Interspecific interactions of heterotrophic bacteria during chitin degradation

Dissertation zur Erlangung des akademischen Grades des Doktors der Naturwissenschaften (Dr. rer. nat.)

vorgelegt von

Nina Jagmann

an der Universität Konstanz Mathematisch-Naturwissenschaftliche Sektion Fachbereich Biologie

Konstanz, Mai 2012

Tag der mündlichen Prüfung: 20.07.2012 1. Referent: Prof. Dr. Bernhard Schink, Universität Konstanz 2. Referent: Prof. Dr. Bodo Philipp, Universität Münster 3. Referent: Prof. Dr. Christof Hauck, Universität Konstanz Konstanzer Online-Publikations-System (KOPS) URL: http://nbn-resolving.de/urn:nbn:de:bsz:352-201102

TABLE OF CONTENTS

TABLE OF CONTENTS SUMMARY..................................................................................................................III ZUSAMMENFASSUNG.............................................................................................. V LIST OF PUBLICATIONS ........................................................................................ VII GENERAL INTRODUCTION .......................................................................................1 Interspecific and interkingdom interactions of bacteria .........................................1 Intraspecific interactions of bacteria......................................................................2 Co-culture model systems for interspecific interactions employed in this thesis ..8 Aims of this thesis ...............................................................................................10 CHAPTER 1 Interactions of bacteria with different mechanisms for chitin degradation result in the formation of a mixed-species biofilm ...........................................11 Abstract...............................................................................................................11 Introduction .........................................................................................................11 Material and Methods .........................................................................................13 Results and Discussion.......................................................................................16 Conclusions ........................................................................................................22 Acknowledgements.............................................................................................22 CHAPTER 2 Parasitic growth of Pseudomonas aeruginosa in co-culture with the chitinolytic bacterium Aeromonas hydrophila ..................................................23 Abstract...............................................................................................................23 Introduction .........................................................................................................23 Material and Methods .........................................................................................25 Results ................................................................................................................34 Discussion...........................................................................................................46 Acknowledgements.............................................................................................51 CHAPTER 3 Metabolic requirements for the parasitic growth strategy of Pseudomonas aeruginosa in co-culture with the chitinolytic bacterium Aeromonas hydrophila .............................................................................................................53 Abstract...............................................................................................................53 Introduction .........................................................................................................54 Material and Methods .........................................................................................55 Results ................................................................................................................62 Discussion...........................................................................................................76 Acknowledgements.............................................................................................83

I

TABLE OF CONTENTS CHAPTER 4 The role of quorum sensing of Pseudomonas aeruginosa in co-culture with Aeromonas hydrophila and the identification of novel genes involved in quorum sensing-regulated processes ...............................................................85 Abstract...............................................................................................................85 Introduction .........................................................................................................86 Material and Methods .........................................................................................88 Results ................................................................................................................97 Discussion.........................................................................................................112 Acknowledgements...........................................................................................122 GENERAL DISCUSSION ........................................................................................123 RECORD OF ACHIEVEMENT ................................................................................133 REFERENCES.........................................................................................................135

II

SUMMARY

SUMMARY In their natural habitats, bacteria live in multi-species microbial communities and are, thus, constantly interacting with bacteria of other phylogenetic groups. In order to prevail in these interspecific interactions, such as the competition for nutrients, bacteria have developed numerous strategies. During the degradation of polymers such interspecific interactions are likely to occur, because degradation starts as an extracellular process. In one possible interaction scenario, investor bacteria, which invest energy in the production of extracellular enzymes, face the danger of being exploited by opportunistic bacteria that compete for degradation products. To investigate such a scenario and to characterize the strategies employed by the bacteria involved, we established two co-culture model-systems consisting of bacteria that co-exist in aquatic environments and with the polymer chitin as carbon, nitrogen, and energy source. Aeromonas hydrophila strain AH-1N, which releases extracellular chitinases, was employed as investor bacterium in both co-cultures. In the first co-culture, chitin embedded in agarose served as substrate. Flavobacterium sp. strain 4D9, which cannot degrade embedded chitin due to its cellassociated chitinases, was employed as opportunistic bacterium. The strategies applied by strain 4D9 in order to acquire nutrients included active integration into the biofilm formed by strain AH-1N on the chitin beads and interception of the chitin monomer N-acetylglucosamine (GlcNAc), leading to overgrowth of strain AH-1N by strain 4D9 in the biofilm. In the second co-culture, suspended chitin served as substrate. Pseudomonas aeruginosa strain PAO1, which is unable to degrade chitin, was employed as opportunistic bacterium. In the first phase of the co-culture, strain PAO1 grew with ammonium, acetate, and possibly GlcNAc and other compounds, which were released by strain AH-1N. In the second phase, strain PAO1 produced quorum sensing (QS)-controlled secondary metabolites, among them the redox active pigment pyocyanin. Pyocyanin inhibited the enzyme aconitase of strain AH-1N through the production of reactive oxygen species causing a block of the citric acid cycle. This led to a massive acetate release by strain AH-1N, which supported substantial growth of strain PAO1. Strain AH-1N was finally inactivated by pyocyanin and presumably other secondary metabolites. Further investigation of this parasitic growth strategy of strain PAO1 revealed that, while catabolite repression of GlcNAc III

SUMMARY metabolism by acetate did not play a role, the action of isocitrate lyase was a key metabolic requirement for the transition into the second phase. Besides its role in acetate utilization, this enzyme was crucial for the utilization of GlcNAc. The ability to synthesize amino acids was a metabolic requirement of strain PAO1 as well. The overexpression of the QS effector protein PqsE regulating pyocyanin production could not restore formation of pyocyanin in auxotrophic mutants. P. aeruginosa possesses three QS systems. For the QS response of strain PAO1 in the co-culture, both the rhl and the 2-alkyl-4(1H)-quinolone system were crucial, whereas the las system was dispensable. Lack of the rhl signal synthase could be complemented by cross-talk with signals of strain AH-1N. By applying transposon mutagenesis and screening for mutants of strain PAO1 with defects in QS-regulated processes, we could identify several genes that were involved in the regulation of pyocyanin production. Among them were members of the gene cluster PA1415-PA1421, mutations of which led to a decreased production of pyocyanin and accelerated growth with the polyamine spermin. By employing our co-culture model systems to study interspecific interactions, we could identify strategies of bacteria that are likely to be important in their natural habitats. With regard to P. aeruginosa, our model system offers the possibility to study QS under conditions that are more ecologically relevant than in single culture.

IV

ZUSAMMENFASSUNG

ZUSAMMENFASSUNG Bakterien

sind

in

ihren

natürlichen

Habitaten

Bestandteil

mikrobieller

Gemeinschaften und befinden sich somit in ständiger Interaktion mit Bakterien verschiedener phylogenetischer Gruppen. Um in diesen Konkurrenzsituationen zu bestehen, haben Bakterien eine Vielzahl verschiedener Strategien entwickelt. Solch interspezifische Interaktionen sind während des Abbaus von Polymeren sehr wahrscheinlich, da dieser als extrazellulärer Prozess initiiert wird. In einem möglichen Interaktionsszenario werden Bakterien (Investoren), die Energie in die Produktion von

extrazellulären

Enzymen

investieren,

von

opportunistischen

Bakterien

ausgenutzt, welche mit ihnen um die Abbauprodukte konkurrieren. Um ein solches Szenario zu untersuchen und die von den beteiligten Bakterien angewandten Strategien zu charakterisieren, entwickelten wir zwei Modellsysteme, die aus jeweils einer Co-Kultur bestanden. Diese Co-Kulturen enthielten Bakterien, die in denselben aquatischen Habitaten vorkommen, sowie das Polymer Chitin als Kohlenstoff-, Stickstoff-, und Energiequelle. Als Investor in beiden Co-Kulturen wurde Aeromonas hydrophila Stamm AH-1N eingesetzt, welcher extrazelluläre Chitinasen sezerniert. In der ersten Co-Kultur wurde in Agarose eingebettetes Chitin als Substrat verwendet. Als opportunistisches Bakterium wurde Flavobacterium sp. Stamm 4D9 eingesetzt, der aufgrund seiner zellassoziierten Chitinasen kein eingebettetes Chitin abbauen kann. Die Strategien, die Stamm 4D9 anwandte, um an Nährstoffe zu gelangen, beinhalteten die aktive Integration in den von Stamm AH-1N auf den Chitinkugeln gebildeten Biofilm und das Abfangen des Chitinmonomers NAcetylglucosamin (GlcNAc). Dies hatte zur Folge, dass Stamm AH-1N durch Stamm 4D9 im Biofilm überwachsen wurde. In der zweiten Co-Kultur wurde suspendiertes Chitin als Substrat verwendet. Als opportunistisches Bakterium wurde Pseudomonas aeruginosa Stamm PAO1 eingesetzt, welcher Chitin nicht abbauen kann. In der ersten Phase der Co-Kultur nutzte Stamm PAO1 Ammonium, Acetat und wahrscheinlich GlcNAc und andere Verbindungen als Wachstumssubstrate, die von Stamm AH-1N freigesetzt wurden. In der zweiten Phase bildete Stamm PAO1 quorum sensing (QS)-regulierte Sekundärmetabolite, darunter den redoxaktiven Farbstoff Pyocyanin. Pyocyanin inhibierte durch die Bildung von reaktiven Sauerstoffspezies das Enzym Aconitase des Stammes AH-1N, was eine Blockade des Citratzyklus zur Folge hatte. Dadurch V

ZUSAMMENFASSUNG kam es zur Freisetzung einer großen Menge von Acetat durch Stamm AH-1N, welches von Stamm PAO1 als Substrat genutzt werden konnte. Stamm AH-1N wurde

schließlich

durch

Pyocyanin

und

vermutlich

auch

durch

andere

Sekundärmetabolite inaktiviert. Weitere Untersuchungen dieser parasitischen Wachstumsstrategie ergaben, dass die Aktivität der Isocitratlyase eine wichtige metabolische Voraussetzung für den Übergang von der ersten in die zweite Phase durch Stamm PAO1 darstellte. Eine mögliche Katabolitrepression des GlcNAcStoffwechsels durch Acetat spielte hierbei keine Rolle. Neben ihrer Beteiligung an der Assimilation von Acetat war die Isocitratlyase essentiell für das Wachstum mit GlcNAc. Eine weitere metabolische Voraussetzung für Stamm PAO1 stellte die Fähigkeit, Aminosäuren zu synthetisieren, dar. Die Bildung von Pyocyanin durch Mutanten,

die

für

Aminosäuren

auxotroph

waren,

konnte

selbst

durch

Überexpression des QS-Effektorproteins PqsE, das diese Bildung reguliert, nicht wiederhergestellt werden. P. aeruginosa besitzt drei QS-Systeme. Für die QSAntwort des Stammes PAO1 in der Co-Kultur waren das rhl- und das 2-alkyl-4(1H)Chinolon-System essentiell, während das las-System entbehrlich war. Die Mutation der Signalsynthase des rhl-Systems konnte durch Signale von Stamm AH-1N komplementiert werden. Die Durchführung einer Transposonmutagenese und die darauffolgende Suche nach Mutanten des Stammes PAO1 mit Defekten in QSregulierten Prozessen führten zur Identifizierung von Genen, die an der Regulation der Pyocyaninbildung beteiligt waren. Darunter befanden sich Gene des Genclusters PA1415-PA1421, deren Mutation zu einer verringerten Bildung von Pyocyanin und einem beschleunigtem Wachstum mit dem Polyamin Spermin führten. Die Nutzung unserer Modellsysteme für die Analyse interspezifischer Interaktionen führte zur Identifizierung von Strategien der beteiligten Bakterien, die auch in ihren natürlichen Habitaten wirksam sein könnten. In Bezug auf P. aeruginosa ermöglicht es unsere Co-Kultur, QS unter Bedingungen zu analysieren, die ökologisch relevanter sind als die einer Reinkultur.

VI

LIST OF PUBLICATIONS

LIST OF PUBLICATIONS This thesis is based on the following publications and manuscripts:

CHAPTER 1

Jagmann, N., Styp von Rekowski, K., and Philipp, B. (2012) Interactions of bacteria with different mechanisms for chitin degradation result in the formation of a mixed-species biofilm. FEMS Microbiol Lett 326(1): 69-75.

CHAPTER 2

Jagmann, N., Brachvogel, HP., and Philipp, B. (2010) Parasitic growth of Pseudomonas aeruginosa in co-culture with the chitinolytic bacterium Aeromonas hydrophila. Environ Microbiol 12(6): 1787-1802.

CHAPTER 3

Jagmann,

N.,

Hupfeld,

M.,

and

Philipp,

B.

Metabolic

requirements for the parasitic growth strategy of Pseudomonas aeruginosa

in

co-culture

with

the

chitinolytic

bacterium

Aeromonas hydrophila. (Manuscript) CHAPTER 4

Jagmann, N., Bleicher, V., and Philipp, B. The role of quorum sensing

of

Pseudomonas

aeruginosa

in

co-culture

with

Aeromonas hydrophila and the identification of novel genes involved in quorum sensing-regulated processes. (Manuscript)

VII

GENERAL INTRODUCTION

GENERAL INTRODUCTION

Interspecific and interkingdom interactions of bacteria In their natural environment, bacteria do not exist as independently acting cell populations, but they are part of multispecies environments, in which bacteria of different phylogenetic groups are constantly interacting with each other (Keller and Surette, 2006; Haruta et al., 2009). These bacterial communities are integral components of most biological systems (Straight and Kolter, 2009). Interspecific interactions of bacteria are ranging from competition, during which for example virulence factors are employed, to cooperation, commensalism, parasitism, and predator-prey interactions. Cooperation between bacteria involves for example symbiotic interactions like syntrophy (McInerny et al., 2008), whereas commensalistic interactions can be mediated for example by the release of waste products by bacteria that serve as growth promoting substances for other bacteria (Ohno et al., 1999; Ueda et al., 2004). In a parasitic interaction, Pseudomonas aeruginosa lyses cells of Staphylococcus aureus in order to get access to iron in low-iron environments (Mashburn et al., 2005). During a predator-prey interaction, Bdellovibrio species predate Escherichia coli by attaching to and subsequently replicating within the cells (Koval and Bayer, 1997). Microbial communities are often found in close association with eukaryotes as well. Consequently, interkingdom interactions of bacteria with plants, animals, and fungi exist. These interactions comprise for example cooperation like the symbiosis between rhizobia and legumes (Robertson et al., 1985) and between mammals and their intestinal microbiota (Hooper et al., 1998) or parasitism involving pathogenic bacteria. The focal point of interspecific and interkingdom interactions is the acquisition of nutrients (Hibbing et al., 2010). To be able to persist in such interactions and to react to changes in their environment, bacteria have developed multiple strategies such as antibiotic production, motility, or coordinated activities, which are often mediated by producing, sensing, and responding to chemical information.

1

GENERAL INTRODUCTION Intraspecific interactions of bacteria Interspecific and interkingdom interactions of bacteria have been acknowledged for a long time, but the view on the complexity of these interactions has changed dramatically over the last 25 years, after it became obvious that intraspecific interactions of bacteria are widespread (Keller and Surette, 2006; West et al., 2006; Williams 2007; West et al., 2007; Straight and Kolter, 2009). These intraspecific interactions are mediated by communication and cooperation between single cells of one population. Communication occurs when one or several individuals produce a signal that can be perceived by other individuals, which alter their behaviour in response to this signal (Keller and Surette, 2006). Cells of some Myxococcus species, for example, have long been known to communicate via chemical signals to form fruiting bodies as multicellular behaviour (Shimkets, 1990). By now, it is clear that various bacteria communicate and cooperate in order to perform multicellular behaviours, and the sociobiology and so-called social lives of bacteria have become major research areas (West et al., 2007; Dunny et al., 2008). These intraspecific interactions of bacteria have great influence on interspecific interactions as competitive strategies that require cooperative behaviour can be carried out (Hibbing et al., 2010). In addition to chemical communication (see below), numerous signalling pathways, e.g. two-component systems, have been identified in bacteria, which enables them to respond to a variety of environmental cues (Williams et al., 2007). Thus, bacteria cannot simply be viewed as passive nutritional sinks taking up nutrients and reproducing without taking note of their environment, but they have developed numerous strategies to ensure their acquisition of resources (Straight and Kolter, 2009; Hibbing et al., 2010). Quorum sensing During intraspecific interactions, bacteria release diffusible signal molecules and respond to them by changes in gene expression. These bacterial cell-to-cell communication mechanisms were termed quorum sensing (QS) (Fuqua et al., 1996). According to the general model of quorum sensing, bacteria constantly produce and release signal molecules into the environment. When a certain threshold concentration of signals is reached, which often coincides with high cell densities, the signal binds to its cognate signal receptor protein, and this complex leads to the activation or repression of the transcription of quorum sensing target genes, such as 2

GENERAL INTRODUCTION genes encoding for enzymes for the biosynthesis of secondary metabolites or virulence factors. Additionally, this complex activates transcription of the signal synthase gene leading to a strong increase in signal molecules and, in consequence, to an enhanced expression of target genes, thus creating a positive feedback loop (Fig. 1).

luxR

luxI

Fig. 1. The basic quorum sensing module. A LuxI-type synthase produces the signal molecule, which binds to a LuxR-type receptor protein, when it has reached a certain threshold concentration. The complex of receptor protein and signal molecule regulates the expression of certain target genes and enhances expression of luxI (positive feedback loop).

QS has been originally defined as cell-density dependent gene regulation, but it has become obvious that QS can be dependent on other environmental factors as well. Nevertheless, QS is used as a general term for bacterial cell-to-cell communication based on diffusible signal molecules (Williams, 2007; Williams and Camara, 2009). The phenomenon of cell-to-cell communication was initially discovered in the Gramnegative bioluminescent bacterium Vibrio fischeri and was originally termed autoinduction (Nealson et al., 1970). Bacteria of the genera Vibrio and Photobacterium live as symbionts in the light organs of sepiolid squids, which use bacterial bioluminesce for reducing their silhouette by counterillumination thus evading predators or disguising during search for prey (Nealson and Hastings, 1991). V. fischeri, the model organism for the molecular background of QS, possesses a 3

GENERAL INTRODUCTION signal synthase, LuxI, which produces N-(3-oxo-hexanoyl)-homoserine lactone (3oxo-C6-HSL) as signal molecule (Eberhard et al., 1981). After binding 3-oxo-C6-HSL the signal receptor LuxR activates transcription of the lux operon, which is responsible for production of bioluminescence, and enhances the expression of luxI as positive feedback loop (Engebrecht et al., 1983). This phenomenon was thought to be limited to marine bioluminescent bacteria, until homologues of LuxR and LuxI were discovered in Erwinia carotovora and Pseudomonas aeruginosa (Gambello and Iglewski, 1991; Bainton et al., 1992). Since then, different LuxR/LuxI/N-acyl-HSL dependent-QS systems have been discovered in a variety of Gram-negative bacteria, some of which employing several interrelated systems (Williams, 2007). So far, N-acyl-HSL-mediated QS has been found only in Gram-negative bacteria. QS in Gram-positive bacteria differs with regard to signal molecules and signal transduction (Jayaraman and Wood, 2008). These bacteria employ so-called autoinducer peptides (AIPs) as QS signalling molecules, which are actively exported from the cell. When a certain threshold of AIPs is reached, they bind to a histidine kinase of a two-component system, and the corresponding response regulator leads to activation or repression of target genes. Both Gram-negative and Gram-positive bacteria share a QS system that employs a group of borate diester-containing furanones, collectively termed autoinducer 2 (AI2), as diffusible signal molecules (Chen et al., 2002). The gene encoding AI-2 synthase (LuxS) is widespread among bacteria and is found for example in Proteobacteria, Firmicutes, Actinobacteridae and in genera of the Cytophaga group (Vendeville et al., 2005). Therefore, it was suggested that AI-2 is used for interspecies communication (Xavier and Bassler, 2003). However, it has also been suggested that LuxS has an important metabolic function in recycling Sadenosylhomocysteine, a precursor of AI-2, and that AI-2 represents a metabolite rather than a signal molecule (Winzer et al., 2002). As described above, intraspecific cell-to-cell communication and the resulting coordination of behaviour increases the complexity of interspecific and interkingdom interactions of bacteria. Additionally, QS can also have a direct influence on other bacteria during interspecies interactions. Burkholderia cepacia, for example, is able to sense and respond to N-acyl-HSLs synthesized by P. aeruginosa but not vice versa (Riedel et al., 2001). Escherichia coli and Salmonella species do not synthesize N-acyl-HSLs but possess an LuxR homologue, which enables them to 4

GENERAL INTRODUCTION intercept signal molecules from other bacteria leading for example to reduced biofilm formation in E. coli (Ahmer, 2004). Equally, QS has a direct influence on interkingdom interactions, and several eukaryotes are able to react to bacterial signal molecules. Spores of the green microalga Ulva intestinalis, for example, preferentially attach to N-acyl-HSL producing bacterial biofilms (Tait et al., 2005). In response to QS by P. aeruginosa, Candida albicans switches from growth as filamentous cells to growth as yeast-form cells, which are resistant to P. aeruginosa attack (Hogan et al., 2004). And the red alga Delisea pulchra is able to inhibit QS of Vibrio harveyi by producing brominated furanones that act on the signal receptor protein (Defoirdt et al., 2007). Quorum sensing in Pseudomonas aeruginosa One of the best studied and most complex QS mechanism is found in P. aeruginosa (Williams, 2007). This bacterium possesses three QS systems (see also Chapter 4), which control about 10 % of its genome (Schuster and Greenberg, 2006) (Fig. 2). Two QS systems, las and rhl, employ N-acyl-HSLs as signal molecules. The las system consists of the signal synthase LasI, which produces N-3-oxo-dodecanoylhomoserine lactone (3-oxo-C12-HSL), and the signal receptor LasR. The las system exerts both transcriptional and translation control over the rhl system (Latifi et al., 1996), which consists of RhlI, producing N-butanoyl-homoserine lactone (C4-HSL), and the signal receptor RhlR. However, it has been shown that the hierarchical relationship of both systems is conditional and dependent on the growth environment (Duan and Surette, 2007). The third QS system of P. aeruginosa employs 2-alkyl4(1H)-quinolones (AQs) as signal molecules (Dubern and Diggle, 2008). For the synthesis of more than 50 different AQs from anthranilate and α-keto fatty acids, transcription of pqsABCD is required. One important signal molecule of this QS system is 2-heptyl-4-quinolone (HHQ), which is the precursor of the second important signal molecule 2-heptyl-3-hydroxy-4-quinolone, which has been termed the Pseudomonas Quinolone Signal (PQS) and is produced from HHQ by PqsH. Both PQS and HHQ bind to their cognate receptor PqsR, which activates the expression of the pqsABCDE and phnAB operons. The latter is responsible for provision of the AQ-precursor anthranilate from chorismate. PqsE, which belongs to the family of metallo-hydrolases, is the effector protein of the AQ quorum sensing system and

5

GENERAL INTRODUCTION

lasR

lasI

O

H N

O

O

O

12

rhlR

rhlI

O O

H N O 4

pqsA pqsB pqsC pqsD pqsE phnA phnB

pqsR

O N H

pqsH

O OH N H

Fig. 2.

The N-acyl-HSL-dependent and AQ-dependent quorum sensing network in P.

aeruginosa that, partially together with other signalling pathways, regulates numerous target genes and controls the expression of multiple virulence determinants, some of which are listed above. The las system (in green), consisting of the signal synthase LasI producing 3oxo-C12-HSL and the signal receptor LasR, exerts control over the rhl system (in red), consisting of RhlI producing C4-HSL and RhlR. AQs (AQ system in blue) are synthesized from anthranilate (provided via PhnAB) by the action of PqsABCD, and PQS is produced from HHQ via PqsH. Both PQS and HHQ bind to the signal receptor PqsR, which drives expression of the pqsABCDE operon. PqsE is the effector protein of the AQ system controlling target gene expression. The AQ system is positively regulated by the las system and negatively regulated by the rhl system, which itself is positively regulated by the PqsR/PQS-complex of the AQ system. Our study indicated that the PqsR/HHQ complex activated the rhl system as well (dashed blue arrow; see Chapter 4). In the absence of LasR, RhlR/C4-HSL positively regulates lasI and pqsH expression (dashed red arrows; Dekimpe and Déziel, 2009). The QS systems are subject to a number of additional regulators, which further modulate the response of QS to a variety of environmental cues. Solid arrows indicate positive regulation; solid T-bars indicate negative regulation.

6

GENERAL INTRODUCTION drives the expression of PQS/HHQ-dependent genes. The biochemical function of PqsE the associated downstream signal transduction is still unknown. The AQ system is linked to both the las and rhl system, with LasR/3-oxo-C12-HSL positively regulating transcription of pqsH, pqsR, and pqsA (Déziel et al., 2004; McGrath et al., 2004; Wade et al., 2005) and with RhlR/C4-HSL negatively regulating pqsR and pqsA (Wade et al., 2005; Xiao et al., 2006). The AQ system in turn positively regulates the rhl system (Heeb et al., 2011). All three QS systems have their own regulons that partially overlap. Target genes of QS in P. aeruginosa include extracellular enzymes such as elastase and alkaline protease, secondary metabolites, such as pyocyanin, siderophores, rhamnolipids, and hydrogen cyanide, and are involved in biofilm formation (Dubern and Diggle, 2008). For many QS-regulated genes, co-regulation by other factors is additionally required, and P. aeruginosa possesses various other signalling pathways and global regulators with partially overlapping regulons (Schuster and Greenberg, 2007). Additionally, the QS systems themselves are subject to a number of additional regulators further modulating the QS response (Juhas et al., 2005; Schuster and Greenberg, 2006). QS together with these mechanisms shape the behaviour of this bacterium in response to changing environmental conditions. Biofilm formation as QS-mediated interaction Biofilms are considered to be the predominant lifestyle of bacteria in the environment (Costerton et al., 1995). Biofilm formation as coordinated activity can be influenced by QS, and there is a difference in gene expression in cells living in a biofilm compared to planktonic cells (Hentzer et al., 2003; Lazazzera, 2005; Dötsch et al., 2012). Biofilms are defined as matrix-enclosed bacterial populations or communities that adhere to each other and are either attached to a surface or freely floating (Costerton et al., 1995). The development of a biofilm is described as a five-stage process (Stoodley et al., 2002). In the beginning of biofilm formation planktonic cells reversibly attach to a surface (stage 1), before they produce extracellular polymeric substances (EPS), which are composed of proteins, polysaccharides, and nucleic acids, leading to irreversible attachment (stage 2) and the formation of microcolonies (stage 3). These subpopulations start to interact with each other forming macrocolonies, and the biofilm structure develops (stage 4), before single cells actively disperse from the biofilm (stage 5). Biofilms are highly structured containing channels for nutrient and oxygen supply, and cells within a biofilm can be 7

GENERAL INTRODUCTION physiologically specialized. One important characteristic of cells within biofilms is their increased resistance to environmental stress and antimicrobial agents.

