Journal of Asia-Pacific Entomology 15 (2012) 186–191

Contents lists available at SciVerse ScienceDirect

Journal of Asia-Pacific Entomology journal homepage: www.elsevier.com/locate/jape

Identification of biotypes and secondary endosymbionts of Bemisia tabaci in Korea and relationships with the occurrence of TYLCV disease Jungan Park a, S.M. Hemayet Jahan b, Woo-Geun Song b, Hyejung Lee a, Young-Su Lee c, Hong-Soo Choi d, Kwan-Suk Lee d, Chang-Suk Kim d, Sukchan Lee a,⁎, Kyeong-Yeoll Lee b,⁎⁎ a

Department of Genetic Engineering, Sungkyunkwan University, Suwon 440-746, Republic of Korea School of Applied Biosciences, Kyungpook National University, Daegu 702-701, Republic of Korea Environmental Agriculture Research Division, Gyeonggi-do Agricultural Research and Extension Services, Hwasung 445-784, Republic of Korea d National Institutes of Agricultural Science, Suwon 441-707, Republic of Korea b c

a r t i c l e

i n f o

Article history: Received 26 April 2011 Revised 18 October 2011 Accepted 20 October 2011 Available online xxxx Keywords: Bemisia tabaci Biotype Endosymbiotic bacteria TYLCV Vector insects

a b s t r a c t Bemisia tabaci is a species complex that consists of at least 24 genetically diverse biotypes. Here, we determined the biotypes of 27 populations collected in 17 different regions of Korea. Nucleotide sequence comparisons of cytochrome oxidase showed that 26 populations were Q biotype and that one population, the Goyang population, was B biotype. Further subgroup analysis of the Q biotype showed that all populations belonged to the Q1 subgroup, which originates from Western Mediterranean countries. Five endosymbiotic bacteria from various B. tabaci populations were analyzed by comparing rDNA sequences. Hamiltonella was detected in all the populations tested regardless of biotype. Cardinium was detected in all Q biotype populations but not in the B biotype population, while Rickettsia was detected in the B biotype population but not in Q biotype populations. Arsenophonus and Wolbachia were detected in 35% and 58% of Q biotype populations, respectively, but not in the B biotype population. Our results show that the endosymbiont profile is strongly associated with each biotype and with subgroups of the Q biotype. Survey of TYLCV disease from 2008 to 2010 indicated that this disease is widely spread in Korea. This study suggests that the rapid spread of TYLCV may be associated with endosymbiont infection, particularly Hamiltonella infection of B. tabaci. © Korean Society of Applied Entomology, Taiwan Entomological Society and Malaysian Plant Protection Society, 2011. Published by Elsevier B.V. All rights reserved.

Introduction The sweet potato whitefly, Bemisia tabaci, is a serious pest of various horticultural crops. B. tabaci damage is caused directly by sucking of plant saps and indirectly by fungi on secreted honey dew and 100 plant viruses (Brown and Czosnek, 2002; Jones, 2003; Chu et al., 2004; De Barro et al., 2006). Recently, tomato cultivars in Korea have been extensively damaged by a new disease caused by Tomato yellow leaf curl virus (TYLCV), which first appeared in 2008. B. tabaci is a vector insect of TYLCV (Brown and Czosnek, 2002). B. tabaci is a species complex and contains at least 24 biotypes, which are morphologically indistinguishable but have different biological characteristics, including host range, insecticide resistance, and transmission of plant viruses (Brown et al., 1995; Perring, 2001; Boykin et al., 2007). Two particularly aggressive B. tabaci variants, such as B and Q biotypes, have become widely distributed in agricultural cropping systems and ornamental plants (Chu et al., 2007, 2008). These two biotypes belong to closely related sister groups. The ⁎ Corresponding author. Tel.: +82 31 290 7866; fax: +82 31 290 7870. ⁎⁎ Corresponding author. Tel.: +82 53 950 5759; fax: +82 53 950 6758. E-mail addresses: [email protected] (S. Lee), [email protected] (K.-Y. Lee).

B biotype originated in the Middle East and Asia Minor regions and the Q biotype originated in the Mediterranean Basin regions (De Barro et al., 2010). However, the Q biotype has spread into many countries and replaced the B biotype in many countries. In some cases, it has a high level of resistance to insecticides (Horowitz et al., 2005). In Korea, the B biotype was first found in 1998 at rose greenhouses in Jincheon and poinsettia greenhouses in Seoul and Goyang (Lee and De Barro, 2000). Subsequently, Q biotype appeared in 2005 on various horticultural plants in the southern area of Korea (Lee et al., 2005). The Q biotype populations can be divided into two subgroups (Chu et al., 2008; Ahmed et al., 2009a). The MedBasin 1, which is considered a Q1 subgroup, contains populations from western Mediterranean countries (Spain, France, Morocco, Sudan) and non-Mediterranean countries (China, Japan, Taiwan and Korea). The MedBasin 2, which is considered a Q2 subgroup, contains populations from eastern Mediterranean countries (Cyprus, Israel) and non-Mediterranean countries (AB297895 Japan Q). Recently, Gueguen et al. (2010) divided the Q biotype into 5 subgroups, Q1, Q2, Q3, Africa silverleafing populations (ASL) and the Mascarene Archipelago population (Ms), according to COI genetic group analysis. Endosymbiotic bacteria are found within cells or tissues of host insects (Buchner, 1965; Brown et al., 1995; Frohlich et al., 1999).

