochrome P450 enzyme systems in fungi. Fungal Genet. Biol. 23, 1–17. Bureik, M., Schiffler, B., Hiraoka, Y., Vogel, F., Bernhardt, R., 2002. Functional expression of human mitochondrial CYP11B2 in fission yeast and identification of a new internal electron transfer protein, etp1. Biochemistry 41, 2311– 2321. Craven, R.A., Griffiths, D.J.F., Sheldrick, K.S., Randall, R.E., Hagan, I.M., Carr, A.M., 1998. Vectors for the expression of tagged proteins in Schizosaccharomyces pombe. Gene 221, 59–68. Dlugonski, J., Bartnicka, K., Zemelko, I., Chojecka, V., Sedlaczek, L., 1991. Determination of cytochrome-P-450 in Cunninghamella-Elegans intact protoplasts and cell-free preparations capable of steroid hydroxylation. J. Basic Microbiol. 31, 347–356. Doddapaneni, H., Yadav, J.S., 2005. Microarray-based global differential expression profiling of P450 monooxygenases and regulatory proteins for signal transduction pathways in the white rot fungus Phanerochaete chrysosporium. Mol. Genet. Genomics 274, 454–466. Dragan, C.A., Zearo, S., Hannemann, F., Bernhardt, R., Bureik, M., 2005. Efficient conversion of 11-deoxycortisol to cortisol (hydrocortisone) by recombinant fission yeast Schizosaccharomyces pombe. FEMS Yeast Res. 5, 621–625. Dumas, B., Brocard-Masson, C., Assemat-Lebrun, K., Achstetter, T., 2006. Hydrocortisone made in yeast: metabolic engineering turns a unicellular microorganism into a drug-synthesizing factory. Biotechnol. J. 1, 299–307. Duport, C., Spagnoli, R., Degryse, E., Pompon, D., 1998. Self-sufficient biosynthesis of pregnenolone and progesterone in engineered yeast. Nat. Biotechnol. 16, 186–189. Fernandes, P., Cruz, A., Angelova, B., Pinheiro, H.M., Cabral, J.M.S., 2003. Microbial conversion of steroid compounds: recent developments. Enzyme Microb. Technol. 32, 688–705. Grinberg, A.V., Hannemann, F., Schiffler, B., Muller, J., Heinemann, U., Bernhardt, R., 2000. Adrenodoxin: structure, stability, and electron transfer properties. Proteins 40, 590–612. Hakki, T., Zearo, S., Dragan, C.A., Bureik, M., Bernhardt, R., 2008. Coexpression of redox partners increases the hydrocortisone (cortisol) production efficiency in CYP11B1 expressing fission yeast Schizosaccharomyces pombe. J. Biotechnol. 133, 351–359. Hannemann, F., Bichet, A., Ewen, K.M., Bernhardt, R., 2007. Cytochrome P450 systems—biological variations of electron transport chains. Biochim. Biophys. Acta 1770, 330–344. Hogg, J.A., Beal, P.F., Nathan, A.H., Lincoln, F.H., Schneider, W.P., Magerlein, B.J., Hanze, A.R., Jackson, R.W., 1955. The adrenal hormones and related compounds. 1. A direct synthesis of hydrocortisone acetate and cortisone acetate from 11alpha-hydroxyprogesterone. J. Am. Chem. Soc. 77, 4436–4438. Irrgang, S., Schlosser, D., Fritsche, W., 1997. Involvement of cytochrome P-450 in the 15 alpha-hydroxylation of 13-ethyl-gon-4-ene-3,17-dione by Penicillium raistrickii. J. Steroid Biochem. Mol. Biol. 60, 339–346.