Co-culture model systems for interspecific interactions employed in this thesis In nutrient-limited environments like the oligotrophic Lake Constance, interspecific interactions during competition for nutrients are likely to occur. In these environments the concentration of dissolved organic matter is low, and organic particles are therefore considered as hot spots for microbial metabolic processes (Simon et al., 2002; Azam and Malfatti, 2007). In aquatic systems polymeric organic compounds constitute a major portion of total organic matter, and are, thus, a major food source for heterotrophic bacteria (Unanue et al., 1999). As polymers are too large to be directly taken up by bacterial cells, their degradation starts as an extracellular process mediated by extracellular hydrolytic enzymes. The resulting oligo- and monomers are subsequently taken up by the cells. The degradation of polymers may therefore lead to different interspecific interactions of bacteria. In particular, bacteria that invest energy in enzyme production (investor bacteria) face the danger of being exploited by bacteria that scavenge the degradation products (opportunistic bacteria). To investigate this interspecific interaction scenario during polymer degradation we set up two different co-culture model systems with chitin as substrate. Chitin is the second most abundant polysaccharide on earth after cellulose and the most abundant in aquatic systems (Gooday, 1990; Pruzzo et al., 2008), as it is part of the cell wall of molds and certain green algae, and a major constituent of the cuticles and exoskeletons of worms, molluscs, and arthropods (Keyhani and Roseman, 1999). It has been estimated that more than 1011 tons of chitin are produced annually in the aquatic biosphere (Keyhani and Roseman, 1999). Chitin is composed of linear strains of β-1,4-linked N-acetylglucosamine (GlcNAc) residues that are cross-linked by hydrogen bonds. As investor bacterium in both co-culture model systems, we employed the Gramnegative Gammaproteobacterium Aeromonas hydrophila. Aeromonads are abundant in aquatic environments, and A. hydrophila, which is an important fish pathogen and can also infect humans (von Graevenitz, 1987), was isolated from Lake Constance (Styp von Rekowski et al., 2008). A. hydrophila possesses a QS system, the ahy system, employing C4-HSL as signal molecule (Swift et al., 1997). For the degradation of chitin, this bacterium releases extracellular chitinases, which 8

GENERAL INTRODUCTION hydrolyse the glycosidic bonds of chitin, before chitin oligomers are taken up into the cells (Li et al., 2007; Lan et al., 2008). Thus, A. hydrophila invests energy into enzyme production and faces the danger of being exploited by opportunistic bacteria matching the criteria of an investor bacterium. As opportunistic bacterium in the first co-culture model system, we employed Flavobacterium sp. strain 4D9, which had been isolated from Lake Constance as well (Styp von Rekowski et al., 2008). Flavobacteria, some species of which are fish pathogens (Duchaud et al., 2007), form a group together with Cytophaga species and are members of the diverse phylum of Gram-negative bacteria known as the Bacteroidetes (McBride et al., 2009). Members of the Cytophaga-Flavobacterium group are abundant in aquatic systems and are known polymer degraders (Kirchman, 2002; Alonso et al., 2007). N-acyl-HSL-mediated QS was described for a member of the marine Bacteroidetes (Romero et al., 2010), but until now, QS has not been reported for members of the Cytophaga-Flavobacterium group (Bruhn et al., 2005). Genome analysis of members of this group of bacteria suggests that chitin degradation proceeds via cell-bound chitinases, which would create a close linkage between chitin hydrolysis and oligomer uptake (McBride et al., 2009). In aquatic habitats, however, polymers are usually entangled into larger aggregates (Simon et al., 2002; Azam and Malfatti, 2007), making it difficult for bacteria with cell-associated enzymes to get into contact with the polymers, and presumably forcing them to scavenge oligo- and monomers produced by others. To account for this situation in this co-culture, chitin was embedded into agarose. As opportunistic bacterium in the second co-culture model system, we employed the Gram-negative

Gammaproteobacterium

P.

aeruginosa.

P.

aeruginosa

is

a

metabolically versatile bacterium and a primary agent of opportunistic human infections (Driscoll et al., 2007), which is especially dangerous for individuals suffering from cystic fibrosis or being immunocompromised (Gang et al., 1999; Jones et al., 2010). Apart from that, P. aeruginosa can be found in various environmental habitats (Ringen et al., 1952; Pellet et al., 1983; Hardalo and Edberg, 1997) and has also been detected in Lake Constance (Hans Güde, ISF Langenargen, personal communication). As described above, P. aeruginosa possesses three QS and various signalling systems that control production of several virulence factors in response to environmental changes. Even though both a chitinase and a chitinbinding protein are encoded in the genome of P. aeruginosa, this bacterium was 9

GENERAL INTRODUCTION reported not to grow with chitin (Folders et al., 2000; Folders et al., 2001). In this coculture, suspended chitin was used as substrate. Thus, both co-culture model systems consisted of bacteria that co-exist in the environment and a polymer that occurs in the natural habitats of these bacteria.

Aims of this thesis The general interest underlying this thesis was to study interspecific interactions of bacteria during competition for nutrients. For this, co-culture model systems for interspecific interactions during polymer degradation should be established. The aim of this thesis was to apply these model systems to identify strategies, which are employed by the bacteria involved in order to prevail in the interactions. Furthermore, once these strategies had been identified and characterized, we aimed at investigating genes and regulatory pathways underlying these strategies.

10

CHAPTER 1

Interactions of bacteria with different mechanisms for chitin degradation result in the formation of a mixed-species biofilm Nina Jagmann, Katharina Styp von Rekowski, Bodo Philipp

FEMS Microbiology Letters (2012) 326(1): 69-75

Abstract In this study, interactions between bacteria possessing either released or cellassociated enzymes for polymer degradation were investigated. For this, a co-culture of Aeromonas hydrophila strain AH-1N as an enzyme-releasing bacterium and of Flavobacterium sp. strain 4D9 as a bacterium with cell-associated enzymes was set up with chitin embedded into agarose beads to account for natural conditions, under which polymers are usually embedded in organic aggregates. In single cultures strain AH-1N grew with embedded chitin, while strain 4D9 did not. In co-cultures, strain 4D9 grew and outcompeted strain AH-1N in the biofilm fraction. Experiments with cell-free culture supernatants containing the chitinolytic enzymes of strain AH-1N revealed that growth of strain 4D9 in the co-culture was based on intercepting Nacetylglucosamine from chitin degradation. For this, strain 4D9 had to actively integrate into the biofilm of strain AH-1N. This study shows that bacteria using different chitin degradation mechanisms can co-exist by formation of a mixed-species biofilm.

Introduction Degradation of polymers by heterotrophic bacteria has to be initiated as an extracellular process. For this, bacteria produce extracellular hydrolytic enzymes that degrade the polymer into oligomers and monomers that can be taken up by the cells. Extracellular hydrolytic enzymes can either be released into the environment, or they

11

CHAPTER 1 AEROMONAS HYDROPHILA – FLAVOBACTERIUM SP. INTERACTIONS can remain associated to the cells (Wetzel, 1991; Vetter and Deming, 1999). Both degradation mechanisms have contrasting advantages and disadvantages. Enzyme-releasing bacteria bear a risk of not being rewarded by their energetic investment, because the polymer degradation products may be lost by diffusion or by scavenging by opportunistic bacteria (also called cheaters), which do not release extracellular enzymes (Allison, 2005). Bacteria with cell-associated enzymes minimize that risk by achieving a tight coupling between the hydrolysis of polymers and the uptake of oligo- and monomers. However, polymeric substrates in the open water do not usually occur as free compounds but are embedded into larger organic aggregates or assembled to complex organic gels (Simon et al., 2002; Verdugo et al., 2004; Azam and Malfatti, 2007). While bacteria with cell-associated enzymes have only limited access to polymers embedded within such networks, enzymereleasing bacteria are able to hydrolyze these polymers. Bacteria with these contrasting mechanisms for polymer degradation co-exist in aquatic environments and are, consequently, interacting with each other during competition for the respective polymer. Thus, both bacteria must have strategies to compensate for the respective disadvantages of their degradation mechanisms during these interactions. Chitin, a polymer of β-1,4-linked N-acetyl–D-glucosamine (GlcNAc) is the most abundant polymer in aquatic environments (Gooday, 1990; Pruzzo et al., 2008). Chitin degradation via released chitinases has been well described for marine bacteria of the genera Vibrio and Pseudoalteromonas (Keyhani and Roseman, 1999; Baty et al., 2000; Meibom et al., 2004) and for freshwater bacteria of the genus Aeromonas (Janda, 1985; von Graevenitz, 1987; Lan et al., 2008). On the contrary, chitin degradation via cell-associated chitinases is largely unexplored. It has been described that many chitinolytic bacteria of the Cytophaga/Flavobacterium-group of the Bacteroidetes, which are abundant inhabitants of marine and freshwater environments and contribute significantly to polymer degradation in the open water (Cottrell and Kirchman, 2000; Kirchman, 2002; Lemarchand et al., 2006; Alonso et al., 2007, Beier and Bertilsson, 2011), do not release chitinases (Sundarraj and Bath, 1972; Gooday, 1990). Recent genome analyses of several Bacteroidetes such as Flavobacterium johnsoniae suggest that chitin degradation in this group of bacteria proceeds via surface-bound chitinolytic enzymes that are very similar to the welldescribed starch utilization system (sus) of Bacteroides thetaiotaomicron (Bauer et al., 2006; Xie et al., 2007; Martens et al., 2009; McBride et al., 2009). 12

FORMATION OF A MIXED-SPECIES BIOFILM The goal of our study was to investigate interactions of bacteria with contrasting mechanisms for chitin degradation to identify the strategies they apply for overcoming their respective disadvantages. As this is difficult to study within natural communities, we set up a reductionistic laboratory model system with a defined coculture of aquatic bacteria, Aeromonas hydrophila strain AH-1N and Flavobacterium sp. strain 4D9. Previously, we reported that strains of Aeromonas and of the Cytophaga/Flavobacterium group were dominant in the same enrichment cultures, in which the microflora of the littoral zone of the oligotrophic Lake Constance had been supplied with artificial organic particles as substrate (Styp von Rekowski et al., 2008). Thus, members of these bacterial groups co-exist in the same environment. As described above for polymers in general, naturally occurring chitin is usually linked to other organic components such as proteins or glucans (Gooday, 1990). To account for this in our study, we embedded chitin into agarose beads.

Material and Methods Cultivation of bacteria Aeromonas hydrophila strain AH-1N (Lynch et al., 2002) and Flavobacterium sp. strain 4D9, a Lake Constance isolate formerly called Cytophaga sp. strain 4D9 (Styp von Rekowski et al., 2008; gene bank accession number EF395377), were cultivated in the mineral medium B (Jagmann et al., 2010). When acetate (5 mM) and tryptone (0.1 %) were used as carbon and energy sources, 5 mM NH4Cl was present in the medium. When suspended chitin (0.5 % (w/v)), embedded chitin (2 chitin-containing agarose beads per test tube) or GlcNAc (5 mM) served as carbon, energy and nitrogen source, ammonium was omitted from the medium. Both strains were maintained on solid (1.5 % w/v agar) medium B plates containing 1 % tryptone. Preparation of suspended and embedded chitin Suspended chitin was prepared as described previously (Jagmann et al., 2010). For preparation of embedded chitin, medium B was supplied with suspended chitin and with agarose (GenAgarose, LE; Genaxxon) both to final concentrations of 1 %. After autoclaving 25 ml of the suspension were poured into a Petri dish (diameter 8.5 cm). Agarose beads were punched out with a truncated 1 ml pipette tip. Each bead had a

13

CHAPTER 1 AEROMONAS HYDROPHILA – FLAVOBACTERIUM SP. INTERACTIONS volume of about 100 µl and contained chitin with a GlcNAc content of approximately 5 µmoles. Growth experiments All growth experiments were carried out in a volume of 4 ml in 15 ml test tubes. Precultures of strains AH-1N and 4D9 were incubated in medium B containing tryptone on an orbital shaker (SI50 Orbital Incubator; Stuart Scientific) at 200 r.p.m. for 1316 h at 21° C. Growth of pre-cultures was measured as optic al density at 600 nm (OD600) with a spectrophotometer. Pre-cultures were harvested by centrifugation at 6000 x g for 3 min, washed with medium B, and were used to inoculate main cultures with suspended or embedded chitin at OD600=0.001 for strain AH-1N and at OD600=0.0005 for strain 4D9, which equals 106 cells ml-1 in both cases. Main cultures with GlcNAc or acetate were inoculated at OD600=0.01 for both strains. Main cultures were incubated on a rotary mixer (scientific workshop; University of Konstanz) at 120 r.p.m. at 16° C. Cell-free culture supernatant of strain AH-1N was prepared by incubating the main cultures with suspended chitin in 100 ml of medium B in a 500 ml Erlenmeyer flask without baffles on an orbital shaker (Innova 4000 incubator shaker; New Brunswick) at 200 r.p.m. for 4 days at 30° C. At this point of time, chitinolytic enzyme activ ities were maximal, and the culture supernatant was processed by two centrifugation steps at 16,100 x g for 15 min at 15° C and filter-sterilization (pore size 0.2 µm ). Before use for growth experiments the supernatant was supplemented in the same way as medium B (Jagmann et al., 2010). Growth of bacteria with acetate or GlcNAc as substrates was measured as OD600 with a spectrophotometer (M107 with test-tube holder; Camspec). Growth of bacteria with suspended or embedded chitin was measured by determination of colony forming units (CFUs) as described previously (Jagmann et al., 2010). Growth of bacteria with embedded chitin was daily inspected for the disappearence of chitin from the agarose beads. When chitin had completely disappeared from the agarose beads, CFUs of the suspended and the biofilm fraction were determined subsequently. To determine CFUs of the biofilm fraction single agarose beads were washed in 500 µl of potassium phosphate buffer (50 mM, pH 6) and processed as described previously (Styp von Rekowski et al., 2008) Colonies of the individual strains in co-cultures could unambiguously be differentiated, because strain AH-1N 14

FORMATION OF A MIXED-SPECIES BIOFILM formed smooth whitish colonies, while strain 4D9 formed structured orange colonies. Colonies of both strains did not show any inhibiting effect on each other. Quantification of substrates and degradation products Suspended chitin in test tubes was quantified by measuring its filling level as described previously (Jagmann et al., 2010). Samples for measuring chitin degradation products were centrifuged in 1.5 ml plastic tubes at 16,100 x g for 15 min at room temperature, and supernatants were stored at -20° C until further analysis. To determine chitin degradation products during incubation in cell-free supernatant of strain AH-1N, samples were centrifuged as described above. Supernatants were subsequently incubated at 100° C for 5 min to inhibit ch itinolytic enzymes. After a further centrifugation step, supernatants were transferred into new plastic tubes and stored at -20° C until further analysis. Acetate, the mono mer, dimer (N,N’diacetylchitobiose (Sigma)) and trimer (N,N’,N’’-triacetylchitotriose (Sigma)) of GlcNAc were determined by ion-exclusion HPLC as described previously (Klebensberger et al., 2006). Ammonium was determined as described previously (GDCH, 1996). Determination of chitinolytic enzyme activities and protein determination Chitinolytic enzyme activities during growth of strains AH-1N and 4D9 with suspended or embedded chitin were determined indirectly with 4-methylumbelliferone (4-MU) derivatized substrates (Colussi et al., 2005). Assays were performed in 96-well black microtiter plates (Nunc) and contained 10 µl of the respective sample and 90 µl of McIlvaine buffer (pH 7). Cell-free culture supernatant was obtained by centrifugation at 16,100 x g for 15 min. To measure chitinolytic enzyme activity in the biofilm fraction single agarose beads were washed in 500 µl medium B and homogenized with a plastic pestle in 100 µl of the same medium. Assays were started by adding 25 µM of either 4-MU-N’-acetyl-β-D-glucosaminide (4MU-GlcNAc, Sigma) for measuring chitobiase activities or 4-MU-N’,N’’-diacetyl-β-Dchitobioside (4-MU-(GlcNAc)2, Sigma) for measuring chitinase activities. Enzyme activities were determined at room temperature by measuring the fluorescence of released 4-MU at 465 nm after exciting at 340 nm in a microplate reader (Genios, Tecan) over a time period of 4 min. Activities were calculated using a 4-MU standard fluorescence curve in the range of 0 to 20 µM. Protein concentrations in culture 15

CHAPTER 1 AEROMONAS HYDROPHILA – FLAVOBACTERIUM SP. INTERACTIONS supernatants were determined using the Pierce BCA Protein Assay Kit (Thermo Scientific).

Results and Discussion Growth in single culture with suspended and embedded chitin To confirm that A. hydrophila strain AH-1N and Flavobacterium sp. strain 4D9 employed different mechanisms of chitin degradation both strains were incubated with suspended and embedded chitin, respectively, as the sole source of carbon, nitrogen, and energy. With suspended chitin strain AH-1N grew concomitant with chitin degradation and reached numbers of 1.5 x 109 CFUs ml-1 within 120 hours (Fig. 1). Cleavage of 4MU-(GlcNAc)2 was detected in cell free culture supernatants with a specific activity of

1010

0

109

20

108

40

107

60

106

80

105 0

50

100

150

200

250

300

chitin decrease [%]

cfu ml-1

120 mU (mg protein)-1 indicating the presence of a released chitinase. With

100 350

time [h]

Fig. 1. Growth of A. hydrophila strain AH-1N and of Flavobacterium sp. strain 4D9 with suspended chitin in single cultures. CFUs of strain AH-1N (filled squares), CFUs of strain 4D9 (filled circles), decrease of chitin in cultures of strain AH-1N (open squares) and of strain 4D9 (open circles). Error bars represent standard deviation (n=3).

embedded chitin strain AH-1N grew in the suspended and in the biofilm fraction attached to the agarose beads. During growth, chitin disappeared from the agarose beads, while the agarose itself was not utilized. Chitin had completely disappeared 16

FORMATION OF A MIXED-SPECIES BIOFILM from the agarose beads after 15 days of incubation. At this point of time, strain AH1N had reached a final number of 3 x 108 CFUs ml-1 in the suspended fraction and 2.2 x 108 CFUs ml-1 in the biofilm fraction (Fig. 2A). Cleavage of 4-MU-(GlcNAc)2 (0.032 mU ml-1) and of 4-MU-GlcNAc (0.013 mU ml-1) indicating the presence of a released chitinase and chitobiase, respectively, could only be detected in the biofilm fraction, while it was below the detection limit in the culture supernatant. When cellfree culture supernatant of strain AH-1N containing chitinolytic enzymes was incubated with embedded chitin only about 40 % of the activity disappeared from the culture supernatant within short time (Fig. 3A). This activity was recovered from the agarose beads at the end of the incubation (not shown). These results indicate that physicochemical interactions alone are not sufficient to cause the strong accumulation of enzymes at the agarose beads in cultures of strain AH-1N. Rather, biofilm formation by strain AH-1N could serve as a strategy for minimizing diffusive loss of released enzymes and degradation products and for preventing exploitation by opportunistic bacteria. Flavobacterium sp. strain 4D9 grew similar to strain AH-1N with suspended chitin and reached numbers of about 1.1 x 109 CFUs ml-1 within 170 hours concomitant with chitin degradation (Fig. 1). In cell-free supernatants of strain 4D9 no chitinolytic activities

could

be

detected.

A

low

4-MU-GlcNAc-cleaving

activity

of

7 mU (mg protein)-1 was detectable when cells of strain 4D9 and chitin were centrifuged and resuspended in fresh medium with 0.1 % of the detergent Triton X100 for solubilising particle-associated enzymes (Rath and Herndl, 1994). This result indicates that chitinolytic enzymes of strain 4D9 are either cell- or chitin-associated. With embedded chitin CFUs of strain 4D9 had increased only slightly in the suspended and the biofilm fraction after 32 days of incubation (Fig. 2A) and chitin did not disappear from the agarose beads. Apparently, strain 4D9 was not able to grow with embedded chitin. If strain 4D9 released chitinases, these enzymes would certainly have reached chitin within the agarose beads (Svitil and Kirchman, 1998). Thus, these results indicated that the chitinolytic enzymes of strain 4D9 were associated to the cells, which is in agreement with genome analyses of F. johnsoniae and other Bacteroidetes. The fact that strain 4D9 could not access embedded chitin clearly illustrated a disadvantage of this chitin degradation mechanism.

17

CHAPTER 1 AEROMONAS HYDROPHILA – FLAVOBACTERIUM SP. INTERACTIONS Growth in co-culture with embedded chitin To investigate whether strain 4D9 had strategies to overcome this disadvantage in co-culture with enzyme-releasing bacteria strains AH-1N and 4D9 were incubated in co-culture with embedded chitin. In these cultures chitin had disappeared from the agarose beads after 32 days of incubation indicating a strong delay in chitin degradation compared to the single culture of strain AH-1N. At this point of time strain AH-1N had reached 5-fold and 8.7-fold lower CFU numbers in the suspended and in the biofilm fraction, respectively, compared to the single culture (Fig. 2A).

1010

A

109

B

107

AH-1 N 4D9 AH-1 N 4D9

cfu ml-1

108

106 105 104 single cocultures culture

t0 suspension

tend suspension

tend biofilm

Fig. 2. A) Growth of A. hydrophila strain AH-1N and of Flavobacterium sp. strain 4D9 with embedded chitin in single and co-cultures. Single cultures of strain AH-1N were incubated for 15 days and single cultures of strain 4D9 as well as the co-cultures were incubated for 32 days. CFUs of the suspended fractions were taken at t=0 and t=end and CFUs of the biofilm fractions were taken at t=end. CFUs of strains AH-1N in single culture (black bars), 4D9 in single culture (dark grey bars), AH-1N in co-culture (light grey bars), and 4D9 in coculture (open bars). Error bars represent standard deviation (n=3); B) Photograph of an agarose bead from a co-culture of A. hydrophila strain AH-1N and of Flavobacterium sp. strain 4D9 with embedded chitin after chitin had been depleted to a large extent; bar equals 1.5 mm.

In contrast, strain 4D9 reached 34-fold higher CFU numbers in the suspended and 13,700-fold higher CFU numbers in the biofilm fraction compared to its single culture (Fig. 2A). Growth of strain 4D9 in the biofilm fraction of the co-culture was visible by 18

FORMATION OF A MIXED-SPECIES BIOFILM the formation of its characteristic orange colonies on the surface of the agarose beads (Fig. 2B). These colonies turned red upon treatment with KOH, indicating the presence of the pigment flexirubin, which is characteristic for bacteria of the Cytophaga/Flavobacterium group (Reichenbach et al., 1980). Apparently, strain 4D9 was able to grow especially in the biofilm fraction of the coculture, even though it could not degrade embedded chitin itself, and it even overgrew strain AH-1N. The strong growth stimulation of strain 4D9 in the biofilm fraction could be the outcome of different strategies. First, strain 4D9 might have been able to access chitin within the agarose bead by penetrating into cavities within the agarose that had resulted from chitin degradation. However, as strain 4D9 only grew on the periphery of the agarose beads (Fig. 2B) this was rather unlikely. Second, strain 4D9 might have grown with organic substrates that were released by strain AH-1N. These could have been either chitin degradation products or other substrates. Identification of growth substrates for strain 4D9 in co-culture with embedded chitin To identify the substrates causing the strong growth stimulation of strain 4D9 in the biofilm fraction of the co-culture, it was first analyzed which compounds were released during growth of strain AH-1N with embedded chitin in single cultures. These analyses revealed that acetate and ammonium were transiently released, while GlcNAc and its oligomers could not be detected (not shown). However, strain 4D9 grew very poorly with acetate (Fig. 4) ruling out this compound as a substrate. Second, it was analyzed which products are formed by chitinolytic enzymes of strain AH-1N by incubating embedded chitin in cell-free supernatant of this strain. During this incubation chitin largely disappeared from the agarose beads, and HPLC analysis showed that up to 2 mM of GlcNAc accumulated (Fig. 3B). As strain 4D9 could grow with GlcNAc (Fig. 4), growth of strain 4D9 in the co-culture might be based on GlcNAc. To investigate this possibility, strain 4D9 was incubated with embedded chitin in cell-free supernatant of strain AH-1N. In these cultures GlcNAc did not accumulate and strain 4D9 reached about 1.400-fold higher CFU numbers in the suspended fraction (Fig. 5A) and about 64-fold higher CFU numbers in the biofilm fraction (Fig. 5B) compared to the control, in which strain 4D9 was incubated with embedded chitin in medium B. If embedded chitin was omitted from cell-free culture supernatant strain 4D9 reached only 48-fold higher CFU numbers in the suspended 19

CHAPTER 1 AEROMONAS HYDROPHILA – FLAVOBACTERIUM SP. INTERACTIONS fraction compared to the control (Fig. 5A). This relatively small growth must have been due to organic compounds in the culture supernatant of strain AH-1N, which have not been identified so far. These results indicated that GlcNAc released from chitin by the chitinolytic enzymes of strain AH-1N was most likely the main growth substrate for strain 4D9 in the co-culture.

B

100

2.5

80

2 GlcNAc [mM]

[ %] of control

A

60 40 20

1.5 1 0.5

0

0 0

20

40

60

80

time [h]

100

120

140

0

1

2

3

4

5

6

time [d]

Fig. 3. Characterization of chitinolytic enzyme activities in cell-free culture supernatants of A. hydrophila strain AH-1N incubated with embedded chitin (four chitin-containing agarose beads). A) Activity of chitinases (cleavage of 4-MU-(GlcNAc)2) for determining absorption of chitinolytic enzymes to the agarose beads over time. Values are expressed as percentages of control measurements (set to 100 %) from supernatants incubated without agarose beads; B) Release of GlcNAc from embedded chitin by chitinolytic enzymes. Error bars represent standard deviation (n=3).

As GlcNAc could not be detected in the supernatant of single cultures of strain AH1N with embedded chitin, this bacterium apparently exhibited a tight coupling of polymer hydrolysis and GlcNAc uptake. To interfere with this tight coupling strain 4D9 had to actively integrate into the biofilm for establishing a close contact to zones of chitin hydrolysis and GlcNAc release. This was supported by the fact that in the presence of strain AH-1N strain 4D9 grew mainly in the biofilm fraction (Fig. 2A), while it grew mainly in the suspended fraction when incubated in cell-free supernatant only (Fig. 5AB) indicating that there was no selective pressure for biofilm formation in the absence of strain AH-1N. As the growth rate with GlcNAc of strain AH-1N (µ = 0.133 h-1) was about 3 times higher than the growth rate of

20

FORMATION OF A MIXED-SPECIES BIOFILM 1 0,8

OD600

0,6 0,4 0,2 0 50

0

100

150

200

time [h]

Fig. 4. Growth of A. hydrophila strain AH-1N (squares) and of Flavobacterium sp. strain 4D9 (circles) with GlcNAc (filled symbols) and acetate (open symbols). Error bars represent standard deviation (n=3).

B

1010

1010

109

109

108

108 cfu ml-1

cfu ml-1

A

107

107

106

106

105

105 104

104 0

1

2

3

4

time [d]

5

6

tend biofilm

Fig. 5. Influence of cell-free culture supernatant of A. hydrophila strain AH-1N containing chitinolytic enzymes on growth of Flavobacterium sp. strain 4D9 with embedded chitin. A) Growth of strain 4D9 in the suspended fraction: CFUs with (circles) and without (diamonds) embedded chitin in culture supernatant, and with embedded chitin in medium B (negative control without culture supernatant; triangles); B) Growth of strain 4D9 in the biofilm fraction after 5 days of incubation: CFUs with embedded chitin in culture supernatant (light grey bar) and in medium B (negative control without culture supernatant; dark grey bar). Error bars represent standard deviation (n=3).