1226-8615/$ – see front matter © Korean Society of Applied Entomology, Taiwan Entomological Society and Malaysian Plant Protection Society, 2011. Published by Elsevier B.V. All rights reserved. doi:10.1016/j.aspen.2011.10.005

J. Park et al. / Journal of Asia-Pacific Entomology 15 (2012) 186–191

Korea, and to discuss the relationship of endosymbiont profile with the acquisition and transmission potential of TYLCV.

Table 1 TYLCV acquisition and endosymbiont infection of various B. tabaci populations. Biotypes

B Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q

Host plants

Tomato Tomato Tomato Tomato Tomato Tomato Tomato Tomato Tomato Tomato Tomato Tomato Tomato Tomato Tomato Tomato Tomato Tomato Tomato Cucumber Cucumber Sweet melon Sweet melon Sweet melon Sweet melon Paprika Water melon

Locations

Goyang Jeongju Daejeon Yecheon Sangju 1 Sangju 2 Gimcheon Daegu 1 Daegu 2 Daegu 3 Daegu 4 Kwangju Iksan Buyeo Haman Bulkyo Kimhae Tongyeong Jeju Daegu Sangju Seongju 1 Seongju 2 Gimcheon 1 Gimcheon 2 Yeongam Seongju

TYLCV

− + − − − − + + + + − + + + + + + + + − − − − − − − −

187

Endosymbionts A

C

H

R

W

− + − − − − − + − − − + − − + + + + − − − + + − − − −

− + + + + + + + + + + + + + + + + + + + + + + + + + +

+ + + + + + + + + + + + + + + + + + + + + + + + + + +

+ − − − − − − − − − − − − − − − − − − − − − − − − − −

− + + + + − + + + − − + − − + + + − − + − + − + + − −

(A: Arsenophonus, C: Cardinium, H: Hamiltonella, R: Rickettsia, W: Wolbachia.)

They are referred to as either primary or secondary symbionts according to their physiological role. In B. tabaci, the obligatory primary symbiont, Portiera aleyrodidarum, is confined to specialized cells or bacteriocytes in the body and is essential for the host's survival and development (Moran and Telang, 1998; Thao et al., 2000; Baumann, 2005). In contrast, secondary endosymbionts are not necessary for host survival, but may play important roles in their host's physiology, ecology, and evolution (Zchori-Fein and Brown, 2002; Chiel et al., 2007). Until now, six secondary endosymbionts of B. tabaci have been identified: Arsenophonus, Cardinium, Fritschea, Hamiltonella, Rickettsia, and Wolbachia (Baumann, 2005; Gottlieb et al., 2006; Chiel et al., 2007). These bacteria can manipulate various physiological characteristics of hosts. Wolbachia, Arsenophonus, Cardinium, and Rickettsia can manipulate host reproduction (Duron et al., 2008; Werren et al., 2008). Hamiltonella induces virus resistance in the pea aphid (Oliver et al., 2002). Rickettsia influences thermotolerance (Brumin et al., 2011). The object of this study is to determine the biotype distribution and endosymbiont infection in various populations of B. tabaci in