437

Ito, H., Fukuda, Y., Murata, K., Kimura, A., 1983. Transformation of intact yeast cells treated with alkali cations. J. Bacteriol. 153, 163–168. Jekkel, A., Ilkoy, É., Horváth, G., Pallagi, I., Süto, J., Ambrus, G., 1998. Microbial hydroxylation of 13[beta]-ethyl-4-gonene-3,17-dione. J. Mol. Catal. B: Enzym. 5, 385–387. Kelly, D., Kelly, S., 2003. Rewiring yeast for drug synthesis. Nat. Biotechnol. 21, 133–134. Kunic, B., Truan, G., Breskvar, K., Pompon, D., 2001. Functional cloning, based on azole resistance in Saccharomyces cerevisiae, and characterization of Rhizopus nigricans redox carriers that are differentially involved in the P450dependent response to progesterone stress. Mol. Genet. Genomics 265, 930– 940. Laemmli, U.K., 1970. Cleavage of structural proteins during assembly of head of bacteriophage T4. Nature 227, 680–685. Mahato, S.B., Garai, S., 1997. Advances in microbial steroid biotransformation. Steroids 62, 332–345. Makovec, T., Breskvar, K., 1998. Purification and characterization of NADPHcytochrome P450 reductase from filamentous fungus Rhizopus nigricans. Arch. Biochem. Biophys. 357, 310–316. Moreno, S., Klar, A., Nurse, P., 1991. Molecular genetic analysis of fission yeast Schizosaccharomyces pombe. Meth. Enzymol. 194, 795–823. Pompon, D., Perret, A., Bellamine, A., Laine, R., Gautier, J.C., Urban, P., 1995. Genetically engineered yeast cells and their applications. Toxicol. Lett. 82–83, 815– 822. Ro, D.K., Paradise, E.M., Ouellet, M., Fisher, K.J., Newman, K.L., Ndungu, J.M., Ho, K.A., Eachus, R.A., Ham, T.S., Kirby, J., Chang, M.C.Y., Withers, S.T., Shiba, Y., Sarpong, R., Keasling, J.D., 2006. Production of the antimalarial drug precursor artemisinic acid in engineered yeast. Nature 440, 940–943. Sakaki, T., Shinkyo, R., Takita, T., Ohta, M., Inouye, K., 2002. Biodegradation of polychlorinated dibenzo-p-dioxins by recombinant yeast expressing rat CYP1A subfamily. Arch. Biochem. Biophys. 401, 91–98. Samanta, T.B., Ghosh, D.K., 1987. Characterization of progesterone 11[alpha]hydroxylase of Aspergillus ochraceus TS: a cytochrome P-450 linked monooxygenase. J. Steroid Biochem. 28, 327–332. Schenkman, J.B., Jansson, I., 2003. The many roles of cytochrome b(5). Pharmacol. Ther. 97, 139–152. Smith, K.E., Ahmed, F., Williams, R.A.D., Kelly, S.L., 1994. Microbial transformations of steroids—VIII. Transformation of progesterone by whole cells and microsomes of Aspergillus fumigatus. J. Steroid Biochem. Mol. Biol. 49, 93–100. Szczebara, F.M., Chandelier, C., Villeret, C., Masurel, A., Bourot, S., Duport, C., Blanchard, S., Groisillier, A., Testet, E., Costaglioli, P., Cauet, G., Degryse, E., Balbuena, D., Winter, J., Achstetter, T., Spagnoli, R., Pompon, D., Dumas, B., 2003. Total biosynthesis of hydrocortisone from a simple carbon source in yeast. Nat. Biotechnol. 21, 143–149. Xu, W., Bak, S., Decker, A., Paquette, S.M., Feyereisen, R., Galbraith, D.W., 2001. Microarray-based analysis of gene expression in very large gene families: the cytochrome P450 gene superfamily of Arabidopsis thaliana. Gene 272, 61– 74. Yamazaki, S., Sato, K., Suhara, K., Sakaguchi, M., Mihara, K., Omura, T., 1993. Importance of the proline-rich region following signal-anchor sequence in the formation of correct conformation of microsomal cytochrome P-450s. J. Biochem. 114, 652–657.