21

CHAPTER 1 AEROMONAS HYDROPHILA – FLAVOBACTERIUM SP. INTERACTIONS strain 4D9 (µ = 0.046 h-1) (Fig. 4), strain 4D9 must be more efficient in the uptake of GlcNAc than strain AH-1N to be able to intercept GlcNAc. This would decrease the rates of growth and of chitinolytic enzyme production of strain AH-1N and could explain the observed delay of chitin degradation in the co-culture compared to the single culture of strain AH-1N. Altogether, integration into the biofilm for exploiting chitinolytic enzymes of strain AH-1N could serve as a strategy of strain 4D9 to overcome its inability to degrade embedded chitin itself.

Conclusions A. hydrophila strain AH-1N as an enzyme-releasing bacterium has to find a trade-off between the benefit of accessing embedded polymers and the risk of being exploited, while Flavobacterium sp. strain 4D9 as bacterium with cell-associated enzymes has to find a trade-off between the benefit of avoiding exploitation and the risk of limited access to embedded polymers. In co-culture the outcome of these contrasting trade-offs was the formation of a mixed-species biofilm on the chitin-containing particle. Despite being exploited, enzyme-releasing bacteria like strain AH-1N occupy a stable ecological niche, in particular in nutrient-limited environments, as the release of extracellular hydrolytic enzymes is an essential prerequisite for making obstructed organic substrates bioavailable. Bacteria with cell-associated enzymes like strain 4D9 or other Bacteroidetes must develop strategies to act as opportunists or cheaters. Integration into the biofilm of enzyme-releasing bacteria might be a general strategy of these bacteria and could be one of the reasons why Bacteroidetes are so abundant in the particle-associated fractions in aquatic environments (DeLong et al., 1993; Kirchman, 2002; Azam and Malfatti, 2007).

Acknowledgements The authors thank Bernhard Schink for continuous support. This work was funded by the Deutsche Forschungsgemeinschaft (DFG) in the framework of the Collaborative Research Center SFB454 “Littoral Zone of Lake Constance” (project B9).

22

CHAPTER 2

Parasitic growth of Pseudomonas aeruginosa in co-culture with the chitinolytic bacterium Aeromonas hydrophila Nina Jagmann, Hans-Philipp Brachvogel, Bodo Philipp

Environmental Microbiology (2010) 12(6): 1787-1802

Abstract Polymer-degrading bacteria face exploitation by opportunistic bacteria that grow with the degradation products without investing energy into production of extracellular hydrolytic enzymes. This scenario was investigated with a co-culture of Aeromonas hydrophila and Pseudomonas aeruginosa with chitin as carbon, nitrogen, and energy source. In single cultures, A. hydrophila could grow with chitin, while P. aeruginosa could not. Co-cultures with both strains had a biphasic course. In the first phase, P. aeruginosa grew along with A. hydrophila without affecting it. The second phase was initiated by a rapid inactivation of and a massive acetate release by A. hydrophila. Both processes coincided and were dependent on quorum sensing-regulated production of secondary metabolites by P. aeruginosa. Among these the redox-active phenazine compound pyocyanin caused the release of acetate by A. hydrophila by blocking the citric acid cycle through inhibition of aconitase. Thus, A. hydrophila was forced into an incomplete oxidation of chitin with acetate as end product, which supported substantial growth of P. aeruginosa in the second phase of the co-culture. In conclusion, P. aeruginosa could profit from a substrate that was originally not bioavailable to it by influencing the metabolism and viability of A. hydrophila in a parasitic way.

Introduction In nutrient-limited environments competition for substrates inevitably enforces interspecific interactions among bacteria. Such interactions can particularly be 23

CHAPTER 2 AEROMONAS HYDROPHILA – PSEUDOMONAS AERUGINOSA INTERACTIONS expected during utilization of polymeric organic compounds, which is related to the fact that their degradation starts as an extracellular process. Bacterial degradation of polymers, such as polysaccharides like chitin or cellulose, is generally initiated by extracellular hydrolytic enzymes, causing the release of oligomers and monomers, which are subsequently taken up and further metabolized by the bacterial cells (Keyhani and Roseman, 1999; Lynd et al., 2002). This common and widespread degradation strategy implies a risk for those bacteria that produce extracellular hydrolytic enzymes, because the resulting hydrolysis products are also available for bacteria that did not produce these enzymes. In consequence, the enzyme-producing bacteria (investors), which had invested energy into protein biosynthesis, may not fully benefit from their investment, while the other bacteria obtain nutrients without this energy investment (opportunists). Investors and opportunists must have strategies to secure degradation products for growth. For investor bacteria, this could be achieved by a tight coupling of polymer degradation with the uptake of oligo- and monomers. Alternatively, investor bacteria could also actively suppress growth of opportunistic bacteria by bioactive compounds. Opportunistic bacteria may acquire growth substrates by a broad metabolic flexibility and versatility to utilize any exudation from polymer-degrading investor bacteria, by very efficient uptake-systems for degradation products, or by inhibition of polymer-degrading investor bacteria. The opportunistic bacteria must accomplish a trade-off of exploitation of and stable coexistence with the investor bacteria to allow it to initiate polymer degradation, because otherwise growth of the opportunists would also be suppressed. This investor-opportunist scenario could play an important ecological role in oligotrophic aquatic systems, where polymeric organic compounds constitute a major portion of organic matter and are, thus, an important nutrient source for heterotrophic bacteria (Unanue et al., 1999). In aquatic systems, extracellular degradation is often the rate-limiting step in the degradation of polymers (Chróst and Rai, 1993). Interactions between investors and opportunists could therefore be a relevant factor for the rates of organic matter turnover and of bacterial biomass production as well as for the composition of the community of heterotrophic bacteria in oligotrophic aquatic systems. Despite the obvious ecological importance and the great general interest in interspecific bacterial interactions (Ryan and Dow, 2008; Haruta et al., 2009; Straight and Kolter, 2009; Hibbing et al., 2010), interactions between investors and opportunists during polymer degradation have not been subject of detailed 24

PARASITIC GROWTH STRATEGY OF PSEUDOMONAS AERUGINOSA studies. Thus, our goal was to establish an appropriate model system for studying interactions of this kind. For this, we set up a defined co-culture with Aeromonas hydrophila strain AH-1N as the investor and Pseudomonas aeruginosa strain PAO1 as the opportunist and with chitin as the sole source of carbon, nitrogen, and energy. Chitin, a linear polysaccharide of β-(1,4)-linked N-acetylglucosamine (GlcNAc) residues, is the most abundant polymer in aquatic systems (Gooday, 1990; Pruzzo et al., 2008). Aeromonads are aquatic Gammaproteobacteria, and many of them, such as A. hydrophila, are chitinolytic and employ extracellular chitinases for the breakdown of chitin (Li et al., 2007; Lan et al., 2008). In this respect, A. hydrophila is appropriate for the investor role. Pseudomonas aeruginosa is reported not to grow with chitin (Folders et al., 2001), although it produces a chitinase (ChiC; PA2300) and a chitinbinding protein (CbpD; PA0852) (Folders et al., 2000; Nouwens et al., 2003; Kay et al. 2006; Manos et al., 2009). P. aeruginosa is metabolically versatile (Clarke, 1982; Mena and Gerba, 2009), and it is known to inhibit other bacteria by quorum sensingregulated secondary metabolites during competition for nutrients (Norman et al., 2004; Straight and Kolter, 2009). In these respects, P. aeruginosa has the potential for an efficient opportunist in our scenario. As both bacteria occur in freshwater habitats and prefer similar environmental conditions, such as moderate temperature and neutral pH values, they are likely to encounter each other (Janda, 1985; von Graevenitz, 1987; Römling et al., 1994; van Asperen et al., 1995; Hardalo and Edberg, 1997; Mena and Gerba, 2009). In summary, our model system with these two well-characterised bacteria has ecological relevance and offers the opportunity to investigate interspecific interactions at the physiological and molecular level. We initiated our study by investigating whether P. aeruginosa could benefit from chitin degradation by A. hydrophila.

Material and Methods Bacterial strains and growth media Bacterial strains and plasmids used in this study are listed in table 1. For cultivation of P. aeruginosa and A. hydrophila strains in liquid culture a mineral medium designated medium B was used. Medium B contained the following components: 25

CHAPTER 2 AEROMONAS HYDROPHILA – PSEUDOMONAS AERUGINOSA INTERACTIONS 50 mM HEPES (pH 7), 0.5 mM MgSO4, 14 mM KCl, 7.2 mM NaCl, 5 mM NH4Cl. After autoclaving, the medium was complemented with 0.01 mM CaCl2, 0.15 mM NaK-phosphate buffer (pH 7; 0.105 mM K2HPO4, 0.045 mM NaH2PO4) and the trace element solution SL10 (Widdel et al., 1983). Acetate and tryptone were used as carbon and energy sources. If Chitin, N-acetylglucosamine (GlcNAc), N,N’diacetylchitobiose ((GlcNAc)2, Sigma), N,N’,N’’-triacetylchitotriose ((GlcNAc)3, Sigma), and glucosamine served as carbon, energy, and nitrogen sources, ammonium was omitted from the medium. P. aeruginosa strain PAO1, A. hydrophila strain AH-1N and unmarked deletion mutants of strains PAO1 and AH-1N were maintained on solid (1.5 % w/v agar) medium B plates containing 1 % tryptone. P. aeruginosa strain PAO1-Tn7-cfp was maintained on solid medium B plates containing 1 % w/v tryptone and 30 µg ml-1 chloramphenicol. Plasmid-harbouring E. coli strain S17-1 was selected and maintained on LB plates containing 100 µg ml-1 ampicillin. Insertional mutants of P. aeruginosa were selected on Pseudomonas isolation agar (PIA; Difco) containing 500 µg ml-1 carbenicillin. For colony forming unit (CFU) counts, LB plates were used. Additionally, unmarked P. aeruginosa strains were selected on PIA plates containing 20 µg ml-1 tetracycline, and P. aeruginosa strain PAO1-Tn7-cfp was selected on LB plates containing 30 µg ml-1 chloramphenicol. Preparation of suspended chitin Suspended chitin was prepared according to a modified protocol (Reichenbach, 2006). 20 g of commercial chitin flakes (practical grade; Sigma) were added to 400 ml HCl (37 %) under stirring until a homogenous slurry was obtained. After stirring for 20 min the suspension was poured into 5 l of ice-cold deionized water. After stirring for 10 min the suspension was filtered through a cellulose coffee filter, and the chitin was washed repeatedly with deionized water until a pH value of about 4 was reached. After resuspension of the chitin in deionized water and adjusting the pH to 7 with NaOH, the suspension was again filtered through a cellulose filter, and the chitin was resuspended in 1 l of medium B to obtain a final concentration of 2 % (w/v). The chitin suspension was transferred into bottles and autoclaved. For cultivation a final chitin concentration of 0.5 % (w/v) was used.

26

PARASITIC GROWTH STRATEGY OF PSEUDOMONAS AERUGINOSA Table 1. Strains and plasmids used in this study Strains and plasmids Pseudomonas aeruginosa PAO1 PAO1(ATCC) PAO1-Tn7-cfp

PAO1(ATCC)∆lasI∆rhlI

PAO1∆pqsA PAO1∆pqsH PAO1∆pqsR PAO1∆pvdD∆pchEF

PAO1∆lecA PAO1∆lecB PAO1-KO[chiC] PAO1-KO[cbpD] Aeromonas hydrophila AH-1N AH-1N∆ahyI Escherichia coli S17-1 Plasmids pKnockout-G pKO[chiC]

pKO[cbpD]

Relevant characteristics

Source or Reference

PAO1 Nottingham wildtype PAO1 wildtype ATCC 15692 PAO1 with Tn7 chromosomal insertion of cfp

Holloway collection ATCC This study

PAO1(ATCC) with Tc cartridge inserted into unique EcoRI site of rhlI and with Gm cartridge inserted into unique EcoRI site of lasI pqsA deletion mutant, PQS negative pqsH deletion mutant pqsR deletion mutant pvdDpchEF deletion mutant; pyoverdine and pyochelin negative lecA deletion mutant lecB deletion mutant PAO1, chiC::pKO[chiC] PAO1, cbpD::pKO[cbpD]

Beatson et al., 2002

Aendekerk et al., 2005 Fletcher et al., 2007 University of Nottingham Ghysels et al., 2004

University of Nottingham University of Nottingham This study This study

AH-1N wildtype ahyI deletion mutant, AHL negative

Swift et al., 1999 Lynch et al., 2002

thi pro hsdR hsdM+ recA RP4-2-Tc::Mu-Km::Tn7

Simon et al., 1983

Suicide vector used for gene inactivation (Apr, Gmr) pKnockout-G harbouring an internal PstI fragment (798 bp) of chiC pKnockout-G harbouring an internal HincII fragment (606 bp) of cbpD

Windgassen et al., 2000 This study

This study

Growth experiments All growth experiments were performed at 30° C. Pre-cultures of strains AH-1N and PAO1 were incubated in 4 ml of medium B containing 0.1 % tryptone in 15 ml test tubes on a rotary shaker (innova 4000 incubator shaker; New Brunswick or KS4000i control; IKA) at 200 r.p.m. for 13-16 h at 30° C. Growth o f pre-cultures was measured as optical density at 600 nm (OD600) with a spectrophotometer. Pre-cultures were harvested by centrifugation at 9300 x g for 5 min, washed with medium B without 27

CHAPTER 2 AEROMONAS HYDROPHILA – PSEUDOMONAS AERUGINOSA INTERACTIONS ammonium and complementing solutions, and were used to inoculate main cultures at OD600=0.001 for both strains, which equals 106 cells ml-1. Main cultures were incubated on a rotary shaker at 200 r.p.m., unless indicated otherwise. For growth experiments with chitin, main cultures were incubated in 4 ml of medium B in 15 ml test tubes or in 100 ml of medium B in a 500 ml Erlenmeyer flask without baffles. For growth experiments with GlcNAc (5 mM), glucosamine (5 mM), tryptone (0.1 % or 0.5 %) and acetate (10 mM) main cultures were incubated in 4 ml of medium B in 15 ml test tubes. For growth experiments with (GlcNAc)2 (2.5 mM) and (GlcNAc)3 (1.7 mM) main cultures were incubated in 400 µl of medium B in 48-wellmicrotiter plates (Nunc) on a rotary shaker at 180 r.p.m.. Bacterial growth in single and co-cultures with chitin and/or tryptone was measured by determination of CFUs. An aliquot of 20 µl of each culture was diluted in a decimal series in 180 µl of medium B without ammonium and complementing solutions. From appropriate dilution steps, three aliquots of 10 µl were used for CFU counts by the drop plate method (Hoben and Somasegaran, 1982). Colonies of strains PAO1 and AH-1N were distinguished by colony morphology, and colonies of PAO1 were additionally selected using antibiotics (see above). The detection limit of strain AH-1N in co-cultures was 105 CFUs ml-1, because the respective dilution still allowed the unambiguous detection of colonies of strain AH1N in the presence of higher colony numbers of strain PAO1. Growth of single cultures with GlcNAc, glucosamine or acetate as carbon sources was measured as OD600 with a spectrophotometer (model M107 with test-tube holder; Camspec). Growth of single cultures with (GlcNAc)2 and (GlcNAc)3 was measured as OD595 in a microplate reader (Genios, Tecan). Total cell counts (TCCs) were determined as described previously (Styp von Rekowski et al., 2008). Construction of plasmids and insertional mutants Genomic DNA of strain PAO1 was purified with the Puregene Tissue Core Kit B (Qiagen).

PA2300

(chiC)

was

amplified

TGGTAGACGCTCGCGCCTGTTTTT-3´)

using

the

and

primer

chiC-F

chiC-R

(5´(5´-

GCTCTCGCCGGCCAAAGGAC-3´). PA0852 (cbpD) was amplified using the primer cbpD-F

(5´-CCGTCACATTTGGTAGGGAC-3´)

and

cbpD-R

(5´-

GCTTGAACAGGCACACGTAG-3´). To construct the plasmids pKO[chiC] and pKO[cbpD] an internal PstI fragment of chiC and an internal HincII fragment of cbpD, 28

PARASITIC GROWTH STRATEGY OF PSEUDOMONAS AERUGINOSA respectively, were cloned into the respective restriction sites of the suicide vector pKnockout-G (Windgassen et al., 2000).The resulting plasmids were transferred into strain PAO1 by bi-parental mating with E. coli strain S17-1 as donor. E. coli strain S17-1 (donor) was grown in LB medium with 100 µg ml-1 ampicillin at 200 r.p.m. at 30° C, while strain PAO1 (recipient) was grown in LB medium at 50 r.p.m. at 42° C. After incubation overnight, 5 x 108 cells of the donor and 1 x 109 cells of the recipient were harvested by centrifugation at 9300 x g for 1.5 min, washed with 500 µl of prewarmed LB medium, and finally resuspended in 50 µl of LB medium. Donor and recipient were carefully mixed by pipetting and spread onto sterile membrane filters (Durapore membrane filters, 0.22 µm GV; Millipore) that were placed on pre-warmed LB plates. After incubation for 6 h at 37° C, the filters w ere transferred to a 12 ml plastic tube containing 2 ml of 0.9 % NaCl. After vortexing, the cell suspensions were transferred to a 2 ml plastic tube, centrifuged at 9300 x g for 2 min and resuspended in 600 µl of 0.9 % NaCl. Aliquots of the cell suspensions were spread on PIA plates containing 500 µg ml-1 carbenicillin to select for insertional mutants of PAO1. Correct chromosomal insertion of the plasmids was confirmed by PCR with the primers pKOG

(5´-GCGCGTTGGCCGATTCATTA-3´)

and

chiC-check-R

(5´-

GTGAAGGCTACCGGCGGC-3´) or cbpD-check-R (5´-GCTGACCGCCCCGTAGG3´). Strain PAO1-Tn7-cfp was constructed as described previously (Klebensberger et al., 2007). Cells suspension experiments with strain AH-1N Precultures of strain AH-1N were incubated for 7-9 h as described above. Main cultures were incubated for 16 hours as described above, harvested by centrifugation at 8300 x g for 5 min and washed with medium B without ammonium and complementing solutions before resuspension in the appropriate medium or sterile culture supernatant to an OD600 of 1. Experiments were performed with 4 ml cell suspension in 15 ml test tubes or with 20 ml cell suspension in 100 ml Erlenmeyer flasks without baffles at 30° C in rotatory shakers at 200 r.p.m.. For cell suspension experiments with supernatant of chitin-grown co-cultures, main cultures of strain AH-1N were grown with 0.5 % tryptone. Co-culture supernatant was obtained by incubating the co-cultures for 5 days as described above before two centrifugation steps at maximum speed for 15 min at 15° C and repeated filtersterilization of the supernatant. For cell suspension experiments with pyocyanin, 29

CHAPTER 2 AEROMONAS HYDROPHILA – PSEUDOMONAS AERUGINOSA INTERACTIONS main cultures of strain AH-1N were grown with 0.5 % tryptone. Cell suspensions were prepared by resuspending the cells in medium B without ammonium with the addition of 5-20 µM pyocyanin (Cayman; 10 mM stock solution in methanol). As a control, only methanol was added. For cell suspension experiments for monitoring the degradation of GlcNAc (3 mM) or acetate (10 mM) in the presence or absence of pyocyanin, main cultures of strain AH-1N were incubated with 10 mM GlcNAc. Cell suspensions were prepared by resuspending the cells in medium B without ammonium and complementing solutions with the addition of 20 µM pyocyanin. For cell suspensions with acetate, ammonium was added to the medium. As a control, only methanol was added. Chitin binding assay Pre-cultures of strains AH-1N, PAO1, PAO1-KO[cbpD], PAO1∆lecA, and PAO1∆lecB were incubated with 0.1 % tryptone for 7 h as described above. Main cultures of these strains were incubated with 0.5 % tryptone for 16 h as described above, harvested by centrifugation at 8300 x g for 5 min and washed with medium B without ammonium and complementing solutions before resuspension in medium B with and without 0.5 % chitin to an OD600 of 1 in 15 ml test tubes. After shaking of the tubes, chitin was allowed to sediment for 30 min before CFUs from the chitin-free supernatant were determined. CFU numbers in cell suspensions without chitin were set as 100 %. Quantification of substrates and degradation products Suspended chitin in test tubes was quantified by measuring its filling level. After shaking of the tubes to obtain a homogenous distribution, chitin was allowed to sediment for 30 min before its filling level was measured. Samples for measurements of degradation products were centrifuged in 1.5 ml plastic tubes at maximum speed for 15 min at room temperature. Supernatants were transferred into new plastic tubes and stored at -20° C until further analysis. Acetate, GlcNAc, (GlcNAc)2, and (GlcNAc)3 were determined by ion-exclusion HPLC as described previously (Klebensberger et al., 2006). Glucosamine was determined by reversed-phase HPLC as described previously (Zhu et al., 2005). Derivatization was performed in 2 ml plastic tubes. 200 µl of borate buffer (200 mM, pH7), 200 µl of 129.35 mg l-1 Fmoc-Cl in acetonitrile and 20 µl of the sample or standard solution (030

PARASITIC GROWTH STRATEGY OF PSEUDOMONAS AERUGINOSA 1 mM D-glucosamine hydrochloride (Sigma) in medium B without ammonium) were mixed and incubated at 20° C for 30 min. Analysis was p erformed with a HPLC system (Prominence liquid chromatograph; Shimadzu) equipped with a diode array detector (SPD M20A; Schimadzu) and a reversed-phase column (EC 150/4.6 Nucleodur 100-3 C18ec; Macherey and Nagel) using the previously described gradient (Zhu et al., 2005) at a flow rate of 0.8 ml min-1. 50 µl were injected onto the column. Ammonium was determined enzymatically with glutamate dehydrogenase. 100 mM TEA buffer (pH 8.6), 5 mM α-ketoglutarate, 150 µM NADPH and 0.96 U glutamate dehydrogenase (Sigma) were mixed in wells of a 96-well-microtiter plate (Nunc) to a final volume of 190 µl. The assay was started by adding 10 µl of the sample or NH4Cl standard (0-2 mM) and incubated at 30° C. The absorption a t 340 nm was measured at time zero and after 20 min in a microplate reader (Genios, Tecan). Determination of phenazines and alkylquinolones The

phenazines

pyocyanin

and

phenazine-1-carboxylate

(PCA)

and

the

alkylquinolones 2-heptyl-4-quinolone (HHQ), 4-hydroxy-2-heptylquinoline-N-oxide (HQNO), and 2-heptyl-3-hydroxy-4-quinolone (Pseudomonas quinolone signal; PQS) in co-culture supernatants were determined by reversed-phase HPLC (see above) with a flow rate of 0.8 ml min-1. A gradient method was applied starting with 10 % acetonitrile for 2 min, rising to 70 % acetonitrile within 10 min, staying at 70 % acetonitrile for 3 min, and returning to 10 % acetonitrile within 1 min, followed by an equilibration of 5 min. 50 µl were injected onto the column. Compounds were identified by co-elution with and by comparison of UV/VIS-spectra of reference compounds. Determination of rhamnolipids The concentration of rhamnolipids in co-culture supernatants was determined after modified protocols (Ramana and Karanth, 1989; Chayabutra et al., 2001; Pinzon and Ju, 2009). 10 ml of co-culture supernatant were acidified (pH 3-4) with 4.5 M sulphuric

acid

and

extracted

twice

with

30

ml

dichloromethane.

After

dichloromethane was evaporated, the solid matter was dissolved in a small volume of methanol. After evaporating methanol under a stream of N2, the solid matter was dissolved in 400 µl of 0.05 M NaHCO3 and mixed with 600 µl of anthron solution 31

CHAPTER 2 AEROMONAS HYDROPHILA – PSEUDOMONAS AERUGINOSA INTERACTIONS (0.005 g l-1 in sulphuric acid) carefully releasing the overpressure. The mixture was incubated at 100° C for 30 min, and the absorption at 4 60 nm was measured with sulphuric acid as reference. For a standard curve, 400 µl of rhamnose (0-1 mM) was mixed with 600 µl of anthron solution and treated as described above. Rhamnolipid concentration was calculated based on the assumption of a 2.5:1 rhamnolipid-torhamnose mass ratio (Pinzon and Ju, 2009). Determination of elastolytic activity, cyanide measurements and detection of siderophores Elastolytic activity of co-culture supernatants was determined with the elastin-congo red (ECR; Sigma) assay (Ohman et al., 1980). A 100 µl aliquot of co-culture supernatant was mixed with 900 µl of ECR buffer (100 mM TRIS/HCl, 1 mM CaCl2, pH 7) containing 8 mg of ECR and incubated with shaking for 21 h at 37° C. The remaining insoluble ECR was removed by centrifugation, and the absorption of the supernatant was measured at 495 nm. ECR buffer was used for the negative control. Cyanide levels were determined using Merckoquant cyanide test strips (Merck). Pyoverdine and pyochelin were qualitatively detected in co-culture supernatants using a fluorescence spectrophotometer (LS50B; Perkin Elmer). Bioassay for AHL production Chitin-grown co-cultures of strains AH-1N and PAO1 and chitin-grown single cultures of strain AH-1N were tested for AHL production in bioassays with the bioluminescent E. coli strains pSB401, pSB536, and pSB1075 (Winson et al., 1998; Yates et al., 2002) as described previously (Styp von Rekowski et al., 2008). At each sampling time aliquots of the co-cultures were centrifuged at maximum speed for 15 min and 50 µl of the supernatant were used in the assay. Oxygen consumption measurements Cells of strains AH-1N and PAO1 were grown in medium B with 10 mM GlcNAc as described above and harvested in late exponential phase by centrifugation at 8300 x g for 10 min at 20° C. Cells were washed once with 50 mM potassium phosphate buffer (pH 7) and finally resuspended in the same buffer to obtain an OD600 of about 20. For oxygen consumption measurements, cell suspensions were diluted with pre-warmed phosphate buffer to an OD600 of 1 (equivalent to a dry weight 32

PARASITIC GROWTH STRATEGY OF PSEUDOMONAS AERUGINOSA of about 0.25 mg) in the reaction chamber of a Clark-type electrode (Rank Brothers Ltd.). After a constant basal oxygen uptake rate was observed, 10 mM GlcNAc, 0.5 mM KCN (50 mM stock solution in 20 mM NaOH) and pyocyanin at different concentrations were successively added to a final volume of 1 ml. Each addition was made after constant oxygen uptake rates had established. Enzyme assays and protein determination Activity of aconitase (EC 4.2.1.3) was measured in cell extracts of strain AH-1N by monitoring the formation of cis-aconitate from isocitrate in a spectrophotometer at 240 nm as described earlier (Hausladen and Fridovich, 1996). For preparing cell extracts, cells of strain AH-1N were grown in medium B with 10 mM GlcNAc as described above and harvested in the mid-exponential phase. For this, cultures were poured into pre-cooled plastic tubes and supplied with 1 mM dithiothreitol (DTT) and 0.5 mM MnCl2 and centrifuged at 8300 x g for 10 min at 4° C. Cells were washed with ice-cold 90 mM TRIS/HCl buffer (pH 8) containing 1 mM DTT and 0.5 mM MnCl2 and finally resuspended in the same buffer to obtain an OD600 of about 20. These cell suspensions were transferred into serum bottles with butyl rubber septa. After exchanging the headspace with nitrogen gas, cells were broken in a pre-cooled French Press under anoxic conditions as described earlier (Philipp and Schink, 1998). Cell extracts were separated from cell debris by centrifugation at 20000 x g for 20 min at 4° C and dispensed into glass vials sealed with butyl rubber septa under anoxic conditions. Anoxic cell extracts were constantly kept on ice and immediately used for determination of aconitase activity. Assay mixtures contained anoxic 90 mM TRIS/HCL buffer (pH 8), 25-50 µl cell extract (ca. 0.1 mg protein) and were started by the addition of 20 mM DL-isocitrate. To investigate the influence of pyocyanin on aconitase activity, assay mixtures were supplied with 30 µM NADH and 10 µM pyocyanin or the respective amount of methanol as a solvent control before starting the reaction with isocitrate. Extracts from cells that were used for monitoring the degradation of GlcNAc in the absence and presence of pyocyanin (see above) were prepared in the same way. In these extracts, also the activity of isocitrate dehydrogenase (EC 1.1.1.42) was measured by monitoring the isocitrate-dependent formation of NADPH in a spectrophotometer at 365 nm (ε = 3.4 mM-1 cm-1). Assay mixtures contained anoxic 90 mM TRIS/HCL buffer (pH 8), 1 mM NADP+, 25-50 µl

33

CHAPTER 2 AEROMONAS HYDROPHILA – PSEUDOMONAS AERUGINOSA INTERACTIONS cell extract (ca. 0.1 mg protein) and were started by the addition of 10 mM DLisocitrate. Activity of pyruvate dehydrogenase (EC 1.2.4.1) was determined by monitoring the CoA- and pyruvate-dependent formation of NADH in a spectrophotometer at 365 nm (ε = 3.4 mM-1 cm-1). Extracts were prepared from cells that were used to monitor the degradation of GlcNAc in the presence and absence of pyocyanin (see above) in the same way as described above but with the following differences: cells were washed with 50 mM TRIS/HCl buffer (pH 7.6), and disruption by French Press, and further processing was performed under oxic conditions. Assay mixtures contained 50 mM TRIS/HCl buffer (pH 7.6), 2 mM MgCl2, 2.5 mM DTT, 0.4 mM thiamine pyrophosphate, 0.1 mM CoA, 5 mM NAD+ , 50 µl cell extract (ca. 0.1 mg protein) and were started by the addition of 5 mM pyruvate. Protein concentrations in cell extracts were determined using the Pierce BCA Protein Assay Kit (Thermo Scientific).