Materials and methods Sample collection and DNA extraction B. tabaci adults were collected from different regions in Korea from 2008 to 2010. They were transferred to absolute ethanol and kept at − 20 °C until further analysis. Total genomic DNA was extracted from each individual for further analysis (Dellaporta et al., 1983; Palmer et al., 1998). Identification of biotypes, endosymbionts and TYLCV B. tabaci biotype was determined by amplification of mitochondrial COI gene fragments from the extracted genomic DNA samples (Khasdan et al., 2005). The presence of 5 secondary B. tabaci endosymbionts, Arsenophonus, Cardinium, Hamiltonella, Rickettsia, and Wolbachia, was determined using specific primer sets of each endosymbiont by amplification of either 16S or 23S rDNA gene fragments (Chiel et al., 2007). TYLCV occurrence in cultivars of various horticultural crops was surveyed in different regions of Korea. TYLCV acquisition of B. tabaci was determined using a TYLCV-specific primer set that can amplify conserved sequences of intergenic region (Lee et al., 2010). Specific primer sets of biotypes, endosymbionts, and TYLCV are listed in Table 2. PCR reactions were performed in a 20 μl mixture containing 5× SuperTaq PCR buffer (10 mM Tris–HCl, 40 mM KCl, 1.5 mM MgCl2, pH 9.0), 2.5 mM dNTPs, 0.5 μM of each primer, 1 unit of SuperTaq DNA polymerase (SuperBio Co, Korea), and 1 µg of DNA as a template. The mixtures were amplified in a PTC-200 thermal cycler (MJ Research, Watertown, MA, USA) with a 3 min initial denaturation at 95 °C, 35 cycles (30 s at 94 °C, 30 s at 52–60 °C, 30 s at 72 °C), and a 10 min extension at 72 °C. Annealing temperatures of each gene are listed in Table 2. The PCR products were visualized on a 1% agarose gel containing ethidium bromide. Expected PCR products were excised from the gel and purified using the Wizard PCR preps DNA purification system (Promega, Madison, WI, USA) and sequenced either directly or by cloning into the pGEM-T easy plasmid vector (Promega, Madison, WI, USA). DNA sequence analysis The sequences of PCR products were determined using the Big Dye Terminator Cycle Sequencing Kit (Applied Biosystems, Foster City, USA) and analyzed by a 3730XL DNA Sequencer (Applied Biosystems, Foster City, USA). Databases were searched using the BLAST algorithm (Altschul et al., 1997; Schäffer et al., 2001) in NCBI and sequences were aligned using the MUSCLE program (Edgar, 2004).

Table 2 PCR primer sets and conditions used in this study. Targeted gene

Primer name

Primer sequence (5′→3′)

Annealing temperature (°C)/product size (bp)

Reference

B. tabaci mtCOI Arsenophonus 23S rDNA Cardinium 16S rDNA Hamiltonella 16S rDNA Rickettsia 16S rDNA Wolbachia 16S rDNA TYLCV

C1-J-2195 L2-N-3014 Ars 23S-1 Ars 23S-2 CFB-F CFB-R Hb-F Hb-R Rb-F Rb-R Wol 16S-F Wol 16S-R TYLCV C1 TYLCV V2

TTGATTTTTGGTCATCCAGAAGT TCCAATGCACTAATCTGCCATATTA CGTTTGATGAATTCATAGTCAAA GGTCCTCCAGTTAGTGTTACCCAAC GCGGTGTAAAATGAGCGTG ACCTMTTCTTAACTCAAGCCT TGAGTAAAGTCTGGAATCTGG AGTTCAAGACCGCAACCTC GCTCAGAACGAACGCTATC GAAGGAAAGCATCTCTGC CGGGGGAAAAATTTATTGCT AGCTGTAATACAGAAAGTAAA CGCCTTATTGGTTTCTTCTTG AAACTTACGAGCCCAATACA

52/~ 800

Khasdan et al. (2005)

60/~ 600

Thao et al. (2000)

58/~ 400

Weeks et al. (2003)

60/~ 700

Zchori-Fein and Brown (2002)

60/~ 900

Gottlieb et al. (2006)

55/~ 600

Heddi et al. (1999)

55/~ 1600

Lee et al. (2010)

188

J. Park et al. / Journal of Asia-Pacific Entomology 15 (2012) 186–191

Mitochondrial COI sequences of B. tabaci were analyzed using MrBayes 3.0 software. Four metropolises coupled with Markov Chain Monte Carlo (MCMC) chains were run, stopping when the standard divergence of split frequencies was less than 0.01 (Ronquist and Huelsenbeck, 2003). All sequences were analyzed over 10 million generations. Four were sampled every 100 generations and the first 25% burn-in (SUMP and SUMT) cycles were discarded prior to the construction of the consensus tree. Consensus trees were visualized with MEGA 4.0 (Tamura et al., 2007). Results Identification of B. tabaci biotypes Twenty seven populations of B. tabaci were collected from 17 different regions of Korea in 2008–2010 (Table 1). PCR analysis with a

mtCOI primer set showed that Q biotype was identified in 26 populations but B biotype was present only in the population collected at the tomato greenhouse in Goyang (Table 1). Two biotypes did not cohabitate in tested populations. According to the analysis of the Q biotype subgroup (Chu et al., 2008), all the Korean Q biotype populations belonged to the Q1 subgroup (Fig. 1). Identification of secondary endosymbionts in B. tabaci populations To determine relationships between biotypes and endosymbiont infection of B. tabaci, the presence of 5 endosymbiotic bacteria in various Korean populations of B. tabaci was examined by PCR analysis of 16S or 23S rDNA sequences (Fig. 2). Hamiltonella was detected in all the tested populations regardless of biotype. However, Cardinium was detected in all Q biotype populations but not in the B biotype, while Rickettsia was detected only in the B biotype but not in any Q