Results Growth in single culture To characterize chitin degradation of A. hydrophila strain AH-1N and to verify that P. aeruginosa strain PAO1 cannot grow with chitin, both strains were incubated with chitin as a sole source of carbon, nitrogen, and energy in single culture. CFUs of strain AH-1N increased concomitantly with chitin degradation reaching a final number of about 109 CFUs ml-1 within one day. CFUs of strain PAO1 increased only to a number of about 3 x 106 CFUs ml-1, and chitin did not decrease (Fig. 1). If chitin was incubated in cell-free supernatant of chitin-grown strain AH-1N containing chitinolytic enzymes, GlcNAc, (GlcNAc)2, and (GlcNAc)3 accumulated indicating that these were the primary products of chitin degradation. To investigate whether both strains could grow with these degradation products of chitin, they were incubated with GlcNac, (GlcNAc)2 and (GlcNAc)3. Additionally, we tested growth of both strains with the further plausible degradation products glucosamine and acetate. As expected strain AH-1N was able to grow with all of these compounds (data not shown). Strain PAO1 could not grow with (GlcNAc)2 and (GlcNAc)3, but was able to grow with GlcNAc, acetate, and glucosamine as substrates, with the latter two only if ammonium was present in the medium. The growth rate of strain PAO1 with GlcNAc 34

PARASITIC GROWTH STRATEGY OF PSEUDOMONAS AERUGINOSA was significantly lower than the growth rate of strain AH-1N (data not shown). While strain PAO1 did not degrade chitin, we observed that more than 80 % of the cells in a cell suspension attached to chitin within 30 min. In that timeframe, about 60 % of the

1010

0

10 9

20

108

40

107

60

10 6

80

105

chitin decrease [%]

cfu ml-1

cells in a cell suspension of strain AH-1N attached to chitin.

100 0

1

2

3

4

5

6

time [d]

Fig. 1. Growth of A. hydrophila strain AH-1N and of P. aeruginosa strain PAO1 in single cultures with chitin. CFUs of strain AH-1N (
); CFUs of strain PAO1 (
); decrease of chitin in cultures of strain AH-1N () and of strain PAO1 (). Error bars indicate standard deviation (n=3).

Growth in co-cultures To investigate whether strain PAO1 was able to benefit from chitin degradation by strain AH-1N, a co-culture with both strains was incubated with chitin as sole source of carbon, nitrogen, and energy. In this co-culture chitin was degraded within three days, and CFUs of strain AH-1N increased to numbers similar to its growth in single culture (Fig. 2). After day 2, however, CFUs of strain AH-1N decreased dramatically and dropped below the detection limit of 105 CFUs ml-1. Coinciding with this decrease, the culture turned dark green and foamy. At day 1 CFUs of strain PAO1 had increased slightly higher than in single culture reaching numbers of about 107 CFUs ml-1. After day 2, CFUs of strain PAO1 increased further reaching numbers of about 109 CFUs ml-1. Thus, in contrast to the single culture, strain PAO1 could grow in the co-culture, in which chitin had been provided as the sole carbon, nitrogen, and energy source. This growth subsequently followed the decrease of 35

CHAPTER 2 AEROMONAS HYDROPHILA – PSEUDOMONAS AERUGINOSA INTERACTIONS CFUs of strain AH-1N and the formation of green colour and foam. While the timepoint of these events varied between day 2 and day 3, the overall course of the co-culture was always reproducible. A further observation was that co-cultures, in

1010

0

10 9

20

108

40

107

60

10 6

80

105

chitin decrease [%]

cfu ml-1

which CFUs of strain AH-1N had already decreased, contained red-coloured cells.

100 0

1

2

3

4

5

6

time [d]

Fig. 2. Growth of A. hydrophila strain AH-1N and of P. aeruginosa strain PAO1 in co-cultures with chitin. CFUs of strain AH-1N (
); CFUs of strain PAO1 (
); decrease of chitin (). Error bars indicate standard deviation (n=3).

To investigate whether the chitinase ChiC and the chitin-binding protein CbpD as well as the sugar-binding proteins LecA and LecB were required for growth of strain PAO1 in the co-culture, respective mutants were tested. Co-cultures with these mutants did not differ from co-cultures with the wildtype. Additionally, binding to chitin was not affected in strains PAO1-KO[cbpD], -KO[chiC], ∆lecA, and ∆lecB. To investigate whether the course of the co-culture with chitin was a general consequence of co-cultivation of strains AH-1N and PAO1, chitin was replaced by tryptone. In this co-culture both strains grew to numbers of about 5 x 108 CFUs ml-1 (data not shown). In stationary phase CFUs of strain AH-1N decreased only slightly, and the culture did not turn green. However, if the co-culture was incubated with chitin and tryptone, chitin degradation was accelerated, and within 24 hours the culture had turned green, CFUs of strain AH-1N were below the detection limit of 105 CFUs ml-1, and strain PAO1 reached about 2 x 109 CFUs ml-1. The same number was reached in the single culture of strain PAO1 with tryptone and chitin, in which chitin was not degraded, and which did not turn green. 36

PARASITIC GROWTH STRATEGY OF PSEUDOMONAS AERUGINOSA The course of the co-culture with chitin raised two questions. First, which substrates supported growth of strain PAO1, and, second, what caused the decrease of CFUs of strain AH-1N in the co-culture? Analysis of metabolite production in the co-culture To address the first question we analysed supernatant samples from co-cultures of strains AH-1N and PAO1 and from single cultures of strain AH-1N growing with chitin by ion-exclusion and reversed-phase HPLC. Additionally, these samples were tested for the presence of ammonium. Ion-exclusion HPLC revealed that in single culture of strain AH-1N up to 5 mM acetate were released and subsequently taken up between 15 and 60 hours of incubation. In the co-culture the release of acetate started slowly around 30 hours of incubation, increased within the next 30 hours and peaked after 60 hours of incubation, reaching concentrations of up to 10 mM. This peak was followed by a fast degradation of acetate within 10-20 hours. Remarkably, the release of acetate coincided with the inactivation of strain AH-1N, and the degradation of acetate coincided with the increase of CFUs of strain PAO1 (Fig. 3A,B). GlcNAc, (GlcNAc)2, and (GlcNAc)3 were neither detected in the single culture nor in the co-culture samples. With reversed-phase HPLC only traces of glucosamine (below 50 µM) could be detected in single and co-culture samples. In single cultures of strain AH-1N up to 10 mM ammonium were released and partly taken up between 20 and 50 hours of incubation (data not shown). In the co-culture about 3 mM of ammonium were detected after 20 hours of incubation. This concentration level remained constant during further incubation. These results clearly showed that growth of strain PAO1 after 70 hours was substantially supported by acetate as carbon and by ammonium as nitrogen source. Analysis of inactivation of strain AH-1N and identification of secondary metabolites To address the question of what caused the decrease of CFUs of strain AH-1N in coculture with strain PAO1, we investigated whether this decrease was dependent on the presence of strain PAO1 cells or not. Therefore, we incubated cell suspensions of strain AH-1N in cell-free supernatants from a co-culture, in which CFUs of strain AH1N had already decreased. This cell-free supernatant caused a more than 1000-fold decrease of CFUs of strain AH-1N within 48 hours, while the total cell counts remained constant over time (Fig. 4A). This indicated that the co-culture supernatant 37

CHAPTER 2 AEROMONAS HYDROPHILA – PSEUDOMONAS AERUGINOSA INTERACTIONS

cfu ml-1

1010

Fig. 3. Metabolite production in

A

10 9

single cultures of A. hydrophila

10 8

strain AH-1N and in co-cultures of

10 7

A. hydrophila strain AH-1N and P.

106

aeruginosa

with

single culture (
), CFUs of strains

104 0

30

60

90

12 0

1 50

time [h] 12

AH-1N () and PAO1 () in coculture. B. Acetate concentration

B

in supernatants of single cultures

10 concentration [mM]

PAO1

chitin. A. CFUs of strain AH-1N in

10 5

of strain AH-1N () and of co-

8

cultures of strains AH-1N and

6

PAO1 (). C. Pyocyanin () and

4

HHQ

2

supernatants

0

(
)

concentration

in

of

of

co-cultures

strains AH-1N and PAO1. 0

30

60

90

120

1 50

tim e [h] 25

concentration [µM]

strain

Error

bars

indicate

standard

deviation (n=3). In B. the three

C

replicates for the co-culture are

20

shown individually. 15 10 5 0 0

30

60

90

12 0

150

tim e [h]

contained toxic compounds that caused inactivation but not lysis of strain AH-1N. Notably, these inactivated cells were red-coloured. Cells of strain PAO1 were not inactivated in co-culture supernatant and did not turn red. This indicated that the aforementioned red-coloured cells in the co-culture were cells of strain AH-1N. In the presence of 106 CFUs ml-1 of strain PAO1, CFUs of strain AH-1N decreased below the detection limit of 105 CFUs ml-1 within 20 hours (Fig. 4A). This indicated that cells of strain PAO1 were not necessary for but accelerated inactivation of strain AH-1N. 38

PARASITIC GROWTH STRATEGY OF PSEUDOMONAS AERUGINOSA

Fig. 4. Inactivation of cells of A. hydrophila

1010

strain

cfu ml-1 TCC ml-1

Inactivation

AH-1N.

by

A.

co-culture

10 9

supernatants in the presence and 10 8

absence of cells of P. aeruginosa

107

strain PAO1. CFUs (
) and total cell counts () of strain AH-1N in

106

co-culture

A

5

10

supernatant

in

the

absence of cells of strain PAO1; 0

10

20

30

40

50

CFUs

time [h]

of

strain

AH-1N

in

the

presence of cells of strain PAO1 (106 CFUs ml-1) (
); CFUs () and

109

cfu ml-1

total cell counts () of strain AH-1N in

10 7

the

medium

control.

B.

Inactivation by pyocyanin. CFUs of 5

10

strain AH-1N during incubation with 0

B

3

10

0

15

30

45

60

(;

solvent

control

with

methanol), 5 (
), 10 (
), and

75

30 () µM pyocyanin. Error bars

time [h]

indicate standard deviation (n=3).

Analysis of co-culture supernatant revealed the presence of rhamnolipids at concentrations up to 31 mg l-1, which could be a plausible cause for foam formation. Fluorescence spectroscopy revealed the presence of the siderophores pyochelin and pyoverdine, as detected by their characteristic excitation/emission wavelengths of 350/440 nm and 405/455 nm, respectively (Cox and Adams, 1985; Visca et al., 1992).

Nevertheless,

a

co-culture

with

the

siderophore

deficient

mutant

PAO1∆pvdD∆pchEF did not differ from a co-culture with the wildtype. Furthermore, elastolytic activity could be measured (data not shown), while cyanide could not be detected. In addition, compounds involved in quorum sensing could also be detected (see below). Reversed-phase HPLC analysis of co-culture supernatants revealed the production of the phenazine compounds phenazine-1-carboxylate (PCA) (not shown) and pyocyanin (Fig. 3C) after 40 hours of incubation. After 80 hours the concentration of 39

CHAPTER 2 AEROMONAS HYDROPHILA – PSEUDOMONAS AERUGINOSA INTERACTIONS pyocyanin was above 20 µM and remained constant. Pyocyanin has toxic effects on bacteria (Hassan and Fridovich, 1980; Baron and Rowe, 1981; Lau et al., 2004). Therefore, we investigated whether pyocyanin as an isolated compound could cause inactivation of strain AH-1N. Pyocyanin caused a concentration-dependent decrease of CFUs in cell suspensions of strain AH-1N within 2 days (Fig. 4B). As pyocyanin production is known to be induced by phosphate limitation (Whooley and McLoughlin, 1982; Jensen et al., 2006), we incubated the co-culture with 600 µM instead of 150 µM phosphate. In this co-culture cells of strain AH-1N were not inactivated, and the culture did not turn green (data not shown). Increasing the iron concentration from 7.5 µM to 100 µM did not change the course of the co-culture. Impact of quorum sensing In P. aeruginosa the production of above-mentioned secondary metabolites is regulated via a hierarchical quorum-sensing system that consists of two Nacylhomoserine lactone (AHL) regulatory circuits (las and rhl) and a 2-alkyl-4quinolone (AQ) system (Williams and Cámara, 2009). In the las and rhl circuits signalling is mediated via N-(3-oxo-dodecanoyl)-L-homoserine lactone (3-oxo-C12HSL) and N-(butanoyl)-L-homoserine lactone (C4-HSL), respectively. Signalling in the AQ system is mediated mainly by 2-heptyl-3-hydroxy-4-quinolone, which is referred to as the Pseudomonas quinolone signal (PQS) and by 2-heptyl-4-quinolone (HHQ) (Dubern and Diggle, 2008). In Aeromonas hydrophila, quorum sensing via the ahy circuit is mediated by the AHL N-(butanoyl)-L-homoserine lactone (C4-HSL) (Swift et al., 1997). Bioassays indicated the presence of C4-HSL and 3-oxo-C12-HSL in co-cultures of strains AH-1N and PAO1 during growth with chitin and the presence of C4-HSL in single cultures of strain AH-1N (data not shown). HPLC analysis of co-culture samples revealed the production of HHQ, starting after 40 hours of incubation and increasing up to 5 µM within the next 30 hours (Fig. 3C). While PQS could not be detected even after extracting and concentrating supernatant samples, 4-hydroxy-2heptylquinoline-N-oxide (HQNO) was detectable in untreated supernatants. To investigate the impact of quorum sensing by strain AH-1N on the co-culture with chitin, we co-incubated strain PAO1 with the AHL negative mutant strain AH1N∆ahyI. The course of the co-culture did not differ from the co-culture with both wildtypes (data not shown). This result also showed that quorum sensing by strain 40

PARASITIC GROWTH STRATEGY OF PSEUDOMONAS AERUGINOSA AH-1N was not required for chitin degradation. In this co-culture we detected both AHLs, indicating that C4-HSL detected in the co-culture of both wildtypes was at least partly produced by strain PAO1. To investigate the impact of quorum sensing by strain PAO1 on the co-culture with chitin, we co-incubated strain AH-1N with the AQ negative mutant strain PAO1∆pqsA and the AHL negative mutant strain PAO1(ATCC)∆lasI∆rhlI, respectively. In these co-cultures, CFUs of strains PAO1∆pqsA (Fig. 5A) and PAO1(ATCC)∆lasI∆rhlI (not shown) reached significantly lower numbers than the respective wildtype strains. In both co-cultures, CFUs of strain AH-1N decreased only slightly in stationary phase, and the cultures did not turn green and foamy. The same course was observed in co-cultures of strain AH-1N and the mutant strain PAO1∆pqsR that lacks the transcriptional regulator PqsR, which is

10 10

1010

A

10 9

B

10 9

8

cfu ml-1

cfu ml -1

10

107 106

10 8 107 106

105 104

105 0

1

2

3 time [d]

4

5

6

0

1

2

3

4

5

6

time [d]

Fig. 5. Growth of A. hydrophila strain AH-1N and of P. aeruginosa mutants with defects in the AQ-mediated quorum sensing system in co-cultures with chitin. A. Co-cultures of strain AH-1N with strains PAO1∆pqsA and PAO1∆pqsH, respectively. CFUs of strain AH-1N in cocultures with strain PAO1∆pqsA (); CFUs of strain AH-1N in co-cultures with strain PAO1∆pqsH (
); CFUs of strain PAO1∆pqsA (); CFUs of strain PAO1∆pqsH (
). B. Cocultures of strain AH-1N with strain PAO1∆pqsA in the presence and absence of pyocyanin. CFUs of strain AH-1N (
,) and of strain PAO1∆pqsA (
,) in co-cultures with 20 µM pyocyanin (closed symbols) and with methanol (open symbols) as solvent control. The arrow indicates addition of pyocyanin and methanol, respectively. Error bars indicate standard deviation (n=3).

required for the activation of AQ biosynthesis (Gallagher et al., 2002). Strains PAO1∆pqsA and PAO1(ATCC)∆lasI∆rhlI could be complemented by supplying the co-culture with a mixture of C4-HSL and 3-oxo-C12-HSL (1 µM each) or with 41

CHAPTER 2 AEROMONAS HYDROPHILA – PSEUDOMONAS AERUGINOSA INTERACTIONS PQS (1 µM), respectively. These results showed that the inactivation of strain AH-1N in co-culture with chitin was dependent on AHL- and AQ-mediated quorum sensing by strain PAO1. To further elucidate the impact of PQS and HHQ on the course of the co-culture, strain AH-1N was co-incubated with the mutant strain PAO1∆pqsH, which lacks the monooxygenase for conversion of HHQ to PQS (Gallagher et al., 2002). This coculture did not differ from the co-culture with the PAO1 wildtype (Fig. 5A) and contained red cells. These results showed that PQS was not required for the inactivation and for the red colouration of cells of strain AH-1N. It was shown that the

∆pqsH mutant displays normal PqsR-dependent gene expression and virulence, but that PQS is required for full production of pyocyanin (Xiao et al., 2006). In agreement with that the pyocyanin concentration in supernatants of co-cultures of strains AH-1N and PAO1∆pqsH was lower (up to 11 µM) than in supernatants of co-cultures with both wildtypes. Effect of pyocyanin on the metabolism of strain AH-1N Intriguingly, pyocyanin production in the co-culture coincided with the massive release of about 10 mM acetate (Fig. 3B,C). In contrast, in a co-culture of strains AH1N and PAO1∆pqsA, in which no pyocyanin was detectable, only about 3 mM acetate were released. These observations prompted us to investigate a possible role of pyocyanin in triggering the release of acetate. For this, 20 µM pyocyanin were added to single cultures of strain AH-1N that had been growing with chitin for 48 hours. This point of time was equivalent to the onset of pyocyanin formation in the co-culture. This addition caused a release of up to 10 mM acetate within the following 48 hours (data not shown), which was not observed in the respective control with methanol. As macroscopic chitin particles were mostly degraded at the timepoints of pyocyanin addition to single cultures and of pyocyanin production in co-cultures, the released acetate could originate from larger GlcNAc oligomers that were still present in the supernatant but could not be detected by HPLC analysis. Additionally, acetate could also originate from degradation of storage material of strain AH-1N. To explore this effect of pyocyanin in more detail, we incubated cell suspensions of strain AH-1N with 3 mM GlcNAc as sole substrate in the presence of

42

PARASITIC GROWTH STRATEGY OF PSEUDOMONAS AERUGINOSA

concentration [mM]

8

A

Fig. 6. Degradation of GlcNAc and acetate by cell suspensions of A.

6

hydrophila strain AH-1N in the 4

presence

of

pyocyanin.

A.

Concentration of GlcNAc () and 2

acetate() in the presence of pyocyanin.

0 0

10

20

30

40

50

B.

Concentration

of

GlcNAc () and acetate () in the

time [ h]

concentration [mM]

8

solvent control with methanol. C.

B

Concentration of acetate in the

6

presence of pyocyanin () and in the

solvent

control

with

4

methanol (). Error bars indicate standard deviation (n=3).

2

0 0

10

20

30

40

50

30

40

50

time [h]

concentration [mM]

12

C

9

6

3

0 0

10

20 t ime [h]

20 µM pyocyanin. Within 22 hours GlcNAc was completely degraded, and up to 7 mM acetate accumulated, which were not utilized further (Fig. 6A).In the control with methanol, degradation of GlcNAc was faster, and up to 3 mM acetate accumulated only transiently (Fig. 6B). Cell suspension experiments with 10 mM acetate as sole substrate revealed that acetate could not be degraded in the presence of pyocyanin, while it was completely consumed in the methanol control within 20 hours (Fig. 6C). These results clearly showed that pyocyanin caused an

43

CHAPTER 2 AEROMONAS HYDROPHILA – PSEUDOMONAS AERUGINOSA INTERACTIONS incomplete oxidation of GlcNAc to acetate, which is based on the inhibition of the further degradation of acetate. Pyocyanin is known to divert the cellular electron flow by chemically and biochemically oxidising electron carriers such as NAD(P)H and reducing oxygen to reactive oxygen species (ROS) with the superoxide radical as primary product. To investigate whether pyocyanin caused such an electron diversion in strain AH-1N, we performed oxygen consumption experiments with cell suspensions incubated with GlcNAc as described previously (Hassan and Fridovich, 1980). These experiments showed that the substrate-dependent oxygen consumption by cell suspensions of strain AH-1N, which was largely inhibited by KCN, could be increased by addition of pyocyanin in a concentration-dependent manner (Fig. 7A). This increase of cyanideinsensitive oxygen consumption was a strong indication for the formation of ROS by pyocyanin, which had been reduced by electrons derived from GlcNAc oxidation. This effect of pyocyanin was not observed with suspensions of heat-inactivated cells of strain AH-1N (incubation at 80° C for 10 min) indicating t hat metabolically active cells were required for pyocyanin-dependent oxygen consumption. In corresponding experiments with cells of strain PAO1 pyocyanin had no influence on oxygen consumption, which is in agreement with previous studies (Hassan and Fridovich, 1980; Hassett et al., 1992). Effect of pyocyanin on aconitase activity It is known that the superoxide radical preferentially damages iron-sulfur-cluster containing dehydratases, such as aconitase and fumarase that are both involved in acetate degradation through the citric acid cycle (Imlay, 2003). To investigate if pyocyanin would inhibit aconitase in cells of strain AH-1N, we measured aconitase activity in cell extracts prepared from cell suspensions that had been incubated with GlcNAc in the presence and absence of pyocyanin as described above. In extracts of cells, which had been incubated in the presence of pyocyanin, aconitase activity was 80 – 100 % lower compared to the aconitase activity of 120 ± 14 mU (mg protein)-1 in extracts of cells, which had been incubated in the absence of pyocyanin. There was no difference in the activities of pyruvate dehydrogenase (249 mU (mg protein)-1 in the presence and 268 ± 64 mU (mg protein)-1 in the absence of pyocyanin) and isocitrate dehydrogenase (487 ± 11 mU (mg protein)-1 in the presence and

44

PARASITIC GROWTH STRATEGY OF PSEUDOMONAS AERUGINOSA

150

A

B

125

125 mU (mg protein)-1

nmol O 2 (min mg dry weight) -1

150

100 75 50

100 75 50 25

25 0

0 GlcNAc KCN

1

5

10

20

40

pyocyanin concentration [µM]

NADH + pyocyanin

pyocyanin

NADH + methanol

methanol

Fig. 7. Effects of pyocyanin on A. hydrophila strain AH-1N. A. Effect of pyocyanin on oxygen consumption rates of cell suspensions after successive addition of (1) 10 mM GlcNAc, (2) of 0.5 mM KCN and (3) of pyocyanin at the respective concentration indicated in the graph. Error bars indicate standard deviation (n=15 for black and white bar, and n=3 for each grey bar). B. Effect of 10 µM pyocyanin on aconitase activity in cell extracts of strain AH-1N in the absence and presence of 30 µM NADH. Assays with methanol in the presence and absence of NADH served as controls. Error bars indicate standard deviation (n=3).

457 ± 28 mU (mg protein)-1 in the absence of pyocyanin) between these two cell extracts indicating that incubation with pyocyanin had no general damaging effect on enzymes. To explore the effect of pyocyanin on aconitase activity in vitro, we prepared extracts from GlcNAc-grown cells of strain AH-1N that were harvested in the mid-exponential growth phase. In these cell extracts aconitase activity was inhibited by 50 %, if the assays contained 10 µM pyocyanin and 30 µM NADH as electron donor (Fig. 7B). In the absence of NADH pyocyanin did not cause an inhibition. Thus, the inhibition of aconitase was dependent on the reduction of pyocyanin, and, in consequence, on the formation of ROS. Growth restoration of strain PAO1∆pqsA in a co-culture by pyocyanin To investigate whether the release of acetate triggered by pyocyanin was sufficient to support growth of strain PAO1, we supplied a co-culture of strains AH-1N and PAO1∆pqsA with 20 µM of pyocyanin after incubation for 48 hours as described above. Strain PAO1∆pqsA started growth within 72 hours after addition of pyocyanin 45

CHAPTER 2 AEROMONAS HYDROPHILA – PSEUDOMONAS AERUGINOSA INTERACTIONS and reached 10-fold higher CFU numbers than in the respective co-culture control with methanol (Fig. 5B). HPLC-analysis showed an increase of acetate of up to 4 mM within 24 hours after addition of pyocyanin, which did not occur in the co-culture control with methanol; acetate was completely consumed when growth of strain PAO1∆pqsA started (not shown). These results showed that the effects of pyocyanin on strain AH-1N were sufficient to restore growth of a mutant strain of PAO1 that does not produce pyocyanin itself thereby underlining the crucial role of this compound for the course of the co-culture. As expected from the cell suspension experiments (Fig. 4B), the addition of pyocyanin caused also a decrease of CFUs of strain AH-1N within 3 days. This inactivation was slower than in co-cultures with the wild type indicating inactivating effects of further quorum sensing-regulated secondary metabolites. In the co-culture control with methanol CFUs of strain AH-1N also decreased but to a lesser extent; this was also observed in a single culture of strain AH-1N with methanol indicating a toxic effect of this solvent.

Discussion Bacteria investing in the production of extracellular hydrolytic enzymes for the degradation of polymers face the danger of being exploited by opportunistic bacteria that may thrive on degradation products without investing energy in the biosynthesis of these enzymes. In our study, we investigated such a scenario with a co-culture of the chitinolytic bacterium A. hydrophila strain AH-1N as investor and P. aeruginosa strain PAO1 as opportunist with chitin as the sole source of carbon, nitrogen, and energy. This co-culture had a highly reproducible biphasic course. In the first phase, strain AH-1N grew with chitin at a very similar rate as in single culture, while strain PAO1 reached slightly higher cell numbers compared to its single culture. This interaction can be described as commensal, because the opportunist grew with substrates provided by the investor, who is obviously not harmed. The second phase of the coculture commenced with the formation of secondary metabolites by strain PAO1, whose biosynthesis was under control of quorum sensing. These metabolites caused a rapid inactivation of and the release of acetate by cells of strain AH-1N. Strain PAO1 continued growth with the released acetate and reached about 200-fold higher cell numbers than in its single culture. Thus, strain PAO1 employed its secondary metabolites to influence both the viability and the metabolism of strain AH-1N in such 46

PARASITIC GROWTH STRATEGY OF PSEUDOMONAS AERUGINOSA a way, that it eventually could use the carbon, nitrogen, and energy of the substrate chitin that was originally not bioavailable to it. This interaction can be described as parasitic, because the opportunist grew by forcing the investor to release substrates and by harming the investor. In conclusion, strain PAO1 progressed from a commensal to a parasitic growth strategy, and this progression was regulated by quorum sensing. The redox active compound pyocyanin played the key role in this growth strategy of strain PAO1 and exhibited two functions as shown by using it as a pure compound. First, pyocyanin triggered the release of acetate by strain AH-1N, and, second, caused an inactivation of strain AH-1N. The oxygen consumption experiments provided strong evidence that pyocyanin caused the formation of the superoxide radical and further ROS in strain AH-1N. This is in agreement with the inhibition of the superoxide radical-sensitive aconitase in cells of strain AH-1N that had been incubated with pyocyanin. This effect of pyocyanin on aconitase has also been shown in human lung epithelial cells (O’Malley et al., 2003). Inhibition of aconitase interrupts the citric acid cycle already at the second step. Therefore, inhibition of aconitase sufficiently explained the observed complete block of acetate degradation in the presence of pyocyanin. In contrast, pyocyanin had only a slight inhibiting effect on GlcNAc degradation and did not affect pyruvate dehydrogenase activity. In the coculture, continued degradation of GlcNAc oligomers by strain AH-1N in the presence of pyocyanin would therefore lead to an accumulation of acetyl-CoA, which could plausibly explain the release of acetate into the medium. An alternative explanation for the release of acetate could be that the reduction of oxygen by pyocyanin might lower the oxygen partial pressure to a degree that fermentative metabolism of strain AH-1N is induced, even though oxic conditions still prevail. Strain AH-1N was able to ferment GlcNAc to acetate, lactate, succinate, acetoin, formate, and ethanol (Jagmann and Philipp, unpublished). Theoretically, pyocyanin could transfer electrons derived from the oxidative branch of GlcNAc fermentation from NADH to oxygen, thereby avoiding the formation of reduced fermentation products as electron sinks. In consequence, acetate would be the only fermentation product of GlcNAc. However, it was unlikely that pyocyanin caused a switch to anaerobic metabolism, because in extracts of cells grown in the presence of pyocyanin a high pyruvate dehydrogenase activity was detected, which was absent in extracts of GlcNAcfermenting cells (Jagmann and Philipp, unpublished). Therefore, we conclude that 47

CHAPTER 2 AEROMONAS HYDROPHILA – PSEUDOMONAS AERUGINOSA INTERACTIONS pyocyanin forced strain AH-1N into incomplete oxidation of the available substrates to acetate as a dead-end metabolite by inhibition of acetate degradation through the citric acid cycle. Based on this inhibiting effect pyocyanin could also complement the phenotype of a ∆pqsA mutant of strain PAO1 by restoring growth in the co-culture. To our knowledge, this effect of pyocyanin has never been reported. This mechanism might as well be applicable for exploiting bacteria degrading cellulose, which is also not bioavailable for strain PAO1 according to its genome sequence. In addition, pyocyanin caused a long-term inactivation of strain AH-1N, showing that the cells had been irreversibly damaged by ROS. Pyocyanin-dependent inactivation has also been shown with Escherichia coli (Hassan and Fridovich, 1980; Hassett et al., 1992), Staphylococcus aureus (Biswas et al., 2009) as well as with several other bacteria (Baron and Rowe, 1981; Norman et al., 2004). In the co-culture, other secondary metabolites, such as rhamnolipids (Haba et al., 2003) and HQNO (Hoffmann et al., 2006), had certainly contributed to inactivating strain AH-1N, because the rate of inactivation was lower in the co-culture with the ∆pqsA mutant after addition of pyocyanin only. In cell suspension experiments, inactivation was strongly accelerated by the presence of cells of strain PAO1, which might be caused by cell-bound factors of strain PAO1. Additionally, strain PAO1 might scavenge nutrients that could otherwise extend the viability span of strain AH-1N. The longterm advantage of inactivating strain AH-1N could be the suppression of a competitor for potential future substrates that strain PAO1 can utilize on its own. Interestingly, the inactivation of strain AH-1N was accompanied by a red colouration of cells, which was reminiscent of two phenomena, the so-called red death of Caenorhabditis elegans and the inactivation of Candida albicans, that are both caused by P. aeruginosa (Zaborin et al., 2009; Gibson et al., 2009). Red death of C. elegans is dependent on a PQS/Fe3+-complex that causes the same symptoms in the animal as did cells of the P. aeruginosa wildtype. In our system, however, PQS was not required because a ∆pqsH mutant that produces HHQ but no PQS also caused the formation of inactivated red cells in the co-culture. As a further difference, the siderophore deficient mutant PAO1∆pvdD∆pchEF, which is not lethal to C. elegans (Zaborin et al., 2009), did not differ from the wildtype in our system. These findings suggest that the red colouration of inactivated cells of strain AH-1N was caused by a mechanism different from that observed with C. elegans. The inactivation of C. albicans is also accompanied by a red colouration of the fungal 48

PARASITIC GROWTH STRATEGY OF PSEUDOMONAS AERUGINOSA cells, which is dependent on 5-methyl-phenazinium-1-carboxylate (5MPCA), the precursor of pyocyanin (Gibson et al., 2009). As in our system, pyocyanin as a pure compound did not cause red colouration, the red colouration disappeared after addition of the reducing agent dithionate, and the pigment appears to be strongly associated with the cells (Jagmann and Philipp, unpublished). These features suggest a similar mechanism for the red colouration in strain AH-1N and C. albicans. However, inactivation by 5MPCA requires cell-cell contact of P. aeruginosa and C. albicans on solid media, and, unlike PCA and pyocyanin, 5MPCA does not accumulate in culture supernatants and is not stable at neutral pH (Gibson et al., 2009). These features suggest some differences to our system, because red coloration of cells of strain AH-1N also occurred upon incubation with cell-free supernatants from co-cultures. The timing for the production of bioactive secondary metabolites by strain PAO1 in the co-culture was crucial, because their premature formation would suppress chitin degradation by strain AH-1N before strain PAO1 could profit from it. Quorum sensing is a means for linking the formation of bioactive secondary metabolites to the environmental situation, population density, and the physiological status (Williams and Cámara, 2009). The prerequisite for the formation of signalling molecules and secondary metabolites is the availability of substrates. This raised the question, which substrates, apart from possible storage material, strain PAO1 could use in the first phase of the co-culture. The fact that no primary chitin degradation products and only traces of glucosamine were detectable in single cultures of strain AH-1N revealed that there was a tight coupling of chitin hydrolysis and uptake of the degradation products by this strain. Therefore, it was unlikely that GlcNAc or glucosamine were available as substrates for strain PAO1 in the first phase of the coculture. It was more probable that strain PAO1 took advantage of the transient acetate release that accompanied chitin degradation by strain AH-1N. Such a transient release of acetate has also been shown for other Aeromonads growing aerobically with carbohydrates (Namdari and Cabelli, 1990). In addition, it was possible that strain PAO1 could grow with other minor exudates of strain AH-1N, as it is known that P. aeruginosa can grow in media with very low concentrations of organic compounds (Favero et al., 1971; van der Kooij et al., 1982). Growth of strain PAO1 in the first phase of the co-culture was therefore likely based on utilizing compounds released from strain AH-1N in any case during chitin degradation, 49

CHAPTER 2 AEROMONAS HYDROPHILA – PSEUDOMONAS AERUGINOSA INTERACTIONS including ammonium as a nitrogen source. From this rather precarious metabolic situation strain PAO1 progressed into the second phase of the co-culture, in which it actively enforced the release of acetate by strain AH-1N by employing quorum sensing-regulated properties. Quorum sensing is defined to be cell density-dependent, but it has been shown that quorum sensing of P. aeruginosa can also be regulated by environmental factors independent of cell density (Fuqua et al., 2001; Wagner et al., 2003; Duan and Surette, 2007; Williams and Cámara, 2009). The fact that the production of quorum sensing-regulated secondary metabolites by strain PAO1 in the co-culture occurred at a relatively low cell density of about 107 CFUs ml-1, corresponding to an OD600 of 0.01, indicated a strong impact of environmental factors. The precarious metabolic situation in the first phase was likely to result in nutrient starvation, which could lead to the induction of quorum sensing via the stringent response (van Delden et al., 2001). Quorum sensing can also be induced upon iron (Bollinger et al., 2001; Kim et al., 2005; Jensen et al., 2006; Duan and Surette, 2007) and phosphate limitation (Bazire et al., 2005, Jensen et al., 2006). While increasing the iron concentration had no effect, increasing the phosphate concentration suppressed the production of bioactive secondary metabolites. This clearly showed that phosphate limitation was an important trigger for quorum sensing in the co-culture. In addition to nutritional factors specific signals from strain AH-1N might also be involved in inducing quorum sensing under these culture conditions. It was unlikely that C4-HSL produced by strain AH-1N played such a role, because co-cultures with the ∆ahyI mutant of strain AH-1N did not differ from those with the wild type. Finally, chitin-specific cues could also contribute to triggering quorum sensing in strain PAO1. Studies for identifying molecular mechanisms underlying the course of the co-culture are currently on the way in our laboratory. Our study is a further example that the quorum sensing-regulated secondary metabolites of P. aeruginosa, which are mainly viewed as its virulence factors in human infections, do also play an important ecological role in competition with other microbes (Hogan and Kolter, 2002; Norman et al., 2004). The parasitic exploitation of chitin-degrading bacteria could contribute to the occasional massive developments of P. aeruginosa during the summer season in oligotrophic freshwater systems, which usually contain only very low numbers of this opportunistic pathogen (van Asperen et al., 1995; Mena and Gerba, 2009). 50

PARASITIC GROWTH STRATEGY OF PSEUDOMONAS AERUGINOSA Acknowledgements The authors like to thank Paul Williams, Steve Diggle and Miguel Cámara (Nottingham) for the gift of the P. aeruginosa strains ∆pqsA, ∆pqsH, ∆pqsR, ∆lecA,

∆lecB as well as for helpful discussions. Furthermore, the authors like to thank Pierre Cornelis (Brussels) for the gift of the ∆pvdD∆pchEF mutant, Susanne Fetzner (Münster) for the gift of PQS and HHQ, and David Schleheck (Konstanz) for the gift of the P. aeruginosa strains PAO1(ATCC) and PAO1(ATCC)∆lasI∆rhlI. Katharina Styp von Rekowski is acknowledged for initial experiments on this project. Technical support from Kathrin Happle and continuous support from Bernhard Schink is acknowledged. This work was funded by a grant of the Deutsche Forschungsgemeinschaft (project B9 in SFB 454) to B.P.

51

CHAPTER 3

Metabolic requirements for the parasitic growth strategy of Pseudomonas aeruginosa in co-culture with the chitinolytic bacterium Aeromonas hydrophila Nina Jagmann, Mario Hupfeld, Bodo Philipp

Abstract Recently, we established a model system for interspecies interactions during polymer degradation consisting of a chitin-containing co-culture of the chitinolytic bacterium Aeromonas hydrophila and Pseudomonas aeruginosa, which cannot degrade chitin (Jagmann et al., 2010). In the first phase of this co-culture, P. aeruginosa has to metabolically prepare for the second phase, in which it influences the metabolism of A. hydrophila in a parasitic way via quorum sensing-controlled secondary metabolites, among them pyocyanin. In this study, we investigated the metabolic requirements that enabled the transition of P. aeruginosa into the second phase of the co-culture. While catabolite repression of the degradation of the chitin monomer N-acetylglucosamine (GlcNAc) by the presence of acetate had no influence, the activity of isocitrate lyase (AceA) was crucial for the transition into the second phase. Beside its role in the utilization of acetate, this enzyme was important for growth with GlcNAc, as transcription of the corresponding gene aceA was induced at the very beginning of growth with this substrate. Amino acid prototrophy was a metabolic requirement as well, as we isolated auxotrophic mutants that were unable to enter the second phase by the production of pyocyanin. Pyocyanin production by these mutants in co-culture could not be restored either by the addition of tryptone as carbon and amino acid source or by overexpression of PqsE, a quorum sensing effector protein for pyocyanin production.

53

CHAPTER 3 AEROMONAS HYDROPHILA – PSEUDOMONAS AERUGINOSA INTERACTIONS Introduction In their natural environments bacteria do not live as populations of individual cells that act independently, but they exist in microbial communities containing multiple bacterial species (Keller and Surette, 2006; Haruta et al., 2009; Straight and Kolter, 2009). In these multispecies environments bacteria undergo a variety of both intraand interspecific interactions (Williams, 2007; Straight and Kolter, 2009). Intraspecific interactions comprise for example cooperative activities like production of secondary metabolites or biofilm formation and are often coordinated by cell-to-cell communication through the secretion and uptake of small diffusible molecules, also known as quorum sensing (Keller and Surette, 2006; West et al., 2007). These intraspecific processes can influence interspecific interactions for example by facilitating competitive strategies that require cooperation between individuals (Hibbing et al., 2010). Very often, these strategies of bacteria are unknown. Interspecific interactions are commonly characterised by competition for nutritional resources (Hibbing et al., 2010) and therefore become important especially in nutrient-limited environments. In these environments polymeric organic compounds like cellulose or chitin constitute a major portion of organic matter (Unanue et al., 1999), and their degradation is likely to evoke interactions between heterotrophic bacteria, because it is initiated as an extracellular process. One possible interaction is the competition between investor bacteria that invest energy in the production of extracellular enzymes and opportunistic bacteria, which compete for degradation products without investing energy in enzyme production. Recently, we established a model system for such an interaction, which consists of a defined co-culture with Aeromonas hydrophila as the investor and Pseudomonas aeruginosa as the opportunist and of chitin as the sole source of carbon, nitrogen, and energy (Jagmann et al., 2010). In this study, we could demonstrate the competitive strategies employed by P. aeruginosa during interaction with A. hydrophila in the co-culture. Among other secondary metabolites P. aeruginosa produces the redox-active phenazine compound pyocyanin, which causes the release of acetate by A. hydrophila by blocking the citric acid cycle through inhibition of aconitase and, finally, the inactivation of A. hydrophila. Thus, A. hydrophila is forced into an incomplete oxidation of chitin with acetate as end product, which subsequently supports substantial growth of P. aeruginosa. This co-culture has a biphasic course. In the first phase, chitin is degraded by A. hydrophila and 54

METABOLIC REQUIREMENTS FOR THE PARASITIC GROWTH STRATEGY P. aeruginosa grows along without affecting A. hydrophila. The second phase is initiated by the quorum sensing (QS)-regulated production of secondary metabolites. The prerequisite for this is the availability of substrates for P. aeruginosa in the first phase of the co-culture. However, A. hydrophila exhibits a tight coupling of chitin hydrolysis and uptake of the degradation products. Yet, there is a transient release of acetate by this bacterium and, additionally, P. aeruginosa is able to grow with very low concentrations of organic compounds (Favero et al., 1971; van der Kooij et al., 1982), which could be released as exudates from A. hydrophila. In any case, in order to enter the second phase of the co-culture, P. aeruginosa must be able to obtain nutrients from the metabolic action of A. hydrophila to prepare for the formation of QS signal molecules and secondary metabolites. The goal of this study was to investigate the metabolic requirements that underlie the competitive strategies applied by P. aeruginosa and that enable its transition from the first into the second phase of the co-culture. For this, we employed both defined and transposon mutants of P. aeruginosa in co-culture with A. hydrophila and aimed at identifying genes and enzymes involved. We initiated our study with the construction of an isocitrate lyase mutant of P. aeruginosa to further elucidate the role of acetate as a central metabolite for this bacterium in co-culture with A. hydrophila.

Material and Methods Bacterial strains, growth media, growth experiments, and cell suspension experiments Bacterial strains and plasmids used in this study are listed in table 1. Strains of P. aeruginosa and A. hydrophila were cultivated in medium B (Jagmann et al., 2010). Tryptone, succinate, acetate, glyoxylate, fructose, glucose, and N-acetylglucosamine (GlcNAc) were used as carbon and energy sources. When chitin served as carbon, energy, and nitrogen source, ammonium was omitted from the medium. Suspended chitin was prepared as described previously (Jagmann et al., 2010). P. aeruginosa strain PAO1, A. hydrophila strain AH-1N and gene deletion mutants of strain PAO1 were maintained on solid (1.5 % w/v agar) Luria-Bertani (LB) plates. Transposon mutants of strain PAO1 were maintained on LB plates containing 80 µg ml-1 tetracycline. Plasmid-harbouring strains of P. aeruginosa were maintained on LB plates containing 350 µg ml-1 carbenicillin or 160 µg ml-1 tetracycline, respectively. 55

CHAPTER 3 AEROMONAS HYDROPHILA – PSEUDOMONAS AERUGINOSA INTERACTIONS Table 1. Strains and plasmids used in this study Strains and plasmids Pseudomonas aeruginosa PAO1 PAO1∆aceA PAO1∆crc PAO1∆crcZ PAO1∆cbrB PAO1∆PA0650::Tn PAO1∆PA5277::Tn PAO1∆PA4447::Tn PAO1∆PA3537::Tn PAO1∆PA3107::Tn PAO1∆PA4939::Tn

Aeromonas hydrophila AH-1N Escherichia coli DH5α

HB101

ST18

JM109

Plasmids pME9672 pME9673 pME9675 pEX18Ap pEX18Ap[∆aceA]

pALMAR3

56

Relevant characteristics

Source or Reference

PAO1 Nottingham wildtype PAO1 with deletion of aceA PAO1 with deletion of crc PAO1 with deletion of crcZ PAO1 with deletion of cbrB PAO1 with TcR mariner transposon inserted in PA0650 PAO1 with TcR mariner transposon inserted in PA5277 PAO1 with TcR mariner transposon inserted in PA4447 PAO1 with TcR mariner transposon inserted in PA3537 PAO1 with TcR mariner transposon inserted in PA3107 PAO1 with TcR mariner transposon inserted in PA4939

Holloway collection This study This study This study This study This study

AH-1N wildtype

Swift et al., 1999

recA1 endA1 hsdR17 thi-1 supE44 gyrA96 relA1 deoR ∆(lacZYA-argF) U196 (Φ80lacZ∆M15) – – thi-1 hsd S20 (rB , mB ) supE44 recA13 ara-14 leuB6 proA2 lacY1rpsL20 (strr) xyl-5 mtl-1 galK2 + R R pro thi hsdR Tp Sm ; chromosome::RP4-2 Tc::MuKan::Tn7/λpir ∆hemA recA1 supE44 endA1 hsdR17 gyrA96 relA1 thi (lac-proAB) F′ [traD36 proAB+ lacIq lacZ M15]

Sambrook and Russell, 2001

pME3087 with a 779-bp deletion of crc pME3087 with a 160-bp deletion in crcZ pME3087 with a 1430-bp deletion of cbrB r Gene replacement vector, Ap , sacB pEX18Ap with aceA deletion cassette as XbaI-HindIII fragment R Insertion vector for Tet Mariner transposon

This study This study This study This study This study

Promega

Thoma and Schobert, 2009

Yanisch-Perron et al., 1985

Sonnleitner et al., 2009 Sonnleitner et al., 2009 Sonnleitner et al., 2009 Hoang et al., 1998 This study

Klebensberger et al., 2007; Malone et al., 2010

METABOLIC REQUIREMENTS FOR THE PARASITIC GROWTH STRATEGY Table 1 - continued Strains and plasmids pSB401 pSB536 pSB1075 pRK2013 pUC18 pUCP18::pqsE

pME6016 pME6016[aceA]

Relevant characteristics r luxR+ PluxI’-luxCDABE Tc p15A ori ahyR+ PahyI’-luxCDABE Ampr in pAHP13 r lasR+ PlasI’-luxCDABE Amp ColE1 ori Helper plasmid for triparental conjugation; IncP Tra+ Kmr R Cloning vector; Ap Escherichia–Pseudomonas shuttle vector for pqsE complementation; ApR Cloning vector for transcriptional R lacZ fusions; Tc pME6016 with a transcriptional lacZ fusion to the aceA promoter

Source or Reference Winson et al., 1998 Swift et al., 1997 Winson et al., 1998 Figurski and Helinski, 1979 Yanisch-Perron et al., 1985 Rampioni et al., 2010

Sonnleitner et al., 2009 This study

Plasmid-harbouring Escherichia coli strains DH5α and ST18 were maintained on LB plates containing 100 µg ml-1 ampicillin and 50 µg ml-1 5-aminolevulinic acid in case of strain ST18. Growth experiments were performed as described previously (Jagmann et al., 2010). For growth experiments with chitin (0.5 % (w/v)), main cultures were inoculated at OD600=0.001. For growth experiments with tryptone (0.1 %), succinate ( 20 mM), acetate (10 mM), glyoxylate (5 mM), fructose (5 mM), glucose (5 mM), and GlcNAc (5 mM), main cultures were inoculated at OD600=0.01. Bacterial growth in single and co-cultures was measured as colony forming units in case of chitin as substrate and as OD600 in case of soluble substrates as described previously (Jagmann et al., 2010). Growth experiments for monitoring the expression of β-galactosidase were performed in 20 ml medium B containing 10 mM GlcNAc or 10 mM glucose in 100 ml Erlenmeyer flasks without baffles. For cell suspension experiments with strains PAO1 and PAO1∆aceA precultures of both strains were incubated as described above and used to inoculate main cultures in 100 ml medium B containing 10 mM glucose and 5 mM GlcNAc at OD600=0.01. Main cultures were harvested after 24 hours by centrifugation at 11000 x g for 5 min at 15° C and washed twice with medium B without ammonium and complementing solutions before resuspension in the same medium containing 3 mM glucose, 3 mM GlcNAc, or 3 mM acetate, respectively, to an OD600 of 0.8.

57

CHAPTER 3 AEROMONAS HYDROPHILA – PSEUDOMONAS AERUGINOSA INTERACTIONS Experiments were performed with 4 ml cell suspension in 15 ml test tubes in a rotary shaker at 200 r.p.m at 30° C. For cell suspension experiments with strains PAO1 and PAO1∆crc for investigation of carbon catabolite repression of GlcNAc degradation by acetate pre-cultures were incubated as described above for 8 h and used to inoculate main cultures in 100 ml medium B containing 0.5 % tryptone at OD600=0.01. Main cultures were harvested after 16 h hours by centrifugation at 8800 x g for 5 min and washed with medium B without ammonium and complementing solutions before resuspension in the same medium containing 20 mM acetate, 5 mM GlcNAc, or both, respectively, to an OD600 of 1. Experiments were performed with 20 ml cell suspension in 100 ml Erlenmeyer flasks at 200 r.p.m. at 30° C. Directly after starting and at regular intervals thereafter, samples were withdrawn from the cell suspensions and analyzed using HPLC. Quantification of substrates and degradation products Degradation of chitin was measured as described previously (Jagmann et al., 2010). Samples for measurements of degradation products were centrifuged in 1.5 ml plastic tubes at maximum speed for 15 min at room temperature. Supernatants were transferred into new plastic tubes and stored at -20° C until further analysis. Acetate, glucose, fructose, and GlcNAc were determined with ion-exclusion HPLC as described previously (Klebensberger et al., 2006). Pyocyanin was determined by reversed-phase HPLC as described previously (Jagmann et al., 2010) with 10 mM Na-K-phosphate buffer (pH 7.1; 0.105 mM K2HPO4, 0.045 mM NaH2PO4) as eluent A and acetonitrile as eluent B. Construction of plasmids and gene replacement mutants Plasmids and primers are listed in table 1 and 2, respectively. DNA cloning and plasmid preparations were performed according to standard methods. Genomic DNA of strain PAO1 was purified with the Puregene Tissue Core Kit B (Qiagen). To construct a lacZ transcriptional promoter fusion for aceA (PA2634), a 688 bp fragment containing the promoter region of aceA was amplified using primers A and B and genomic DNA of strain PAO1 as template. The PCR fragment was digested with EcoRI and PstI and ligated into the corresponding sites of pME6016, resulting in

58

METABOLIC REQUIREMENTS FOR THE PARASITIC GROWTH STRATEGY pME6016[aceA], which was introduced into strain PAO1 by transformation (Chuanchuen et al., 2002). To construct an aceA deletion mutant, two PCR products spanning parts of the upand downstream region of aceA were obtained from genomic DNA of strain PAO1 with primer C/D and E/F, respectively. The 484 bp upstream and 415 bp downstream fragments were used as templates for a second overlapping PCR (SOE-PCR; Ho et al., 1989) with primers C and F, which was possible, because the primers D and E carry a complementary sequence. The resulting fragment with a 1044 bp deletion of aceA was digested with XbaI and HindIII and ligated into the corresponding sites of the suicide vector pEX18Ap. The resulting plasmid pEX18Ap[∆aceA] was mobilized into strain PAO1 by biparental mating with E. coli strain ST18 as donor as described previously (Jagmann et al., 2010). Mutants were selected on LB plates containing 350 µg ml-1 carbenicillin and transferred onto LB plates containing 7 % sucrose for excision of the vector. The gene deletion was confirmed by PCR using primers C and F, and DNA of the wildtype served as control. To construct crc, crcZ and cbrB deletion mutants, plasmids pME9672, pME9673, and pME9675, respectively, were used. The plasmids pME9672 and pME9675 were introduced in strain PAO1 by triparental mating with the help of E. coli strain HB101(pRK2013), and the plasmid pME9673 was introduced in strain PAO1 by biparental mating with E. coli strain ST18 as donor. Mutants were selected on Pseudomonas isolation agar (PIA) or LB plates containing 160 µg ml-1 tetracycline. Excision of the vector by a second crossover was achieved by enrichment for tetracycline sensitive cells (Heurlier et al., 2003). For this, tetracycline resistant mutant cells were grown in LB medium at 200 r.p.m. for 5 hours at 37 °C before addition of 20 µg ml-1 tetracycline. After incubation for 1 hour, 800 µg ml-1 Dcycloserine were added. After further incubation for 2.5 hours, cells were harvested by centrifugation at 8800 x g for 5 min and washed with LB medium before plating on LB plates. Using replica plating, colonies were transferred on LB plates containing 160 µg ml-1 tetracycline and LB plates without an antibiotic, respectively, to identify tetracycline sensitive mutants. Gene deletions were confirmed by PCR using primers G and H, I and J, or K and L, respectively, and wildtype DNA as a control.