AY827613 Sudan Q AF342775 Spain Q AM180063 France Q AY582872 China Q DQ989547 Taiwan Q HM488310 Korea Haman Q HM488309 Korea Jeonju Q

52

HM488315 Korea Seongju Q AB204588 Japan Q AB204586 Japan Q 98

Group Q1

AY587514 China Q HM488311 Korea Goheung Q DQ462583 Korea Q DQ462584 Korea Q DQ462585 Korea Q AM176573 Morocco Q DQ473394 China Q DQ462586 Korea Q

94

HM488312 Korea Jeju Ilgwari 1 Q HM488313 Korea Jeju Ilgwari 2 Q HM488314 Korea Jeju Ilgwari 3 Q DQ989554 Israel Q AY518191 Israel Q

Group Q2

DQ365878 Israel Q 100

DQ365877 Cyprus Q AB297895 Japan Q AJ877264 Reunion MS DQ989551 Spain B AY611642 China B DQ462587 Korea B AB473558 Japan B 100

AF418671 Israel B JF414589 Korea Goyang B EU547771 Iran Q 92 97

DQ174538 Korea B DQ989531 Korea B AF418668 Ghana C

AJ550168 Colombia A AY827595 Italy T DQ174525 Taiwan An

100 81

DQ174524 Indonesia Nauru

0.05

Fig. 1. Phylogenetic relationships of B. tabaci populations based on a fragment (~800 bp) of the mitochondrial COI sequences. Mitochondrial COI sequences of B. tabaci were compared with other B. tabaci biotype sequences to generate phylogenetic trees according to the Bayesian method. Scale bar indicates the horizontal distance of 0.05. Bold letters indicate the samples of the present study.

J. Park et al. / Journal of Asia-Pacific Entomology 15 (2012) 186–191

Fig. 2. PCR analysis of endosymbionts in B. tabaci. Genomic DNA was extracted from a single B. tabaci adult. The presence of 5 secondary endosymbionts, Arsenophonus (A), Cardinium (C), Hamiltonella (H), Rickettsia (R), and Wolbachia (W), was determined using specific primer sets (Table 2) of each endosymbiont by amplification of either 16S or 23S rDNA gene fragments.

biotype population. Arsenophonus and Wolbachia were not detected in the B biotype but in 35% and 58% of Q biotype populations, respectively. All populations examined in this study were infected with two or more secondary endosymbionts (Table 1). B biotype was co-infected by Hamiltonella and Rickettsia. All the Q biotype populations were co-infected by Cardinium and Hamiltonella. In contrast, Cardinium was not found with Rickettsia in the same host. Relationships of the endosymbiont profile with TYLCV acquisition of B. tabaci TYLCV disease was widespread in tomato greenhouses of various regions in Korea but not in cucumber, sweet melon, water melon, or paprika (Table 1 and Fig. 3). The TYLCV was acquired in some Q biotype populations but not in the B biotype population. Those populations harbored both Cardinium and Hamiltonella, but were not always infected by Arsenophonus and Wolbachia. Discussion Since B. tabaci has recently invaded the Korean peninsula, the B biotype in 1998 and the Q biotype in 2005 (Lee and De Barro, 2000; Lee et al., 2005), our current survey suggests that the Q biotype was widely distributed in most regions of the country but the B biotype was still only in a restricted region, Goyang, which was one of the regions where it was first identified in 1998. The Q biotype is subdivided into several groups that may be due to its being widespread in many countries in the world. It was divided into two subgroups, Q1 and Q2 (Chu et al., 2008; Ahmed et al., 2009a). Gueguen et al. (2010) add 3 more subgroups, the Q3, ALP, and Ms subgroups. According to the COI analysis, all the Q biotype populations in Korea belong to the Q1 subgroup. This result suggests that the Korean populations originated from eastern Mediterranean countries. Subgroups of the Q biotype have several different biological characteristics in development and pesticide resistance. For example, the Q biotype in southern Spain has high resistance to neonicotinoid insecticides (Ebert and Nauen, 2000). However, those in Israel did not show comparable resistance to the same chemicals (Nauen et al., 2002). Chu et al. (2008) suggest that this difference may be caused by overuse of those pesticides in Spain rather than by genetic differences within the biotype Q subgroup. However, no further information is available on genetic differentiation between subgroups of the Q biotype. An understanding of genetic differentiation on different subgroups of Q biotype is required for the appropriate management of B. tabaci.