59

CHAPTER 3 AEROMONAS HYDROPHILA – PSEUDOMONAS AERUGINOSA INTERACTIONS Table 2. Oligonucleotides used in this study Oligonucleotides Primer A aceAP fw B aceAP rev C aceA Up fw D aceA Up rev E aceA Dn fw F aceA Dn rev G crc fw H crc rev I crcZ fw J crcZ rev K cbrB fw L cbrB rev M MARseq rev N MARseq fw O Linker Primer Linker Linker2_XmaI Linker2_XhoI Linker1

Sequence TTTTTTTGAATTCCAGGGACGCGACGACACCAG TTTTTTTCTGCAGTTCAGCGCGGCAACTGCCTT AAATCTAGACCGCAAGACAACCTTCACCA ATGCCGGCGTGGGCCGAGCCATCGAAGGTGTACAGCTCTTCGAT CGATGGCTCGGCCCACGCCGGCATCTTCCACCACCTGATCACC TTTAAGCTTACGGAGCATTGACGCTAACC TCGCGCTGATACGCCTGCAT AGGCCAACGAAGGCAAGGCC CTGGGCATTCCGCGGCGTAA GCCGCATAGTCTGCGCGGAT CGGCCGAGCTGTAGACGAGC CTTCCGACTGGCTGCGGGAC CATTAGGCACCCCAGGCTTTACACTTT ACATATCCATCGCGTCCGCC CTGCTCGCACTCACGCTCCT

CCGGTGTCCCCGTACATCGTTAGGACTACTCTTACCATCCACAT TCGATGTCCCCGTACATCGTTAGGACTACTCTTACCATCCACAT TTTCTGCTCGCACTCACGCTCCTAACGATGTACGGGGACA

Transposon mutagenesis of strain PAO1 and identification of transposon insertion sites Transposon mutagenesis of strain PAO1 with the plasmid pALMAR3 (Klebensberger et al., 2007; Malone et al., 2010) was performed as described previously (Klebensberger et al., 2007). Transposon mutants were screened for an altered phenotype during growth with chitin or chitin and 0.1 % tryptone in co-culture with strain AH-1N. For this, pre-cultures of transposon mutants were inoculated in 200 µl medium B containing 0.1 % tryptone in the wells of a 96 well plate (Nunc) using toothpicks and incubated at 200 r.p.m. for 17-19 hours at 30° C. Pre-cultures of strain AH-1N were incubated as described above. Main cultures were inoculated with cells of strain AH-1N to an OD600 of 0.001 and with 1 µl of the transposon mutant precultures in 200 µl medium B without ammonium containing 0.5 % chitin (w/v) or 0.5 % chitin and 0.1 % tryptone in 96 well plates. Plates were covered with a breathable sealing tape (Nunc) and incubated at 200 r.p.m. for 2-4 days at 30 °C. Transposon insertion sites in the genomes of selected mutants were identified by a PCR-based method using Y-linker (Kwon and Ricke, 2000) or by cloning of a genome library of the respective mutants in E. coli strain DH5α. For the PCR based method, the Ylinker were generated by mixing 9 µl linker 1 (350 ng µl-1) and 9 µl linker 2_XhoI (350 ng µl-1) or linker 2_XmaI (350 ng µl-1) (Table 2), respectively, before adding 60

METABOLIC REQUIREMENTS FOR THE PARASITIC GROWTH STRATEGY water to a final volume of 29 µl. This mixtures were heated for 2 min at 95°C and cooled to room temperature to give Y-linker[XhoI] and Y-linker[XmaI]. Genomic DNA of the respective mutants was digested with XhoI and XmaI, and approximately 40 ng were ligated to 5 µl of a 1:1 mixture of Y-linker[XhoI] and Y-linker[XmaI]. After incubation for 16-19 hours at room temperature, the ligation mixture was diluted with water to a final volume of 200 µl and incubated for 10 min at 65° C. PCR was performed with primers M and O in a final volume of 25 µl containing 2 µl of ligation mixture and 4 % DMSO. Obtained fragments were sequenced with primer M. To construct a genome library genomic DNA of the respective transposon mutants was digested with PsuI and ligated into the plasmid pUC18 digested with BamHI and dephosphorylated (FastAP Thermosensitive Alkaline Phosphatase; Fermentas). The resulting plasmids were transformed into E. coli strain DH5α, and cells harbouring plasmids with genomic DNA of the transposon mutants containing the transposon were selected on LB plates with 10 µg ml-1 tetracycline. The respective plasmids were sequenced with primer N. β-Galactosidase Assays To assess expression of the aceA promoter 100 µl- to 500 µl-culture samples were used for β-galactosidase assays, processed as described previously (Mathee et al., 1997) and assayed for activity as described previously (Miller, 1972). Measurement of isocitrate acid lyase activity and protein determination Activity of isocitrate acid lyase was measured in soluble fractions of cell extracts of strain PAO1 as described previously (Wendisch et al., 1997). For preparing cell extracts, cells of strain PAO1 were grown in 100 ml medium B with 10 mM glucose, 10 mM GlcNAc, or 30 mM acetate as described above and harvested in early and mid-exponential phase in case of GlcNAc- and glucose-grown cultures and in midexponential phase in case of acetate-grown cultures. For this, cultures were poured into plastic tubes and centrifuged at 11000 x g for 10 min at 4°C. Cells were washed twice with ice-cold 50 mM MOPS buffer (pH 7.3) and finally resuspended in 1.5 ml of the same buffer. These cell suspensions were transferred into serum bottles, and cells were disrupted by French Press as described earlier (Jagmann et al., 2010). Cell extracts were separated from cell debris by centrifugation at 20000 x g for 20 min at 4° C and subsequently ultracentrifuged at 45000 for 60 min rpm at 4 °C to 61

CHAPTER 3 AEROMONAS HYDROPHILA – PSEUDOMONAS AERUGINOSA INTERACTIONS obtain soluble fractions. Assay mixtures were prepared as described previously (Wendisch et al., 1997), but contained 5 U LDH, 50 µl soluble fraction and were started by the addition of 5 mM D,L-isocitrate. The decrease of NADH was monitored in a spectrophotometer at 365 nm (ε = 3.4 mM-1 cm-1) at 30° C. Protein concentrations in the soluble fractions were determined using the Pierce BCA Protein Assay Kit (Thermo Scientific). Bioassay for AHL production Co-cultures of strain AH-1N and strain PAO1 or mutant strains of PAO1 were tested for AHL production in bioassays with the bioluminescent E. coli sensor strains JM109(pSB401), JM109(pSB536), and JM109(pSB1075) as described previously (Styp von Rekowski et al., 2008). At each sampling time aliquots of the co-cultures were centrifuged at maximum speed for 15 min, and 50 µl of the supernatant were used in the assay. Results Growth of an aceA mutant of P. aeruginosa in co-culture In our previous study we could show that growth of strain PAO1 in the second phase of the co-culture is at least to a large extent based on acetate as carbon and on ammonium as nitrogen source, which are released by strain AH-1N (Jagmann et al., 2010). However, the metabolic basis for growth of strain PAO1 in the first phase of the co-culture, apart from possible storage material, remains elusive. No primary chitin degradation products were detectable with HPLC analysis as strain AH-1N exhibits a tight coupling of chitin hydrolysis and uptake of degradation products, but up to 2 mM of acetate are released in this first phase of the co-culture by strain AH1N. To investigate the role of acetate as a central growth substrate for strain PAO1 in both phases of the co-culture an aceA mutant of strain PAO1 was constructed. This mutant lacks isocitrate lyase, which catalyses the formation of succinate and glyoxylate from isocitrate. It is the key enzyme of the glyoxylate pathway, which is necessary for the utilization of acetate as carbon source. Consequently, strain PAO1∆aceA could not grow with acetate as sole carbon and energy source (not shown). In co-culture with strain AH-1N and chitin, CFUs of strain PAO1∆aceA 62

METABOLIC REQUIREMENTS FOR THE PARASITIC GROWTH STRATEGY reached significantly lower numbers compared to strain PAO1, while growth of strain AH-1N was not affected by the presence of strain PAO1∆aceA (Fig.1A). The culture did not turn green indicating that strain PAO1∆aceA was not able to produce secondary metabolites like pyocyanin for the inactivation of strain AH-1N. The formation of secondary metabolites in strain PAO1 is regulated by quorum sensing. P. aeruginosa possesses a hierarchically organized quorum sensing system that consists of two regulatory circuits (las and rhl) employing N-acylhomoserine lactones (AHLs) as signal molecules (N-(3-oxo-dodecanoyl)-L-homoserine lactone (3-oxo-C12-HSL) and N-(butanoyl)-L-homoserine lactone (C4-HSL), respectively) and a chemically distinct QS system employing 2-alkyl-4(1H)-quinolones (AQs) as signal molecules (mainly the Pseudomonas quinolone signal (PQS) and 2-heptyl-4quinolone (HHQ)) (Williams and Càmara, 2009). A. hydrophila possesses a quorum sensing system that consists of the ahy circuit employing C4-HSL (Swift et al., 1997). Bioassays indicated the presence of C6-HSL, C4-HSL and 3-oxo-C12-HSL in cocultures of strains AH-1N and PAO1∆aceA. Compared to co-cultures with both wildtypes, less C4-HSL could be detected (Fig. 1B,C). Thus, despite the production of AHLs, strain PAO1∆aceA was not able to enter the second phase of the co-culture by producing pyocyanin and inactivating strain AH1N. This indicated that the reaction catalysed by isocitrate lyase was a key metabolic prerequisite for strain PAO1 in the first phase of the co-culture to be able to enter the second phase of the co-culture. Growth with and degradation of GlcNAc by strain PAO1∆aceA Besides acetate the only plausible product resulting from chitin degradation by strain AH-1N that could be used by strain PAO1 for growth in the first phase of the coculture is GlcNAc. Strain PAO1 could not grow with (GlcNAc)2 and (GlcNAc)3 (Jagmann et al., 2010). To investigate whether the deletion of aceA had any influence on growth with this substrate, strain PAO1∆aceA was incubated with GlcNAc as sole carbon and energy source (Fig. 2). Strain PAO1∆aceA did not grow with GlcNAc within 100 hours of incubation. There was no difference in growth with glucose or fructose as only carbon and energy sources compared to the wildtype indicating that deletion of aceA did not lead to a general defect in sugar utilization. Degradation of GlcNAc as it is known from aquatic chitin-degrading bacteria such as Aeromonads and Vibrio species involves transport of GlcNAc into the cytoplasm via 63

CHAPTER 3 AEROMONAS HYDROPHILA – PSEUDOMONAS AERUGINOSA INTERACTIONS 10 10

Fig.1.

A

Growth

production

10 9

by

of

and

AHL

A.

hydrophila

cfu ml-1

strain AH-1N and P. aeruginosa 10

8

strains PAO1 and PAO1∆aceA in co-cultures with chitin. A.

107

Growth in co-culture: CFUs of

106

strain AH-1N in co-cultures with 10

5

1

0

2

3

4

5

6

AH-1N in co-cultures with strain

time [d] 160 140

strain PAO1 (
); CFUs of strain

PAO1∆aceA (); CFUs of strain

B

PAO1

(
);

CFUs

of

strain

Error

bars

[ %] of control

120

PAO1∆aceA

100 80

indicate

60

(n=4). B., C. Production of C6-

40

HSL (black bar), C4-HSL (light

20

grey bar), and 3-oxo-C12-HSL

0 1

2

3

4

160 140

standard

deviation

(dark grey bar) in co-cultures of strain

time [d]

AH-1N

and

strain

PAO1∆aceA (B) or strain PAO1

C

(C). Values are expressed as

120 [ %] of control

().

percentages

100

of

control

80

measurements (set to 100 %)

60

with 0.5 µM of C6-HSL, C4-HSL,

40

and 3-oxo-C12-HSL, respectively.

20

Values represent means of two

0 1

2

3

4

independent cultures.

time [d]

the PEP:GlcNAc phosphotransferase system and conversion of the resulting GlcNAc6-phosphate to fructose-6-phosphate, acetate and ammonia by GlcNAc-6-phosphate deacetylase and glucosamine-6-phosphate deaminase (Keyhani and Roseman, 1999). In P. aeruginosa intermediates of the tricarboxylic acid cycle usually cause catabolite repression of pathways for the degradation of sugars and other carbon sources (Wolff et al., 1991). To test whether the acetate formed at the beginning of GlcNAc degradation might inhibit further degradation of the resulting sugar moiety, 64

METABOLIC REQUIREMENTS FOR THE PARASITIC GROWTH STRATEGY

1

OD600

0.8 0.6 0.4 0.2 0 0

20

40

60

80

100

time [h]

Fig. 2. Growth of P. aeruginosa strains PAO1 (closed symbols) and PAO1∆aceA (open symbols) with GlcNAc (
,), glucose (,), and fructose (
,). Error bars represent standard deviation (n=3).

thus inhibiting growth of an aceA mutant, strain PAO1∆aceA was incubated with fructose and acetate. However, strain PAO1∆aceA could grow and reached the same optical density as the wildtype indicating that catabolite repression did not lead to the impaired growth of strain PAO1∆aceA with GlcNAc. If glyoxylate was added to cultures of strain PAO1∆aceA containing GlcNAc, this strain could grow and reached the same optical density as the wildtype. Thus, the ability of strain PAO1 to form glyoxylate from isocitrate by the action of isocitrate lyase was crucial for the degradation of GlcNAc. To further investigate the effect of aceA disruption on the degradation of GlcNAc cell suspensions experiments with strains PAO1 and PAO1∆aceA were carried out. Cells of both strains were incubated with 3 mM GlcNAc, glucose or acetate, respectively, as sole substrates. No differences could be observed with respect to the degradation of glucose (Fig. 3A). In suspensions of both strains, glucose was degraded within 3 hours with transient accumulation of two intermediates (P9.2, P10.6). No differences could be observed with respect to degradation of GlcNAc as well (Fig. 3B). GlcNAc was fully degraded between 10 and 23 hours, and no accumulation of degradation intermediates could be observed. Degradation of acetate, however, was delayed in cell suspensions of strain PAO1∆aceA compared to cell suspensions of strain PAO1 (Fig. 3C). Acetate was fully degraded in cell suspensions of strain 65

CHAPTER 3 AEROMONAS HYDROPHILA – PSEUDOMONAS AERUGINOSA INTERACTIONS PAO1 within 6.5 hours, whereas acetate concentration had only decreased to 2.3 mM in suspensions of strain PAO1∆aceA at this point of time. Thus, the deletion of aceA had no effect on the uptake and dissimilation of GlcNAc in this strain.

400

4

A

Fig. 3. Degradation of glucose,

3

3 00

2. 5 2

200

1. 5 1

GlcNAc, and acetate by cell suspensions of P. aeruginosa strains PAO1 (open symbols)

10 0

and

0 .5 0

0 5

0

10

15

20

25

B

3 .5

PAO1∆aceA

(closed

symbols). A. Concentration of glucose (,) and peak area

tim e [h ] 4

concentration [mM]

peak area x 10 3

concentration [mM]

3. 5

of

the

unknown

degradation

3 2 .5

glucose

products

P9.2

(
,) and P10.6 (
,). B.

2 1 .5

Concentration of GlcNAc. C.

1

Concentration of acetate. Error

0 .5

bars

0 0

5

10

15

20

25

15

20

25

t im e [h ] 4

C

concentration [mM]

3. 5 3 2. 5 2 1. 5 1 0 .5 0 0

5

10 tim e [h ]

66

represent

deviation (n=3).

standard

METABOLIC REQUIREMENTS FOR THE PARASITIC GROWTH STRATEGY Activity of isocitrate lyase and expression of aceA during growth with GlcNAc To further investigate the role of the isocitrate lyase during growth of strain PAO1 with GlcNAc, we measured specific isocitrate lyase activity in GlcNAc-grown cultures compared to glucose-grown cultures in early (OD600=0.15) and mid-exponential (OD600=0.6-1.0) growth phase (Fig. 4). In glucose-grown cells a low specific activity of about 8 mU (mg protein)-1 could be detected in both growth phases. In GlcNAcgrown cells, the activity was slightly higher in the early exponential (16 mU (mg protein)-1) compared to the mid-exponential growth phase (11 mU (mg protein)-1). Still, this activity constituted only about 20 % of the activity measured in acetategrown cultures, in which the ability of strain PAO1 to grow inevitably depended on the action of isocitrate lyase.

100

mU (mg protein)-1

90 80

20 10 0 A

B

GlcNAc

B

B

glucose

acetate

A

Fig. 4. Specific activity of isocitrate lyase in soluble fractions of cell extracts of P. aeruginosa strain PAO1 during growth with GlcNAc, glucose, or acetate. Cells were harvested in early exponential phase (A) and mid-exponential phase (B). Error bars represent standard deviation (n=3).

In addition, the expression of aceA during growth of strain PAO1 with GlcNAc was monitored with the help of a transcriptional fusion of the aceA promoter region to lacZ (Fig. 5). The activity of β-galactosidase was maximal in the early phase of growth with GlcNAc between 4 and 19 hours and an OD600 between 0.01 and 0.06, before decreasing concomitant with growth. Activity of β-galactosidase during growth with glucose remained on a constant level of about 500 Miller Units independent of the 67

CHAPTER 3 AEROMONAS HYDROPHILA – PSEUDOMONAS AERUGINOSA INTERACTIONS growth phase (not shown). These results indicated that in strain PAO1 the isocitrate

3500

1

3000

0.9 0.8

2500

0.7 0.6

2000

0.5 1500

0.4

1000

0.3

OD 600

ß-Galactosidase activity [Miller Units]

lyase played an important role at the very beginning of growth with GlcNAc.

0.2

500

0.1

0

0 0

20

40

60

80

time [h]

Fig. 5. β-Galactosidase activity of a transcriptional aceA-lacZ fusion in P. aeruginosa strain PAO1 during growth with GlcNAc. β-Galactosidase activity () and growth () in strain PAO1 carrying pME6016::aceA. β-Galactosidase activity (
) and growth () in strain PAO1 carrying pME6016 only as a control. Error bars represent standard deviation (n=3).

Analysis of catabolite repression in strain PAO1 during growth with GlcNAc and acetate As described above, previous studies showed that in P. aeruginosa intermediates of the tricarboxylic acid cycle cause catabolite repression of degradation pathways for sugars, amino acids, and other carbon sources mediated by the Crc protein on the translational level by binding to target mRNAs. The small RNA crcZ, whose expression is controlled by the CbrA/CbrB two-component system and the sigma factor rpoN, acts as an antagonist by sequestering Crc in the presence of a nonpreferred substrate as sole carbon source, thus resulting in translation of target mRNAs (Sonnleitner et al., 2009). As GlcNAc and acetate are the only substrates produced by strain AH-1N during chitin degradation that could be used by strain PAO1 in the first phase of the co-culture, we wanted to investigate whether catabolite repression played a role during growth of this strain at this point of the co-culture.

68

METABOLIC REQUIREMENTS FOR THE PARASITIC GROWTH STRATEGY First, we investigated whether there was catabolite repression of the GlcNAc degradation pathway by acetate in strain PAO1. Incubation of strain PAO1 with both acetate and GlcNAc as carbon and energy sources did not reveal a diauxic mode of growth as it is known from E. coli, for example (Loomis and Magasanik, 1967) (not shown). Therefore, we conducted cell suspension experiments with GlcNAc and acetate compared to GlcNAc only to further examine a possible catabolite repression with this carbon sources in strain PAO1 (Fig. 6A). In cell suspensions with GlcNAc as sole substrate GlcNAc concentration started to decrease after 3 hours of incubation. In cell suspensions with both substrates, acetate was rapidly degraded within 5 hours of incubation. In this time period GlcNAc concentration decreased only slightly before a more rapid decrease after 6 hours of incubation. In these cell suspensions GlcNAc degradation, though slow, started from the beginning of incubation indicating that the degradation pathway of GlcNAc is at least not fully repressed by the presence of acetate. Compared to cell suspensions with only GlcNAc as carbon source, GlcNAc degradation was slower and only commenced to become steeper after acetate had been fully degraded. As a next step, we conducted the same cell suspension experiments with a crc mutant of strain PAO1 that should not be able to exhibit catabolite repression any more (Fig. 6B). No difference in GlcNAc degradation could be detected in cell suspensions with GlcNAc and acetate as substrates compared to cell suspensions with GlcNAc only as a substrate. These results showed that there was no distinct catabolite repression of the GlcNAc degradation pathway by acetate in strain PAO1. Rather, it was a gradual mode of repression, which is in agreement with the finding that crcZ/Crc ratios in P. aeruginosa can vary depending on the carbon source (Sonnleitner et al., 2009), which would lead to gradual modes of repression. Impact of catabolite repression on growth of strain PAO1 in co-culture To investigate whether this gradual catabolite repression of GlcNAc degradation by acetate had an effect on the outcome of the co-culture, we co-incubated strain AH-1N with strains PAO1∆crc, PAO1∆crcZ and PAO1∆cbrB, respectively. CFU counts in these co-cultures did not differ compared to CFUs of strain PAO1 in co-culture (not shown). Strain AH-1N was inactivated by pyocyanin and strains of PAO1 commenced to grow in the second phase of the co-culture. Whereas co-cultures of 69

CHAPTER 3 AEROMONAS HYDROPHILA – PSEUDOMONAS AERUGINOSA INTERACTIONS

A

30 25

8

Fig.

7

catabolite repression of the

20

5 4

15

3

10 5 0 0

2

4

8

0

sole

substrate

(
)

in

cell

8

strain

7

represent standard deviation

15

4 3

10 5 0 6

8

10

GlcNAc [mM]

acetate [mM]

strain PAO1. A. Degradation of

acetate () and of GlcNAc as

5

time [h]

by acetate in P. aeruginosa

suspensions of P. aeruginosa

20

4

GlcNAc degradation pathway

1

6

2

of

GlcNAc (
) in the presence of

10

25

0

Characterization

2

time [h]

B

30

6

GlcNAc [mM]

acetate [mM]

6

6.

(n=4).

PAO1.

B.

Error

bars

Degradation

of

GlcNAc () in the presence of acetate () and of GlcNAc as

2

sole

substrate

1

suspensions of P. aeruginosa

0

strain represent

()

PAO1∆crc. means

in

cell

Values of

two

independent cell suspensions.

strain AH-1N with strains PAO1∆crc and PAO1∆cbrB showed a similar green coloration as co-cultures with strain PAO1, the co-culture of strain AH-1N with strain PAO1∆crcZ showed a blue coloration indicating a modified formation of secondary metabolites. This change in colour could result either from the formation of higher amounts of pyocyanin or from the production of less yellow-green coloured secondary metabolites as pyoverdine. According to the model of catabolite repression by Crc, deletion of crc should have the opposite effect of deletion of cbrB or crcZ as deletion of those genes would lead to a prolonged binding of Crc to the target mRNA. Despite these opposite effects on the metabolism, there was no difference in the outcome of the co-cultures with regard to the ability of the PAO1 strains to exploit strain AH-1N. Identification of transposon mutants with defects in metabolic pathways In addition to defined mutants we carried out transposon mutagenesis to generate and select mutants, which produced less or no pyocyanin in co-culture and were thus 70

METABOLIC REQUIREMENTS FOR THE PARASITIC GROWTH STRATEGY unable to enter the second phase of the co-culture. Transposon mutants were selected in co-culture with chitin as sole carbon, nitrogen, and energy source. To identify metabolic requirements that were important for strain PAO1 for entering the second phase of the co-culture, we concentrated on mutants with defects in metabolic pathways. We could select five transposon mutants that showed no production of pyocyanin. These mutants had transposon insertions in genes that were involved in amino acid biosynthesis (PA3537, PA3107, PA0650, PA5277, PA4939; Table 3). All five mutants could not enter the second phase of the co-culture as they produced no pyocyanin and were thus unable to inactivate strain AH-1N. To identify further genes involved in the metabolism of strain PAO1 in the first phase of the co-culture and to avoid mutants with transposon insertions in genes involved in amino acid biosynthesis, mutants from a subsequent transposon mutagenesis were selected in co-cultures with chitin and 0.1 % tryptone as external source of amino acids. Nevertheless, from 3 mutants selected in total, 2 had an insertion in genes involved in histidine biosynthesis, one of which was again mapped to PA4939 (PA4447, PA4939; Table 3). This indicated that at least the inability to synthesize histidine could not be complemented by the addition of an external source of amino acids. To confirm that mutants with transposon insertion in amino acid biosynthetic genes were auxotrophic, they were incubated in medium B with succinate as only carbon and energy source without addition of external amino acids. Neither of the mutants could grow. The auxotrophic mutants had transposon insertions in genes involved in the biosynthesis of different classes of amino acids. Methionine (strain PAO1∆PA3107) belongs to the class of nonpolar hydrophobic amino acids, whereas tryptophan (strain PAO1∆PA0650) belongs to the class of uncharged polar amino acids. Arginine (strain PAO1∆PA3537), lysine (strain PAO1∆PA5277), and histidine (strains PAO1∆PA4447 and PAO1∆PA4939) are cationic alkaline amino acids.

71

CHAPTER 3 AEROMONAS HYDROPHILA – PSEUDOMONAS AERUGINOSA INTERACTIONS Table 3. Auxotrophic mutants obtained by transposon mutagenesis and the respective interrupted biosynthetic pathways. PRPP: phosphoribosyl pyrophosphate Strain

Interrupted gene PA3537 (argF)

Encoded protein

PAO1∆PA3107

PA3107 (metZ)

o-succinylhomoserine sulfhydrylase

methionine

PAO1∆PA0650

PA0650 (trpD)

anthranilate phosphoribosyltransferase

tryptophan

PAO1∆PA5277

PA5277 (lysA)

diaminopimelate decarboxylase

lysine

PAO1∆PA4447

PA4447 (hisC1)

histidinol-phosphate aminotransferase

histidine

PAO1∆PA4939

PA4939 (hisZ)

ATP-phosphoribosyltransferase regulatory subunit

histidine

PAO1∆PA3537

carbamoyltransferase

Biosynthesis pathway arginine

Reaction catalysed carbamoyl-phosphate + Lornithine
L-citrulline + Pi o-succinyl-L-homoserine + cysteine
cystathionin + succinate anthranilate + PRPP
N(5-phosphoribosyl)anthranilate + PPi meso-2.6diaminopimelate
Llysine +CO2 imidazol-acetol-phosphate + L-glutamate
L-histidinol-phosphate + α-ketoglutarate PRPP + ATP
5’phosphoribosyl-ATP + PPi

Influence of auxotrophy on growth of strain PAO1 in co-culture To further characterize the effect of auxotrophy on the metabolism of strain PAO1 during growth in co-culture we chose strain PAO1∆PA4939 for further investigations. First, we tried to complement this strain during growth in medium B with succinate as only carbon source by the addition of 20 µM or 200 µM L-histidine, respectively. In these cultures, only slight turbidity could be observed, and growth of strain PAO1∆PA4939 could not be fully restored. On the contrary, growth of strain PAO1 was negatively affected by the addition of 200 µM histidine. To characterize growth of strain PAO1∆PA4939 in co-culture with strain AH-1N in detail, both strains were co-incubated with chitin and with chitin and tryptone, respectively. In co-cultures with chitin, CFUs of strain PAO1∆PA4939 did not get beyond the inoculation number within 4 days, growth of strain AH-1N was not affected, and the culture did not turn green (Fig. 7A). Bioassays indicated only traces of C4-HSL and 3-oxo-C12-HSL (not shown). In co-cultures with chitin and tryptone, CFUs of strain PAO1∆PA4939 increased to about 108 CFUs ml-1 within 9 hours, and growth did not differ from strain PAO1 in co-culture with strain AH-1N. In the same time frame CFUs of strain AH-1N increased to about 109 CFUs ml-1 and were not affected by the presence of strain PAO1∆PA4939, whereas in co-culture with strain 72

METABOLIC REQUIREMENTS FOR THE PARASITIC GROWTH STRATEGY PAO1, CFUs of strain AH-1N rapidly decreased after 9 hours of growth concomitant with pyocyanin production by strain PAO1 (Fig. 7B). In co-cultures with strain PAO1∆PA4939 no pyocyanin was produced. However, bioassays indicated the presence of C6-HSL, C4-HSL and 3-oxo-C12-HSL (Fig. 7C, D). Compared to the AHL profile of the co-culture with strain PAO1, less C6-HSL was detectable. Luminescence intensity of the indicator strain indicating the presence C4-HSL

1010

1010

A

10 9

10 cfu ml-1

10 8 cfu ml-1

B

9

107

108 107

106 106

105

105

104 20

0

40

60

80

100

5

0

10

15

time [h] 250

25

30

time [h] 250

C

200

D

200 [ %] of control

[ %] of control

20

150 100 50

150 100 50 0

0 5

9

21.75 time [h]

28.75

5

9

21.75

28.75

time [h]

Fig.7. Growth of A. hydrophila strain AH-1N with P. aeruginosa strains PAO1 or PAO1∆PA4939 in co-cultures with chitin or chitin and tryptone and AHL production by these strains in co-cultures with chitin and tryptone. Growth in co-cultures with chitin (A) and with chitin and tryptone (B): CFUs of strain AH-1N in co-cultures with strain PAO1 (
); CFUs of strain AH-1N in co-cultures with strain PAO1∆PA4939 (); CFUs of strain PAO1 (
); CFUs of strain PAO1PA4939 (). Error bars indicate standard deviation (n=3). Production of C6-HSL (black bar), C4-HSL (light grey bar), and 3-oxo-C12-HSL (dark grey bar) in co-cultures of strain AH-1N and strain PAO1∆PA4939 (C) or strain PAO1 (D) with chitin and tryptone. Values are expressed as percentages of control measurements (set to 100 %) with 0.5 µM of C6-HSL, C4-HSL, and 3-oxo-C12-HSL, respectively. Values represent means of two independent cultures.

73

CHAPTER 3 AEROMONAS HYDROPHILA – PSEUDOMONAS AERUGINOSA INTERACTIONS decreased in wildtype co-cultures after 9 hours, but showed only a slight decrease in co-cultures with strain PAO1∆PA4939 after 21.75 hours. 3-oxo-C12-HSL could be detected throughout incubation in co-cultures with strain PAO1∆PA4939 but was no longer detectable in wildtype co-cultures at 21.75 hours. As described previously (Jagmann et al., 2010), co-cultures of strains AH-1N and PAO1 with tryptone as only substrate do not turn green, and there is no inactivation of strain AH-1N. When strain PAO1∆PA4939 was co-incubated with strain AH-1N with tryptone, there was no difference in CFU numbers, AHL production, and colour formation compared to the wildtype co-culture. Single cultures of strain PAO1 and strain PAO1∆PA4939 with tryptone also showed the same pattern of AHL production and no green colour formation (not shown). These results indicated that the auxotrophy of strain PAO1∆PA4939 had no effect on its ability to produce AHL. Next, we wanted to investigate whether the transposon insertion in strain PAO1∆PA4939 caused a general defect in pyocyanin formation. For this, strain PAO1∆PA4939 was incubated in medium B with 20 mM succinate and 0.1 % tryptone. Under these conditions, strain PAO1 produced high amounts of pyocyanin. There was no difference in the production of pyocyanin between cultures of strain PAO1∆PA4939 and strain PAO1 (not shown). In consequence, the auxotrophy of strain PAO1∆PA4939 had no effect on its ability to produce pyocyanin. Thus, in coculture with strain AH-1N strain PAO1∆PA4939 could not enter the second phase of the co-culture despite the production of AHL and the general ability to produce pyocyanin. Next, we investigated whether there were any amino acids in the culture supernatant that could support growth of strain PAO1∆PA4939. For this, we harvested cell-free culture supernatant from a co-culture of strains PAO1∆PA4939 and AH-1N after 20 hours of growth with chitin and tryptone, and incubated strain PAO1∆PA4939 in this culture supernatant with succinate as carbon and ammonium as nitrogen source. Additionally, the culture supernatant was complemented in the same way as medium B. Within 48 hours of incubation no growth of strain PAO1∆PA4939 could be detected (not shown). This indicated that there were either no amino acids in the culture supernatant or strain PAO1∆PA4939 could not use them to support growth. The production of pyocyanin depends on the action of PqsE, which is the effector of the AQ quorum sensing system response (Farrow et al., 2008). To investigate whether the overexpression of pqsE would lead to pyocyanin production by strain PAO1∆PA4939 74

in

co-culture

with

strain

AH-1N,

we

co-incubated

strain

METABOLIC REQUIREMENTS FOR THE PARASITIC GROWTH STRATEGY PAO1∆PA4939 harbouring either pUCP18::pqsE or pUCP18 as a control, respectively, and strain AH-1N with chitin and tryptone and analysed the production of pyocyanin after 48 hours of incubation. This experiment was also carried out with strains PAO1∆PA5277, PAO1∆PA3537, PAO1∆PA3107, PAO1∆PA0650, and PAO1∆pqsA as control (Fig 8). Overexpression of pqsE had an effect on pyocyanin production in strain PAO1∆PA3107 and PAO1∆PA0650, which produced pyocyanin already in small amounts without the overexpression of pqsE. Overexpression of pqsE had a minor effect in strain PAO1∆PA4939. Strains PAO1∆PA3537 and PAO1∆PA5277 did not produce pyocyanin when pqsE was overexpressed. The concentration of pyocyanin produced by the mutants, however, never reached the concentration produced by strain PAO1∆pqsA during overexpression of pqsE.

180

concentration [µM]

160 140 120 100 80 60 40 20 0 + -

+ -

+ -

+ -

+ -

+ -

PA5277 PA3537 PA3107 PA0650 PA4939 ∆pqsA

Fig. 8. Formation of pyocyanin after 48 hours of incubation by pqsE-overexpressing auxotrophic transposon mutants of P. aeruginosa strain PAO1 and by P. aeruginosa strain PAO1∆pqsA in co-culture with A. hydrophila strain AH-1N with chitin and tryptone. Pyocyanin formation in the presence of pUCP18::pqsE (+) or of pUCP18 as negative control (-). Values are means of two independent cultures.

These results indicated that the inactivation of genes required for biosynthesis of certain amino acids did not lead to an overall similar phenotype, but that there were differences regarding the ability to produce pyocyanin. However, no mutant strain could be fully complemented by the presence of tryptone or the overexpression of pqsE. Thus, the inability of the auxotrophic mutants to produce the wildtype level of

75

CHAPTER 3 AEROMONAS HYDROPHILA – PSEUDOMONAS AERUGINOSA INTERACTIONS pyocyanin was caused by a restriction in metabolism that occurred downstream of the action of PqsE. Taken together, prototrophy is a crucial metabolic prerequisite for strain PAO1 to be able to enter the second phase of the co-culture.

Discussion Our model system for studying interactions between investor and opportunistic bacteria during polymer degradation consists of a defined co-culture with Aeromonas hydrophila strain AH-1N as the investor and Pseudomonas aeruginosa strain PAO1 as the opportunist and with chitin as the sole source of carbon, nitrogen, and energy. This co-culture has a biphasic course. In the first phase, strain PAO1 has to metabolically prepare for the production of quorum sensing signal molecules and of secondary metabolites like pyocyanin to be able to enter the second phase of the coculture, in which it forces the release of acetate by strain AH-1N, until this strain is finally inactivated. In this study we investigated the metabolic requirements underlying the transition of strain PAO1 from the first into the second phase of the coculture. We initiated our study by setting up a co-culture of an isocitrate lyase mutant of strain PAO1 (strain PAO1∆aceA) with strain AH-1N to investigate whether acetate had the presumed role as a central growth substrate for strain PAO1 in the co-culture. Coincubation of these strains indicated that isocitrate lyase activity was crucial for growth of strain PAO1 already in the first phase of the co-culture as strain PAO1∆aceA did not produce pyocyanin and, thus, could not enter the second phase of the co-culture. If isocitrate lyase activity had been necessary only in the second phase of the co-culture, strain PAO1∆aceA would have been able to produce secondary metabolites thus forcing the release of acetate by strain AH-1N but could not have grown with this substrate in the second phase. Strain PAO1∆aceA was still able, however, to produce C4-HSL and 3-oxo-C12-HSL. Thus, strain PAO1∆aceA acquired sufficient amounts of nutrients or utilised storage material to produce signal molecules, but was not able to react to these signals showing that the action of isocitrate lyase was a crucial metabolic requirement for entering the second phase of the co-culture. This could have been due to two reasons. First, acetate could be the most important substrate already in the first phase of the co-culture. Second, GlcNAc

76

METABOLIC REQUIREMENTS FOR THE PARASITIC GROWTH STRATEGY could play an important role as well, because strain PAO1∆aceA did not grow with GlcNAc within about 4 days of incubation. Besides acetate, GlcNAc is one of the intermediates of chitin degradation formed by strain AH-1N that can be utilized by strain PAO1 (Jagmann et al., 2010). Strain PAO1∆aceA had no general defect in sugar metabolism as it showed no differences in growth with and degradation of glucose and in growth with fructose compared to the wildtype. As most of them are devoid of 6-phosphofructokinase (Sawyer et al., 1977; Heath and Gaudy, 1978) Pseudomonads dissimilate carbohydrates mainly via the Entner-Doudoroff pathway (Wang et al., 1959; Lessie and Phibbs, 1984). Carbohydrates are converted into 6-phosphogluconate and further into the central metabolite

2-keto-3-desoxy-6-phosphogluconate

(KDPG)

that

is

cleaved

by

KDPG aldolase into glyceraldehyde-3-phosphate (GAP) and pyruvate, which can be further degraded via the TCA cycle after oxidative decarboxylation to acetyl-CoA. The degradation of glucose involves both a direct oxidative and a phosphorylative pathway for its conversion to 6-phosphogluconate. The direct oxidative pathway is induced during growth with high concentrations of glucose and involves its oxidation to gluconate and 2-ketogluconate by membrane-associated dehydrogenases in the periplasm. Two-ketogluconate is then transported into the cell and further converted to 6-phosphogluconate. The two intermediates that were transiently released during degradation of glucose by cell suspensions of strains PAO1 and PAO1∆aceA were likely to be gluconate (P9.2) and 2-ketogluconate (P10.6). The phosphorylative pathway on the other hand is induced during growth with limiting concentrations of glucose, and glucose is directly transported into the cytoplasm and phosphorylated to glucose-6-phosphate before oxidation to 6-phosphogluconate. In contrast to glucose, fructose is transported into the cytoplasm via the PEP:fructose phosphotransferase system (PTS), forming fructose-1-phosphate. Thus, no intermediates of fructose degradation should be released. In contrast to glucose and fructose, the dissimilation pathway of GlcNAc in Pseudomonads is not fully resolved. Genes for the metabolism of GlcNAc by P. aeruginosa are organized in the nag operon (Reizer et al., 1999), the transcription of which is induced by GlcNAc (Korgaonkar and Whiteley, 2011). The operon is composed of the transcriptional regulator nagR that positively regulates the transcription of the operon, a putative GlcNAc-6-phosphate deacetylase (nagA), a putative glucosamine-fructose-6-phosphate aminotransferase (nagS), and two genes that comprise the components of the PEP:GlcNAc phosphotransferase system 77

CHAPTER 3 AEROMONAS HYDROPHILA – PSEUDOMONAS AERUGINOSA INTERACTIONS (nagE, nagF). According to the data available (Iwamoto and Imanaga, 1991; Reizer et al., 1999; Korgaonkar and Whiteley, 2011) a model of GlcNAc degradation can be derived (Fig. 9). GlcNAc is transported via its PTS into the cytoplasm, and the resulting GlcNAc-6-phosphate is deacetylated by NagA or another enzyme that can functionally complement NagA, since deletion of nagA has no effect on growth with GlcNAc (Korgaonkar and Whiteley, 2011). Further degradation of the resulting glucosamine-6-phosphate is unclear. There are three possible pathways for this. First, although no orthologue of the E. coli glucosamine-6-phosphate deaminating isomerase gene (nagB) was found in the nag operon of P. aeruginosa (Reizer et al., 1999), there is a possibility of a functionally complementing enzyme encoded somewhere else in the genome (pathway B in Fig. 9). The resulting fructose-6phosphate could then be converted into glucose-6-phosphate and further degraded to KDPG via the reactions of the Entner-Doudoroff pathway. Second, glucosamine-6phosphate could be converted into fructose-6-phosphate by the aminotransferase NagS (GlmS) (pathway A in Fig. 9), which could then be further degraded to KDPG as in pathway B. However, deletion of nagS has no effect on growth with GlcNAc (Korgaonkar and Whiteley, 2011). Third, a 6-phospho-gluconolactonase encoded by pgl could be involved, which is not located within the nag operon and is an orthologue of the deaminating isomerase NagB of E. coli (pathway C in Fig. 9). This enzyme could secondarily catalyze deamination of 6-phospho-glucosaminate derived from 6-phospho-glucosaminolactone to KDPG. 6-phospho-glucosaminolactone could be derived from glucosamine-6-phosphate by the reaction catalyzed by glucose-6phosphate dehydrogenase (Zwf; Reizer et al., 1999). A fourth possibility, which has not been observed, however, could be the formation of acetamide from GlcNAc-6phosphate. P. aeruginosa is able to utilize acetamide, which is used to determine the presence of this bacterium in water samples by growth on acetamide broth (European ISO Norm 12780:2002). Acetamide is cleaved into acetate and ammonia by an acetamidase. According to the proposed model, acetate is cleaved off at the initial stage of GlcNAc degradation. This is in agreement with the results showing that the aceA promoter was maximally expressed and specific isocitrate lyase activity was highest at the beginning of growth of strain PAO1 with GlcNAc. Thus, the activity of isocitrate lyase at the very beginning of growth with GlcNAc was important to enable the degradation of GlcNAc. Because of the presence of GlcNAc, the nag operon should have been 78

METABOLIC REQUIREMENTS FOR THE PARASITIC GROWTH STRATEGY

A

B

C

Fig. 9. Putative pathways of GlcNAc degradation by P. aeruginosa strain PAO1. After uptake by a PEP:GlcNAc phosphotransferase system (PTS), deacetylation by a GlcNAc-6phosphate deacetylase (NagA) and a deamination step (pathways A, B, C), GlcNAc is degraded via KDPG in the Entner-Doudoroff pathway. A: Glucosamine-6-phosphate could be deaminated by a glucosamine-6-phosphate aminotransferase (NagS) and further degraded via glucose-6-phosphate. B: Glucosamine-6-phosphate could be deaminated via a functional homologue of the glucosamine-6-phosphate deaminating isomerase NagB and further degraded as in pathway A. C: Glucosamine-6-phosphate could be oxidised to 6-phosphoglucosaminolactone by glucose-6-phosphate dehydrogenase (Zwf), which could be finally deaminated and converted into KDPG by a 6-phospho-gluconolactonase (Pgl). PEP: Phosphoenolpyruvate; PTS: PEP:GlcNAc phosphotransferase system; KDPG: 2-keto3-desoxy-6-phosphogluconate; GAP: Glyceraldehyde-3-phosphate; NagE,F: EIIB and EIIA of PTS; NagA: Putative GlcNAc-6-phosphate deacetylase; NagS: Putative glucosaminefructose-6-phosphate aminotransferase; NagB: Glucosamine-6-phosphate deaminating isomerase; Pgi: Phosphoglucoisomerase; Zwf: Glucose-6-phosphate dehydrogenase; Pgl: 6phospho-gluconolactonase; Edd: 6-phospho-gluconate dehydratase; Eda: KDPG aldolase.

79

CHAPTER 3 AEROMONAS HYDROPHILA – PSEUDOMONAS AERUGINOSA INTERACTIONS fully induced. Therefore, GlcNAc should have been transported into the cell, which was in agreement with cell suspension experiments showing that strain PAO1∆aceA degraded GlcNAc at the same rate as the wildtype. All other enzyme activities needed to degrade the sugar moiety of GlcNAc should have been induced as well. When isocitrate lyase is absent isocitrate cannot be cleaved into glyoxylate and succinate anymore. Possibly the formation of glyoxylate was additionally important to induce degradation of GlcNAc besides the presence of this substrate. This was supported by the fact that strain PAO1∆aceA could utilize GlcNAc in the presence of glyoxylate. The absence of isocitrate lyase could also lead to an accumulation of acetate within the cells. However, strain PAO1∆aceA did not release acetate during the degradation of GlcNAc as could be shown with cell suspension experiments. If accumulation of acetate led to a malfunction of the deacetylating enzymes, GlcNac-6phosphate could not be further metabolized. Such an accumulation could have been avoided by the dissimilation of acetate, which should be possible even if isocitrate lyase was absent. However, cell suspensions of strain PAO1∆aceA degraded acetate slower compared to cell suspensions of the wildtype indicating that the inability to assimilate acetate had also a negative influence on its dissimilation. Thus, the inability of strain PAO1∆aceA to metabolize acetate at the beginning of growth with GlcNAc seemed to be responsible for the inhibition of growth with this substrate in general. Strain AH-1N releases about 2 mM acetate in the first phase of the co-culture, but GlcNAc could not be detected by HPLC, which does not exclude that traces of GlcNAc are released. It has been shown that micromolar concentrations of GlcNAc are sufficient to enhance expression of the nag operon of P. aeruginosa during in vitro growth in cystic fibrosis sputum (Palmer et al., 2005; Korgaonkar and Whiteley, 2011). Additionally, genes for the biosynthesis of phenazines are upregulated in the presence of GlcNAc or the GlcNAc-containing polymer peptidoglycan, but it is not known if GlcNAc catabolism is required for this (Korgaonkar and Whiteley, 2011). The strong pyocyanin formation by strain PAO1 in co-culture might therefore be due to micromolar concentrations of GlcNAc released by strain AH-1N or the presence of chitin, which would induce the upregulation of genes for phenazine biosynthesis, whereas the growth substrate for strain PAO1 in the first phase was acetate. If GlcNAc catabolism was important for the production of phenazines, an aceA mutant of strain PAO1 would not be able to grow and produce pyocyanin in co-culture with 80

METABOLIC REQUIREMENTS FOR THE PARASITIC GROWTH STRATEGY strain AH-1N. Overall, metabolism of GlcNAc could constitute an important metabolic requirement of strain PAO1 for entering the second phase of the co-culture and should be further investigated. As mentioned above, acetate and GlcNAc are chitin degradation products formed by strain AH-1N and possible substrates for strain PAO1. As Pseudomonads prefer organic acids such as citrate, acetate, and succinate to carbohydrates, such as glucose, gluconate, fructose, and glycerol (Wolff et al., 1991; Rojo, 2010), carbon catabolite repression (CCR) might have played a role in the first phase of the coculture. We could demonstrate, however, that CCR by the Crc system was not a metabolic requirement of strain PAO1 for entering the second phase as co-incubation of strains PAO1∆crc, PAO1∆crcZ, and PAO1∆cbrB with strain AH-1N showed no difference compared to co-incubation of both wildtypes. Investigation of catabolite repression of GlcNAc degradation by acetate in general using strain PAO1∆crc, however, indicated the possibility of a gradual mode of repression. Deletion of crc should abolish catabolite repression as Crc does not bind to target mRNAs coding for enzymes for carbohydrate degradation any more. However, the repressing effect of Crc varies as levels of crcZ, which sequesters Crc, vary according to the carbon source, thus giving different crcZ/Crc ratios depending on the carbon source (Sonnleitner et al., 2009). Thus, gradual modes of Crc-mediated CCR seem to prevail in Pseudomonads, but information available is still fragmentary (Rojo, 2010). To our knowledge, CCR regarding a compound containing both a sugar and an organic acid moiety has never been investigated in P. aeruginosa. As the degradation of GlcNAc yields acetate at an initial stage, which is a preferred substrate for P. aeruginosa, it is feasible that a moderate CCR with regard to GlcNAc might exist. CrcZ is regulated by CbrB, which is part of the two-component system CbrAB. The latter, however, is a global system necessary for the utilization of several carbon and nitrogen sources (Rojo, 2010), and crcZ mediates not all functions of the CbrAB system (Sonnleitner and Haas, 2011). Therefore, other signal pathways might be involved in CCR as well. Possibly, CCR could occur inside the cell when both organic acid and sugar moieties are present as it happens during the degradation of GlcNAc as mentioned above. Thus, the sugar moiety could not be metabolized as long as acetate is present. This would be a further explanation of the phenotype of strain PAO1∆aceA during growth with GlcNAc.

81

CHAPTER 3 AEROMONAS HYDROPHILA – PSEUDOMONAS AERUGINOSA INTERACTIONS As a further approach for identifying genes involved in metabolic pathways that were required by strain PAO1 for entering the second phase of the co-culture, transposon mutagenesis was applied. Compared to the overall number of mutants with altered formation of pyocyanin that had been obtained, a high proportion of the mutants had defects in biosynthetic pathways of amino acids. Overall, 7 out of 15 mutants obtained were auxotrophic. Only the biosynthetic pathways for methionine and lysine share the same precursor, oxaloacetate, whereas the biosynthetic pathways of the other amino acids have no common intermediates. Therefore, it might be concluded that auxotrophy in general prevented strain PAO1 from entering the second phase. Apparently, strain AH-1N did not release any amino acids in the first phase of the coculture that could have complemented the auxotrophic mutants. This is different to the situation in the CF lung, where the amino acid concentration of the sputum is high (Thomas et al., 2000) and mutations of P. aeruginosa isolates leading to auxotrophy are common (Barth and Pitt, 1995; Barth and Pitt, 1996). Whereas the roles of the enzymes encoded by PA3537, PA3107, PA0650, PA5277, and PA4447 have been confirmed, the function of the protein encoded by PA4939 is still unknown. It shows homology to the regulatory subunit of an ATPphosphoribosyltransferase that could catalyse the formation of 5’-phosphoribosylATP, which is a precursor of histidine at an initial stage of biosynthesis. However, there is another ATP-phosphoribosyltransferase (PA4449) encoded next to PA4447, encoding for a histidinol-phosphate aminotransferase (Table 3 in results section), and PA4448, encoding for histidinol dehydrogenase, which both are involved in histidine biosynthesis. Thus, the protein encoded by PA4939 might have another function. It also shows homology to a histidyl-tRNA synthase. This would explain why strain PAO1∆PA4939 could not be complemented by the addition of histidine. Nevertheless, the phenotype of strain PAO1∆PA4939 did not differ significantly from the phenotypes of the other auxotrophic mutants. Strain PAO1∆PA4939 was able to produce AHLs in co-cultures with strain AH-1N with tryptone and chitin and had no general defect in pyocyanin production. Nevertheless, this strain and the other auxotrophic mutants produced no or only small amounts (PAO1∆PA3107, PAO1∆PA0650) of pyocyanin in these co-cultures, even though tryptone was present. The mutants could use tryptone as amino acid source as they could grow with this substrate in single culture equally to the wildtype. If PqsE was overexpressed, pyocyanin production could be partially restored only in 82

METABOLIC REQUIREMENTS FOR THE PARASITIC GROWTH STRATEGY strains PAO1∆PA3107 and PAO1∆PA0650. PqsE has sequence similarities to proteins of the metallo-β-lactamase superfamily, but its function and natural substrate are still unknown (Heeb et al., 2011). This enzyme alone, however, can drive the expression of target genes through the rhl QS system such as genes for pyocyanin, rhamnolipid or elastase production as shown by the restoration of pyocyanin production in strain PAO1∆pqsA. In strain PAO1∆PA0650 the gene encoding anthranilate phosphoribosyltransferase for the conversion of anthranilate to N-(5’phosphoribosyl) anthranilate was inactivated. Anthranilate and its direct precursor chorismate are also precursors for quinolones and phenazines, respectively (Mavrodi et al., 2001; Farrow and Pesci, 2007). As PA0650 was inactivated, anthranilate and chorismate might have been channelled in the direction of these secondary metabolites, which would explain the partial restoration of pyocyanin production during overexpression of PqsE in strain PAO1∆PA0650. Our results showed that lack of pyocyanin production by the auxotrophic mutants in co-culture was not caused by a defect in the regulatory or metabolic pathways leading to pqsE expression. Possibly, it was caused by an inhibition of metabolic reactions downstream of the action of PqsE. Altogether, it remains unclear, why the overexpression of PqsE in the auxotrophic mutants did not lead to a full restoration of pyocyanin production. This study showed the importance of isocitrate lyase activity and of the ability to synthesize amino acids as metabolic requirements of strain PAO1 for entering the second phase of the co-culture and, thus, for profiting from chitin degradation by strain AH-1N.

Acknowledgements The authors like to thank Dieter Haas for the gift of pME9672, pME9673, pME9675, and pME6016 and the group of Paul Williams (Nottingham) for the gift of pUCP18::pqsE. Bernhard Schink is acknowledged for continuous support, and experimental support from Vera Bleicher is acknowledged.

83

QUORUM SENSING OF PSEUDOMONAS

AERUGINOSA IN THE CO-CULTURE

CHAPTER 4

The role of quorum sensing of Pseudomonas aeruginosa in coculture with Aeromonas hydrophila and the identification of novel genes involved in quorum sensing-regulated processes Nina Jagmann, Vera Bleicher, Bodo Philipp

Abstract Pseudomonas aeruginosa possesses three quorum sensing (QS) systems, two of which (las and rhl) are mediated by N-acyl-homoserine lactones (AHLs) that allow this bacterium to regulate virulence gene expression in response to different environmental cues. Recently, we established a co-culture model system for interspecific interactions of P. aeruginosa with Aeromonas hydrophila, in which P. aeruginosa pursues a parasitic growth strategy based on the QS-controlled production of pyocyanin (Jagmann et al., 2010). By employing this model system to study AHL-mediated QS of P. aeruginosa we could show that the AHL-receptor RhlR was crucial for induction of pyocyanin production, whereas lack of the AHL-synthase RhlI could be complemented by AHLs produced by A. hydrophila. Activation of the rhl system was independent of LasR. By transposon mutagenesis and selection of P. aeruginosa mutants in co-culture, we identified several genes encoding for unknown proteins whose disruption led to altered pyocyanin formation, among them members of the gene cluster PA1421-PA1415. Mutants with disruption of genes belonging to this cluster produced lower amounts of pyocyanin and grew faster with the polyamine spermine. Transcript analysis indicated two operons within the gene cluster. A possible involvement of this gene cluster in polyamine or arginine metabolism is discussed. In conclusion, our model system is suitable to study QS and the effects of QS disruption under conditions that P. aeruginosa might encounter in its natural environment, where virulence factors important in human infections have evolved.