189

The presence of 5 endosymbiotic bacteria was identified in B. tabaci populations in Korea. Our results did not agree with those of B. tabaci collected from Israel (Chiel et al., 2007). Endosymbiont profiles of the B biotype were similar between two countries but those of the Q biotype were different from each other; the presence of Cardinium and Hamiltonella in Korean populations but not in Israeli populations. The Q biotype in Israel belongs to the Q2 subgroup, while that in Korea belongs to the Q1 subgroup. Thus, endosymbiotic profiles are associated with different subgroups within the Q biotype. Recently, Gueguen et al. (2010) analyzed the endosymbiont distribution in 5 subgroups of the Q biotype worldwide. Hamiltonella was present in the B and Q1 groups, but not in the MS, Q2, or Q3 group. Cardinium was also present in most of the Q1 group but not in B, Q2, or Q3 group. Our results clearly matched these patterns and strongly suggest a specific relationship between certain endosymbionts with subgroups of Q biotype. Our results show that Rickettsia was only detected in the B biotype but not in the Q biotype populations in Korea. This bacterium was detected at high rates in both B and Q biotypes in Israel (Chiel et al., 2007). In addition, Rickettsia is present in B, Q2 and Q3 but not in Q1 and ASL groups (Gueguen et al., 2010). Thus, our results are consistent with previous data: Rickettsia is present in B populations but not in Q1 populations of Korea. Arsenophonus infection is a biotype-specific pattern. Gueguen et al. (2010) reported that Arsenophonus is strongly hosted in Q2, Q3, and ASL groups, but not in B, Q1, and MS groups. In Israeli populations, Arsenophonus is found at a high rate only in the Q2 subgroup (Chiel et al., 2007). Our results show that Arsenophonus was absent in B but was found in only 35% of the Q1 subgroup. This contrasted Gueguen's study which showed that Arsenophonus is absent in the Q1 subgroup. In Gueguen's study, Arsenophonus was detected in a single ASL group and in some populations that had a Q1 and ASL mix. It is possible that Arsenophonus may come from Q1 in those mixed populations. Another study on Chinese populations of B. tabaci shows that Arsenophonus is found in 44% of the Q1 subgroup and is also high in indigenous (Cv) biotypes (Chu et al., 2008; Ahmed et al., 2009b, 2010). Thus, Arsenophonus infection was distributed in Q1 populations in Korea as well as China. The presence of Wolbachia is not consistent with genetic groups of B. tabaci. Wolbachia was only present in the Q biotype but not in the B biotype in Israeli populations (Chiel et al., 2007). Gueguen et al. (2010) showed that Wolbachia was present in Q1 and Q2 but not in B and Q3. Our results showed that Wolbachia infection was in 58% of Q biotype populations but not in a B biotype population. However, in Chinese populations, Wolbachia infection occurs at a high rate in B and indigenous biotypes as well as in the Q biotype (Li et al., 2007; Ahmed et al., 2009a, 2010). This suggests that Wolbachia infection in the B biotype in Korea cannot be excluded because we examined only one B biotype population. Multiple infections of endosymbionts are common in most biotypes of B. tabaci (Gueguen et al., 2010). Co-infection of Hamiltonella and Rickettsia occurred in the B biotype and co-infection of Cardinium and Hamiltonella occurred in the Q1 biotype. Our results showed that these patterns are also present in Korean populations. Co-infected bacteria can be localized in the same tissue of the host body (Gottlieb et al., 2008). They may interact mutually or competitively with each other or with hosts for their co-existence (Vautrin-Ul et al., 2008). An important question regarding plant virus vectors is how they successfully deliver plant viruses without disrupting the virus. Although this mechanism is largely unknown, endosymbionts have significant roles in the acquisition and transmission of plant viruses. Until now, the only known mechanism is that one of the secreted proteins of endosymbionts, such as GroEL, has a protective role for plant virus, such as TYLCV, from the host immune system by binding to the coat proteins of virus (Morin et al., 2000; Czosnek et al., 2002). Although all endosymbionts synthesize GroEL, Hamiltonella is responsible for the TYLCV protection (Gottlieb et al., 2010). In their experiment with various strains of

190

J. Park et al. / Journal of Asia-Pacific Entomology 15 (2012) 186–191

Fig. 3. Occurrence of TYLCV disease from 2008 to 2010 in Korea. Tomato cultivars infected by TYLCV were monitored in various regions of Korea. The numbers indicate: 1. Gyeonggido, 2. Gangwon-do, 3. Chungcheongnam-do, 4. Chungcheongbuk-do, 5. Gyeongsangbuk-do, 6. Gyeongsangnam-do, 7. Jeollabuk-do, 8. Jeollanam-do, and 9. Jeju-do.

B and Q biotypes that harbor different endosymbionts, TYLCV transmission rates were high in all the B biotype strains but very low in all the strains of Q biotype. In these Israeli populations, the B biotype harbors Hamiltonella and Rickettsia, and the Q biotype, including the Q2 subgroup, harbors Arsenophonus, Rickettsia, and Wolbachia (Chiel et al., 2007). This suggests that GroEL proteins of Hamiltonella in the B biotype facilitate TYLCV transmission. However, a high rate of TYLCV transmission is also reported in the Q biotype populations of Spain and China (Jiang et al., 2004; Li et al., 2010). These populations belong to the Q1 subgroup, not to the Q2 subgroup, and also harbor Hamiltonella. This bacterium was detected in all populations of B and Q1 biotypes in Korea. In conclusion, the present study shows that the recently invading Q biotype has spread widely, but that the B biotype inhabits a restricted region in Korea. According to the analysis of COI and endosymbiont profile, all the Q biotype populations belong to the Q1 subgroup. These invading strains are the vectors responsible for the transmission of the recent outbreak of TYLCV disease in tomato cultivars. Both B and Q1 biotypes are vectors for TYLCV transmission because both strains harbor Hamiltonella, which has the potential for virus transmission within the host body. These findings provide useful information to further monitor the spread of exotic invaders and to improve management of the whitefly and viral disease in the field. Acknowledgments We thank Dr Kim Tae-Sung at Gyeongnam Agricultural Research and Extension Services, Dr Lee Jung-Hwan at Gyeongbuk Agricultural Research and Extension Services, and Kim Young-Bae at Jeju Agricultural Research and Extension Services for help with the TYLCV disease survey and whitefly collections. This study was supported by a grant of the Biogreen21 Agenda program (no. PJ006325) of the Rural Development Administration in Korea.

References Ahmed, M.Z., Shatters, R.G., Ren, S.-X., Jin, G.H., Mandour, N.S., Qiu, B.L., 2009a. Genetic distinctions among the Mediterranean and Chinese population of Bemisia tabaci Q biotype and their endosymbiont Wolbachia populations. J. Appl. Entomol. 133, 733–741. Ahmed, M.Z., Shen, Y., Jin, G.H., Ren, S.X., Du, Y.Z., Qiu, B.L., 2009b. Population and host plant differentiation of the sweetpotato whitefly, Bemisia tabaci (Homoptera: Aleyrodidae), in East, South and Southwest China. Acta Entomol. Sin. 52, 1132–1138. Ahmed, M.Z., Ren, S.X., Xue, X., Li, X.X., Jin, G.H., Qiu, B.L., 2010. Prevalence of endosymbionts in Bemisia tabaci populations and their in vivo sensitivity to antibiotics. Curr. Microbiol. 61, 322–328. Altschul, S.F., Madden, T.L., Schäffer, A.A., Zhang, J., Zhang, Z., Miller, W., Lipman, D.J., 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25, 3389–3402. Baumann, P., 2005. Biology of bacteriocyte-associated endosymbionts of plant sapsucking insects. Annu. Rev. Microbiol. 59, 155–189. Boykin, L.M., Shatters Jr., R.G., Rosell, R.C., McKenzie, C.L., Bagnall, R.A., De Barro, P.J., Frohlich, D.R., 2007. Global relationships of Bemisia tabaci (Hemiptera: Aleyrodidae) revealed using Bayesian analysis of mitochondrial COI DNA sequences. Mol. Phylogenet. Evol. 3, 1306–1319. Brown, J.K., Czosnek, H., 2002. Whitefly transmission of plant viruses. Adv. Bot. Res. 36, 65–100. Brown, J.K., Frohlich, D.R., Rosell, R.C., 1995. The sweetpotato or silverleaf whiteflies: biotypes of Bemisia tabaci or a species complex? Annu. Rev. Entomol. 40, 511–534. Brumin, M., Kontsedalov, S., Ghanim, M., 2011. Rickettsia influences thermotolerance in the whitefly Bemisia tabaci B biotype. Insect Sci. 18, 57–66. Buchner, P., 1965. Endosymbiosis of Animals with Plant Microorganisms. Interscience, New York, p. 909. Chiel, E., Gottlieb, Y., Zchori-Fein, E., Mozes-Daube, N., Katzir, N., Inbar, M., Ghanim, M., 2007. Biotype-dependent secondary symbiont communities in sympatric populations of Bemisia tabaci. Bull. Entomol. Res. 97, 407–413. Chu, D., Zhang, Y.J., Cong, B., Xu, B.Y., Wu, Q.J., 2004. The invasive mechanism of a world important pest, Bemisia tabaci (Gennadius) biotype B. Acta Entomol. Sin. 47, 400–406. Chu, D., Jiang, T., Liu, G.X., Jiang, D.F., Tao, L.Y., Fan, Z.X., Zhou, H.X., Bi, Y.P., 2007. Biotype status and distribution of Bemisia tabaci (Hemiptera: Aleyrodidae) in Shandong Province of China based on mitochondrial DNA markers. Environ. Entomol. 36, 1290–1295. Chu, D., Wan, F.H., Tao, Y.L., Liu, G.X., Fan, Z.X., Bi, Y.P., 2008. Genetic differentiation of Bemisia tabaci (Hemiptera: Aleyrodidae) biotype Q based on mitochondrial DNA markers. Insect Sci. 117, 117–125.

J. Park et al. / Journal of Asia-Pacific Entomology 15 (2012) 186–191 Czosnek, H., Ghanim, M., Ghanim, M., 2002. The circulative pathway of begomoviruses in the whitefly vector Bemisia tabaci insights from studies with Tomato yellow leaf curl virus. Ann. Appl. Biol. 140, 215–231. De Barro, P.J., Bourne, A., Khan, S., Brancatini, V., 2006. Host plant and biotype density interactions: their role in the establishment of the invasive B biotype of Bemisia. Biol. Invasions 8, 287–294. De Barro, P.J., Liu, S.S., Boykin, L.M., Dinsdale, A.B., 2010. Bemisia tabaci: a statement of species status. Annu. Rev. Entomol. 56, 1–19. Dellaporta, S., Wood, J., Hicks, J.B., 1983. A plant DNA minipreparation: version II. Plant Mol. Biol. Rep. 1, 19–21. Duron, O., Bouchon, D., Boutin, S., Bellamy, L., Zhou, L., Engelstädter, J., Hurst, G.D., 2008. The diversity of reproductive parasites among arthropods: Wolbachia do not walk alone. BMC Biol. 24, 6–27. Ebert, A., Nauen, R., 2000. Resistance of Bemisia tabaci (Homoptera: Aleyrodidae) to insecticides in southern Spain with special reference to neonicotinoids. Pest Manage. Sci. 56, 60–64. Edgar, R.C., 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 32, 1792–1797. Frohlich, D.R., Torres-Jerez, I., Bedford, I.D., Markham, P.G., Brown, J.K., 1999. A phylogeographical analysis of the Bemisia tabaci species complex based on mitochondrial DNA markers. Mol. Ecol. 8, 1683–1691. Gottlieb, Y., Ghanim, M., Chiel, E., Gerling, D., Portnoy, V., Steinberg, S., Tzuri, G., Horowitz, A.R., Belausov, E., Mozes-Daube, N., Kontsedalov, S., Gershon, M., Gal, S., Katzir, N., Zchori-Fein, E., 2006. Identification and localization of a Rickettsia sp. in Bemisia tabaci (Homoptera: Aleyrodidae). Appl. Environ. Microbiol. 72, 3646–3652. Gottlieb, Y., Ghanim, M., Gueguen, G., Kontsedalov, S., Vavre, F., Fleury, F., Zchori-Fein, E., 2008. Inherited intracellular ecosystem: symbiotic bacteria share bacteriocytes in whiteflies. FASEB J. 22, 2591–2599. Gottlieb, Y., Zchori-Fein, E., Mozes Daube, N., Kontsedalov, S., Skaljac, M., Brumin, M., Sobol, I., Czosnek, H., Vavre, F., Fleury, F., Ghanim, M., 2010. The transmission efficiency of Tomato yellow leaf curl virus by the whitefly Bemisia tabaci is correlated with the presence of a specific symbiotic bacterium species. J. Virol. 84, 9310–9317. Gueguen, G., Vavre, F., Gnankine, O., Peterschmitt, M., Charif, D., Chiel, E., Gottlieb, Y., Ghanim, M., Zchori-Fein, E., Fleury, F., 2010. Endosymbiont metacommunities, mtDNA diversity and the evolution of the Bemisia tabaci (Hemiptera: Aleyrodidae) species complex. Mol. Ecol. 19, 4365–4376. Heddi, A., Grenier, A.M., Khatchadourian, C., Charles, H., Nardon, P., 1999. Four intracellular genome direct weevil biology: nuclear, mitochondrial, principal endosymbiont, and Wolbachia. Proc. Natl. Acad. Sci. U. S. A. 96, 6814–6819. Horowitz, A.R., Kontsedalov, S., Khasdan, V., Ishaaya, I., 2005. Biotypes B and Q of Bemisia tabaci and their relevance to neonicotinoid and pyriproxyfen resistance. Arch. Insect Biochem. Physiol. 58, 216–225. Jiang, Y.X., de Blas, C., Bedford, I.D., Nombela, G., Muñiz, M., 2004. Effect of biotype in the transmission of (TYLCSV-ES) between tomato and common weeds. Span. J. Agric. Res. 2, 115–119. Jones, D.R., 2003. Plant viruses transmitted by whiteflies. Eur. J. Plant Pathol. 345, 428–434. Khasdan, V., Levin, I., Rosner, A., Morin, S., Kontsedalov, S., Maslenin, L., Horowitz, A.R., 2005. DNA markers for identifying biotypes B and Q of Bemisia tabaci (Hemiptera: Aleyrodidae) and studying population dynamics. Bull. Entomol. Res. 95, 605–613.

191

Lee, M.L., De Barro, P.J., 2000. Characterization of different biotypes of Bemisia tabaci (Gennadius) (Homoptera; Aleyrodidae) in South Korea based on 16S ribosomal RNA sequences. Korean J. Entomol. 30, 125–130. Lee, M.H., Kang, S.K., Lee, S.Y., Lee, H.S., Choi, J.Y., Lee, G.S., Kim, W.Y., Lee, S.W., Kim, S.G., Uhm, K.B., 2005. Occurrence of the B- and Q-biotype of Bemisia tabaci in Korea. Korean J. Appl. Entomol. 44, 169–175. Lee, H., Song, W., Kwak, H.R., Kim, J.D., Park, J., Auh, C.K., Kim, D.H., Lee, K.Y., Lee, S., Choi, H.S., 2010. Phylogenetic analysis and inflow route of Tomato yellow leaf curl virus (TYLCV) and Bemisia tabaci in Korea. Mol. Cells 30 (5), 467–476. Li, Z.X., Lin, H.Z., Guo, X.P., 2007. Prevalence of Wolbachia infection in Bemisia tabaci. Curr. Microbiol. 54, 467–471. Li, M., Hu, J., Xu, F.C., Liu, S.S., 2010. Transmission of Tomato yellow leaf curl virus by two invasive biotypes and a Chinese indigenous biotype of the whitefly Bemisia tabaci. Int. J. Pest Manage. 56, 275–280. Moran, N.A., Telang, A., 1998. The evolution of bacteriocyte-associated endosymbionts in insects. Bioscience 48, 295–304. Morin, S., Ghanim, M., Sobol, I., Czosnek, H., 2000. The GroEL protein of the whitefly Bemisia tabaci interacts with the coat protein of transmissible and nontransmissible begomoviruses in the yeast two-hybrid system. Virology 276, 404–416. Nauen, R., Stumpf, N., Elbert, A., 2002. Toxicological and mechanistic studies on neonicotinoid cross resistance in Q type Bemisia tabaci (Hemiptera: Aleyrodidae). Pest Manage. Sci. 58, 868–875. Oliver, K.M., Russell, J.A., Moran, A.N., Hunter, M.S., 2002. Facultative bacterial symbionts in aphids confer resistance to parasitic wasps. Proc. Natl. Acad. Sci. U. S. A. 100, 1803–1807. Palmer, L.E., Hobbie, S., Galan, J.E., Bliska, J., 1998. YopJ of Yersinia pseudotuberculosis is required for the inhibition of macrophage TNF-a production and down-stream regulation of the MAP kinase p38 and JNK. Mol. Microbiol. 27, 953–965. Perring, T.M., 2001. The Bemisia tabaci species complex. Crop. Prot. 20, 725–737. Ronquist, F., Huelsenbeck, J.P., 2003. MrBayes version 3.0: Bayesian phylogenetic inference under mixed models. Bioinformatics 19, 1572–1574. Schäffer, A.A., Aravind, L., Madden, T.L., Shavirin, S., Spouge, J.L., Wolf, Y.I., Koonin, E.V., Altschul, S.F., 2001. Improving the accuracy of PSI-BLAST protein database searches with composition-based statistics and other refinements. Nucleic Acids Res. 29, 2994–3005. Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24, 1596–1599. Thao, M.L.L., Moran, N.A., Abbot, P., Brennan, E.B., Burckhardt, D.H., Baumann, P., 2000. Cospeciation of psyllids and their primary prokaryotic endosymbionts. Appl. Environ. Microbiol. 66, 2898–2905. Vautrin-Ul, C., Mendy, H., Taleb, A., Chaussé, A., Stafiej, J., Badiali, J.P., 2008. Numerical simulation of spatial heterogeneity formation in metal corrosion. Corros. Sci. 50, 2149–2158. Weeks, A.R., Velten, R., Stouthamer, R., 2003. Incidence of a new sex-ratio distorting endosymbiotic bacterium among arthropods. Proc. Biol. Sci. 270, 1857–1865. Werren, J.H., Baldo, L., Clark, M.E., 2008. Wolbachia: master manipulators of invertebrate biology. Nat. Rev. Microbiol. 6, 741–751. Zchori-Fein, E., Brown, J.K., 2002. Diversity of prokaryotes associated with Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae). Ann. Entomol. Soc. Am. 95, 711–718.