85

CHAPTER 4 AEROMONAS HYDROPHILA – PSEUDOMONAS AERUGINOSA INTERACTIONS Introduction Pseudomonas aeruginosa is a metabolically versatile bacterium (Alonso et al., 1999) that exists in a wide variety of environmental habitats like soil and aquatic systems (Ringen and Drake, 1952; Pellet et al., 1983; Hardalo and Edberg, 1997). Moreover, as an opportunistic pathogen P. aeruginosa is able to infect and kill many organisms such as insects, nematodes, plants, and fungi (Rahme et al., 1995; Rahme et al., 1997; Jander et al., 2000; Morales et al., 2010), most of them sharing the same environmental habitat. It is also a major agent of human infections (Driscoll et al., 2007). One important reason for the ability of P. aeruginosa to adapt to a variety of environments is the existence of numerous regulatory signalling pathways encoded in its genome that are involved in sensing and responding to different environmental cues by changes in gene expression (Coggan and Wolfgang, 2012; Jimenez et al., 2012). Besides signalling systems based on the second messengers cAMP and c-di-GMP (Wolfgang et al., 2003a; Kulasakara et al., 2006) and the Gac/Rsm pathway (Burrowes et al., 2006; Brencic and Lory, 2009) quorum sensing (QS) systems are key regulatory systems of P. aeruginosa. Quorum sensing is defined as cell-to-cell communication regulating gene expression in a cell density-dependent manner (Fuqua et al., 1996). P. aeruginosa possesses two QS systems that are mediated by N-acyl-homoserine lactones (AHLs) as signal molecules (Schuster and Greenberg, 2006). The las system consists of the signal synthase LasI, which produces mainly N-3-oxo-dodecanoyl-homoserine lactone (3-oxo-C12-HSL), and the signal receptor LasR, which binds this signal and activates expression of target genes. The las system controls the production of multiple virulence factors including elastase, alkaline protease, and exotoxin A (Gambello and Iglewski, 1991; Gambello et al., 1993; Jones et al., 1993). Accordingly, the rhl system consists of RhlI, which produces mainly N-butanoyl-homoserine lactone (C4-HSL), and the signal receptor RhlR. The rhl system controls the expression of several virulence factors as well, including rhamnolipids, pyocyanin, siderophores, and the type III secretion system (Ochsner et al., 1994; Brint and Ohman, 1995; Diggle et al., 2002; Bleves et al., 2005). The las and rhl systems are considered to be linked hierarchically, because the las system exerts both transcriptional and translational control over the rhl system (Latifi et al., 1996). The regulons of both systems overlap (Schuster et al., 2003) and regulate directly or indirectly about 10 % of the P. aeruginosa genome (Schuster and 86

QUORUM SENSING OF PSEUDOMONAS

AERUGINOSA IN THE CO-CULTURE

Greenberg, 2006). In addition to LasR and RhlR, there is a third LuxR homologue, QscR, encoded in the genome of P. aeruginosa that does not have a cognate AHLsynthase (Chugani et al., 2001), but responds to 3-oxo-C12-HSL generated by LasI and controls a specific regulon (Lequette et al., 2006). QscR acts as a repressor of LasR- and RhlR-regulated promoters (Chugani et al., 2001; Ledgham et al., 2003). Furthermore, P. aeruginosa possesses a third QS system that is mediated by 2-alkyl4(1H)-quinolones (AQs), mainly 2-heptyl-4-quinolone (HHQ) and 2-heptyl-3-hydroxy4-quinolone (Pseudomonas Quinolone Signal: PQS) (Dubern and Diggle, 2008). The synthesis of HHQ is directed via the gene products of pqsABCD, and HHQ is converted into PQS by the monooxygenase PqsH. The cellular response to AQ signalling is mediated via PqsE, whose function is only poorly understood. A pqsE mutant does not produce AQ-controlled secondary metabolites like pyocyanin, even though AQ synthesis remains intact (Gallagher et al., 2002). Regulation of the AQ biosynthetic genes and pqsE occurs through the transcriptional regulator PqsR, which can bind both HHQ and PQS. Most genes regulated by the AQ system are coregulated by the rhl system (Deziel et al., 2005). Additionally, the AQ system is negatively regulated by the rhl system (McGrath et al., 2004) and positively regulated by the las system (Wade et al., 2005) illustrating the close linkage between the three QS systems. Whereas much work has been conducted to elucidate the molecular structure of signalling pathways of P. aeruginosa, the environmental cues that are sensed and integrated by the respective pathways and the environmental relevance of the corresponding responses are poorly understood (Coggan and Wolfgang, 2012). Most attention is paid to the role of P. aeruginosa in human infections. It is hypothesized, however, that the virulence characteristics of this bacterium have evolved as defence mechanisms against eukaryotic predators sharing the same environmental habitat (Hilbi et al., 2007). The phenotypes of P. aeruginosa that lead to human infections are likely pre-existing in the environment (Hogan and Kolter, 2002; Coggan and Wolfgang, 2012), which is supported by the fact that clinical isolates are usually indistinguishable from environmental isolates (Römling et al., 1994; Wolfgang et al., 2003b). Thus, in order to understand the basis of human infections by P. aeruginosa, it is important to study the environmental lifestyle of this bacterium and its virulence strategies against competitor organisms.

87

CHAPTER 4 AEROMONAS HYDROPHILA – PSEUDOMONAS AERUGINOSA INTERACTIONS Recently, we reported about a QS-based parasitic growth strategy of P. aeruginosa in co-culture with Aeromonas hydrophila during the degradation of chitin as sole source of carbon, nitrogen, and energy (Jagmann et al., 2010). This co-culture was set up as a model system for studying interspecific interactions of bacteria and their strategies involved. Degradation of polymers like chitin starts as an extracellular process, and interspecific interactions between bacteria that invest energy in enzyme production (investors) and opportunistic bacteria that thrive on degradation products without enzyme production are likely to occur. In the first phase of this co-culture with A. hydrophila strain AH-1N as investor and with P. aeruginosa strain PAO1 as opportunist, strain PAO1 grows along strain AH-1N without affecting it. The second phase of the co-culture is initiated by the QS-controlled production of secondary metabolites by strain PAO1 including pyocyanin. Pyocyanin inhibits the aconitase of strain AH-1N through the generation of reactive oxygen species, thus blocking the citric acid cycle in this bacterium. This leads to an incomplete oxidation of chitin by strain AH-1N resulting in a massive release of acetate, which is used for further growth by strain PAO1. Strain AH-1N is finally inactivated by pyocyanin and presumably also other secondary metabolites. As the co-culture with these two strains represents a good model for a QS based strategy of P. aeruginosa for competing with another bacterium, which it is likely to encounter in its natural environment, we wanted to employ the co-culture to study QS of strain PAO1 under these conditions. We could show previously that a lasIrhlI double mutant as well as a pqsA and a pqsR mutant of strain PAO1 could not enter the second phase of the co-culture by producing pyocyanin (Jagmann et al., 2010). In this study, we wanted to further elucidate the relative contributions of the different QS systems to the pathogenicity of P. aeruginosa in co-culture by using defined mutants with defects in QS pathways. Second, by employing transposon mutagenesis, we aimed at identifying novel genes that participated in QS controlled processes important in the co-culture. Material and Methods Bacterial strains, growth media, growth experiments and cell suspension experiments Bacterial strains and plasmids used in this study are listed in table 1. P. aeruginosa strain PAO1, A. hydrophila strain AH-1N and gene deletion mutants of strain PAO1 88

QUORUM SENSING OF PSEUDOMONAS

AERUGINOSA IN THE CO-CULTURE

were maintained on solid (1.5 % (w/v) agar) Luria-Bertani (LB) plates. Plasmidharbouring and insertional mutant strains of P. aeruginosa were maintained on LB plates containing 200 µg ml-1 carbenicillin, 80 µg ml-1 tetracycline, or 80 µg ml-1 gentamicin, respectively. Transposon mutants of strain PAO1 were maintained on LB plates containing 80 µg ml-1 tetracycline. Plasmid-harbouring E. coli strains DH5α, S17-1 and ST18 were maintained on LB plates containing 10 µg ml-1 tetracycline, or 100 µg ml-1 ampicillin and 50 µg ml-1 5-aminolevulinic acid in case of strain ST18. Strains of P. aeruginosa and A. hydrophila were cultivated in medium B (Jagmann et al., 2010). All cultures were incubated at 200 r.p.m. in a rotary shaker (innova 4000 incubator shaker; New Brunswick or KS4000i control; IKA). Growth experiments were performed as described previously (Jagmann et al., 2010) in 4 ml medium B in 15 ml test tubes or in 50 ml medium B in 250 ml Erlenmeyer flasks without baffles at 30° C. Tryptone (0.1 %), isoleucine (5 mM), valine (5 mM), leucine (5 mM), succinate (12 mM), agmatine (5 mM), putrescine (5 mM), and spermine (5 mM) were used as carbon and energy sources, and main cultures were inoculated at OD600=0.01. If chitin (0.5 % (w/v)) served as carbon, energy, and nitrogen source for growth experiments, ammonium was omitted from the medium, and main cultures were inoculated at OD600=0.001. Suspended chitin was prepared as described previously (Jagmann et al., 2010). Bacterial growth in single and co-cultures was measured as colony forming units in case of chitin as substrate and as OD600 in case of soluble substrates as described previously (Jagmann et al., 2010). For monitoring the expression of β-galactosidase cultures were incubated in 4 ml LB in 15 ml test tubes for 4 h at 37° C. Carbon utilization of strains PAO1, PAO1∆PA1417::Tn and PAO1∆PA1420::Tn was assayed using the Biolog Phenotype Microarray plates PM1 and PM2 (Biolog; Bochner et al., 2001). Precultures of these strains were incubated in medium B containing 0.5 % tryptone. Cells were harvested by centrifugation at 9,300 x g for 5 min and washed twice with IF-0 fluid (Biolog) and finally resuspended in the same fluid to an OD600 of 0.06. 5 ml of these cell suspensions were added to 25 ml IF-0 fluid containing indicator dye. 100 µl of this cell suspension were transferred to each well, and the plates were incubated without shaking for 48 hours at 37° C. Absorbance at 560 nm was measured using a microplate reader (Genios, Tecan). Additionally, the plates were checked by visual inspection.

89

CHAPTER 4 AEROMONAS HYDROPHILA – PSEUDOMONAS AERUGINOSA INTERACTIONS Table 1. Strains and plasmids used in this study Strains and plasmids Pseudomonas aeruginosa PAO1 PAO1∆lasI PAO1lasR::Gm

PAO1rhlI::Tc PAO1∆rhlR PAO1∆PA1415

PAO1∆PA1416 PAO1∆PA1417 PAO1∆PA1419 PAO1∆PA1420 PAO1∆PA1422 PAO1∆PA1417::Tn PAO1∆PA1420::Tn PAO1∆pqsR PAO1∆pqsE Aeromonas hydrophila AH-1N AH-1N∆ahyI Escherichia coli DH5α

S17-1 ST18

HB101

JM109

Plasmids pEX18Ap pEX18Ap[∆lasI]

pEX18Ap[∆PA1416]

90

Relevant characteristics

Source or Reference

PAO1 Nottingham wildtype PAO1 with deletion of lasI PAO1 with Gm cartridge inserted into unique SalI site of lasR PAO1 with Tc cartridge inserted into unique EcoRI site of rhlI PAO1 with deletion of rhlR PAO1 with res-cat-res cassette inserted into unique PstI site of PA1415 PAO1 with deletion of PA1416 PAO1 with res-sites inserted into unique PstI site of PA1417 PAO1 with deletion of PA1416 PAO1 with deletion of PA1420 PAO1 with res-sites inserted into unique PstI site of PA1415 R PAO1 with Tc mariner transposon inserted in PA1417 PAO1 with TcR mariner transposon inserted in PA1420 PAO1 with deletion of pqsR PAO1 with deletion of pqsE

Holloway collection This study This study

AH-1N wildtype AH-1N with deletion of ahyI

Swift et al., 1999 Lynch et al., 2002

recA1 endA1 hsdR17 thi-1 supE44 gyrA96 relA1 deoR ∆(lacZYA-argF) U196 (Φ80lacZ∆M15) thi pro hsdR hsdM+ recA RP4-2Tc::Mu-Km::Tn7 + R R pro thi hsdR Tp Sm ; chromosome::RP4-2 Tc::MuKan::Tn7/λpir ∆hemA – – thi-1 hsd S20 (rB , mB ) supE44 recA13 ara-14 leuB6 proA2 lacY1rpsL20 (strr) xyl-5 mtl-1 galK2 recA1 supE44 endA1 hsdR17 gyrA96 relA1 thi (lac-proAB) F′ [traD36 proAB+ lacIq lacZ M15]

Sambrook and Russell, 2001

r

Gene replacement vector, Ap , sacB pEX18Ap with lasI deletion cassette as XbaI-HindIII fragment pEX18Ap with PA1416 deletion cassette as XbaI-HindIII fragment

This study This study This study

This study This study This study This study This study This study This study University of Nottingham University of Nottingham

Simon et al., 1983 Thoma and Schobert, 2009

Promega

Yanisch-Perron et al., 1985

Hoang et al., 1998 This study

This study

QUORUM SENSING OF PSEUDOMONAS

AERUGINOSA IN THE CO-CULTURE

Table 1 - continued Strains and plasmids pEX18Ap[PA1415::Cm]

pEX18Ap[∆PA1419]

pEX18Ap[∆PA1420]

pEX18Ap[PA1417::Cm]

pEX18Ap[PA1422::Cm]

pKO2b pME6016 pME6016[PA1417]

pME6016[PA1422]

pALMAR3 pSB401 pSB536 pSB1075 pRK2013 pUC18 pUCP18::pqsE

pRIC380∆lasR pRIC380∆rhlI pDM4∆rhlR

Relevant characteristics pEX18Ap carrying PA1415 with res-cat-res cassette from pKO2b inserted into unique PstI site of PA1415 pEX18Ap with PA1419 deletion cassette as XbaI-HindIII fragment pEX18Ap with PA1420 deletion cassette as XbaI-HindIII fragment pEX18Ap carrying PA1417 with res-cat-res cassette from pKO2b inserted into unique PstI site of PA1417 pEX18Ap carrying PA1422 with res-cat-res cassette from pKO2b inserted into unique PstI site of PA1422 pUC18Sfi containing a res-catres casette, Apr, Cmr Cloning vector for transcriptional lacZ fusions; TcR pME6016 with a transcriptional lacZ fusion to the PA1417 promoter pME6016 with a transcriptional lacZ fusion to the PA1422 promoter R Insertion vector for Tc Mariner transposon luxR+ PluxI’-luxCDABE Tcr p15A ori ahyR+ PahyI’-luxCDABE Ampr in pAHP13 lasR+ PlasI′-luxCDABE Ampr ColE1 ori Helper plasmid for triparental + r conjugation; IncP Tra Km R Cloning vector; Ap Escherichia–Pseudomonas shuttle vector for pqsE complementation; AmpR pRIC380 carrying lasR::Gm pRIC380 carrying rhlI::Tc r Gene replacement vector, Cm , sacBR with rhlR deletion cassette

Source or Reference This study

This study

This study

This study

This study

Klebensberger et al., 2009 Sonnleitner et al., 2009 This study

This study

Klebensberger et al., 2007; Malone et al., 2010 Winson et al., 1998 Swift et al., 1997 Winson et al., 1998 Figurski and Helinski, 1979 Yanisch-Perron et al., 1985 Rampioni et al., 2010

Beatson et al., 2002 Beatson et al., 2002 University of Nottingham

Construction of plasmids and gene replacement mutants Plasmids and primers are listed in table 1 and 2, respectively. DNA manipulations and plasmid preparations were performed according to standard methods. Genomic DNA of strain PAO1 was purified with the Puregene Tissue Core Kit B (Qiagen).

91

CHAPTER 4 AEROMONAS HYDROPHILA – PSEUDOMONAS AERUGINOSA INTERACTIONS To construct lacZ transcriptional promoter fusions for PA1422 (gbuR) and PA1417, a 145 bp fragment containing the promoter region of PA1422 and a 324 bp fragment containing the putative promoter region of PA1417 were amplified using primer pairs A/B and C/D, respectively, and genomic DNA of strain PAO1 as template. The PCR fragments were digested with EcoRI and PstI and ligated into the corresponding sites of pME6016, resulting in pME6016[PA1422] and pME6016[PA1417], which were introduced into strain PAO1 by transformation (Chuanchuen et al., 2002). To construct insertional mutants of lasR and rhlI and a deletion mutant of rhlR, plasmids pRIC380∆lasR, pRIC380∆rhlI, and pDM4∆rhlR, respectively, were used and mobilized into strain PAO1 by biparental mating with E. coli strain S17-1 as donor as described previously (Jagmann et al., 2010). Mutants were selected on Pseudomonas isolation agar (PIA) plates containing 120 µg ml-1 gentamicin, 160 µg ml-1 tetracycline, or 350 µg ml-1 chloramphenicol, respectively, and excision of the vectors by a second crossover was obtained by transfer onto LB plates containing 7 % sucrose. The gene disruptions were confirmed by PCR using primer pairs E/F,G/H, or I/J, respectively, and genomic DNA of the wildtype served as control. To construct deletion mutants of lasI, PA1416, PA1419, and PA1420, two PCR products spanning parts of the up- and downstream regions of the respective genes were obtained from genomic DNA of strain PAO1 with primer pairs K/L and M/N (lasI), O/P and Q/R (PA1416), S/T and U/V (PA1419), and W/X and Y/Z (PA1420). The 1073 bp (lasI), 776 bp (PA1416), 861 bp (PA1419), and 639 bp (PA1420) upstream and 975 bp (lasI), 819 (PA1416), 721 bp (PA1419), and 716 bp (PA1420) downstream fragments were used as templates for a second overlapping PCR (SOEPCR; Ho et al., 1989) with primer pairs K/N (lasI), O/R (PA1416), S/V (PA1419), and W/Z (PA1420), respectively. The resulting fragments were digested with XbaI and HindIII and ligated into the corresponding sites of the suicide vector pEX18Ap. The resulting plasmids pEX18Ap[∆lasI], pEX18Ap[∆PA1416], pEX18Ap[∆PA1419], and pEX18Ap[∆PA1420] were mobilized into strain PAO1 by biparental mating with E. coli strain ST18 as donor. Mutants were selected on LB plates containing 350 µg ml-1 carbenicillin and transferred onto LB plates containing 7 % sucrose for selecting for excision of the vector by a second crossover. The gene deletions (684 bp of lasI, 1227 bp of PA1416, 1431 bp of PA1419, and 419 bp of PA1420) were confirmed by PCR using the same primer pairs as for the SOE-PCR and genomic DNA of the 92

QUORUM SENSING OF PSEUDOMONAS

AERUGINOSA IN THE CO-CULTURE

wildtype as control. To construct insertional mutants of PA1415, PA1417, and PA1422, a 1011 bp fragment containing the gene PA1415, a 1649 bp fragment containing the gene PA1417, and a 1138 bp fragment containing the gene PA1422 were amplified using primer pairs AA/AB, AC/AD, and AE/AF, respectively, and genomic DNA of strain PAO1 as template. The fragments were digested with XbaI and HindIII and ligated into the corresponding sites of the suicide vector pEX18Ap. The resulting plasmids were linearized with PstI cutting within the ORFs of the respective genes and ligated with a res-cat-res cassette carrying a chloramphenicol resistance obtained from plasmid pKO2b through digestion with PstI. The resulting plasmids

pEX18Ap[∆PA1415::Cm],

pEX18Ap[∆PA1417::Cm],

and

pEX18Ap[∆PA1422::Cm] were mobilized into strain PAO1 by triparental mating with E. coli strain DH5α as donor and HB101(pRK2013) as helper strain. Triparental mating was done as described previously for biparental mating (Jagmann et al., 2010) with the helper strain treated like the donor strain. Mutants were selected on PIA plates containing 350 µg ml-1 chloramphenicol and transferred onto LB plates containing 350 µg ml-1 chloramphenicol and 7 % sucrose for excision of the vector by a second crossover. The resulting mutants were transformed with pUCP24[parA] to excise the res-cat-res cassette as described previously (Smits et al., 2002) and selected on LB plates with 120 µg ml-1 gentamicin. Mutants were checked for removal of the res-cat-res cassette by PCR and transferred on LB plates without antibiotics 3 times for selecting for loss of pUCP24[parA]. Transposon mutagenesis of strain PAO1 and identification of transposon insertion sites Transposon mutagenesis of strain PAO1 with the plasmid pALMAR3 (Malone et al., 2010) was performed as described previously (Klebensberger et al., 2007). Transposon mutants were screened for an altered phenotype during growth with chitin in co-culture with strain AH-1N as described previously (Chapter 3). Transposon insertion sites in the genomes of selected mutants were identified by a PCR-based method using Y-linker (Kwon and Ricke, 2000) or by cloning of a genome library of the respective mutants in E. coli strain DH5α as described previously (Chapter 3).

93

CHAPTER 4 AEROMONAS HYDROPHILA – PSEUDOMONAS AERUGINOSA INTERACTIONS Table 2. Oligonucleotides used in this study

A B C D E F G H I J K L M N O P Q R S T U V W X Y Z AA AB AC AD AE AF AG AH AI AJ AK AL AM AN AO AP AQ AR AS

94

Oligonucleotides Primer PA1422P fw PA1422P rev PA1417P fw PA1417P rev lasR fw lasR rev rhlI fw rhlI rev rhlR fw rhlR rev lasI Up fw lasI Up rev lasI Dn fw lasI Dn rev PA1416 Up fw PA1416 Up rev PA1416 Dn fw PA1416 Dn rev PA1419 Up fw PA1419 Up rev PA1419 Dn fw PA1419 Dn rev PA1420 Up fw PA1420 Up rev PA1420 Dn fw PA1420 Dn rev PA1415 fw PA1415 rev PA1417 fw PA1417 rev PA1422 fw PA1422 rev PA1415/16 fw PA1415/16 rev PA1416/17 fw PA1416/17 rev PA1417/18 fw PA1417/18 rev PA1418/19 fw PA1418/19 rev PA1419/20 fw PA1419/20 rev PA1420/21 fw PA1420/21 rev Linker Primer

Sequence TTTTTTTGAATTCGGGTGGCCTCACGGTCGTTG TTTTTTTCTGCAGAGGCTCGGCGGCGAAGTCTA TTTTTTTGAATTCCGCTGCTGGGCCTGGTAGTGC TTTTTTTCTGCAGTTGTGCCTGGTTCAGGCGGC GCCTTGGTTGACGGTTTTCT GTCTGGTAGATGGACGGTTC CAGGAGTATCAGGGTAGGGAT TGCACAGGTAGGCGAAGACG GTTGTCATAGGGAGGGGGATG TGCACAGGTAGGCGAAGACG TTTTCTAGAGTGCCGGATATCGGGTGCCG GGCGCGAGCCGACAGGTCCCCGGGTGAACCCGGACCCTTGC CGGGGACCTGTCGGCTCGCGCCGGCGCGTTCTCTGTCGGAG ATTAAGCTTTCGGTATCAGCGCGTTCGCC AAATCTAGACGTGGTGTTCGACGGCGGCT GGCGGGCTCCGGGTCAGGGATG CATCCCTGACCCGGAGCCCGCCTGCGCTGGCGTGATCTCCG ATTAAGCTTGCGCGAGGCTGGAGGCATAG AAATCTAGAGTGCAGGCCGAGGAGTGCTG CGTTGCGTTCGTGGTCGGGA TCCCGACCACGAACGCAACGGTGGGGTACACACACGGCGG ATTAAGCTTGGCAGCTTGGCTACCAGGGC AAATCTAGACGACCGCATCCTCGGTCAC GGTCGCGCTACGGCTCAG CTGAGCCGTAGCGCGACCGCTCTCCCGGGAGAACG ATTAAGCTTGGAAGGCGCCGAAGGAGAT AAATCTAGACATACCCTGAACGCCTATCC TTTAAGCTTCCCGATTCTCCTTCCCTTG AAATCTAGAAAAGGAACGGCCATGACCAC TTTAAGCTTAGAGGGAGCGGTAGAGTTCG AAATCTAGAGTGGTTGTTTTAGGGGTCGG TTTAAGCTTCAAGGTGGTAGAAGCGGTGC ACCTGCACGTCATGCTCGCC CGTTCGGTGAGCCAGGGCAG GAGCGGCGCGAGATCACTCC CGGCGAGGTTCTGCGGATGG GATCAGCGCCCTGACCGTGG TGATGACGTCGAGCGGCAGC CCGGGGCAATTCGTCGGTCC CATGGACGTAGCCCAGGCGC TGCAAGGCGACCTGGCGATC TGTTGGTGCCGTTGAGCGGG CATCGACGGCATCGACCCGG CCTCGCTGAAGGCGGCGAAA CTGCTCGCACTCACGCTCCT

Linker Linker2_XmaI Linker2_XhoI Linker1

CCGGTGTCCCCGTACATCGTTAGGACTACTCTTACCATCCACAT TCGATGTCCCCGTACATCGTTAGGACTACTCTTACCATCCACAT TTTCTGCTCGCACTCACGCTCCTAACGATGTACGGGGACA

QUORUM SENSING OF PSEUDOMONAS

AERUGINOSA IN THE CO-CULTURE

RNA transcript analysis by RT-PCR For preparation of RNA for reverse transcription (RT)-PCR, cultures of strain PAO1 were incubated in 3 ml LB medium at 200 r.p.m. for 15 h at 37° C. RNA was prepared with the RNeasy Protect Bacteria Mini Kit (Qiagen) with subsequent DNase digestion (DNase I; Fermentas). Synthesis of cDNA was performed with the iScript Select cDNA Synthesis Kit (Bio-Rad) using 125 ng RNA as template. PCR was performed with 1 µl cDNA reaction mix, 20 ng chromosomal DNA, or 25 ng RNA, respectively, with primer pairs AG/AH to AQ/AR amplifying fragments that overlap putative co-transcribed coding regions. Quantification of pyocyanin and determination of elastolytic activity Pyocyanin was determined by reversed-phase HPLC as described previously (Jagmann et al., 2010) with 10 mM Na-K-phosphate buffer (pH 7.1; 0.105 mM K2HPO4, 0.045 mM NaH2PO4) as eluent A and acetonitrile as eluent B. Elastolytic activity in culture supernatants of strain PAO1 was determined as described previously (Jagmann et al., 2010). Cultures were incubated in 4 ml medium B containing 0.1 % tryptone with or without the addition of 100 µM pyocyanin for 16 hours. As a control, only methanol was added. β-Galactosidase Assays To assess expression of the putative PA1417 and the PA1422 promoter 100 µl culture samples were used for β-galactosidase assays, processed as described previously (Mathee et al., 1997) and assayed for activity as described previously (Miller, 1972). Bioassay for AHL production Co-cultures of strains AH-1N and AH-1N∆ahyI with strain PAO1 or mutant strains of PAO1 were tested for AHL production in bioassays with the bioluminescent E. coli sensor strains JM109(pSB401), JM109(pSB536), and JM109(pSB1075) as described previously (Styp von Rekowski et al., 2008). At each sampling time aliquots of the co-cultures were centrifuged at maximum speed for 15 min, and 50 µl of the supernatant were used in the assay. 3-oxo-C12-HSL in green supernatants of co-cultures of strains AH-1N and PAO1 was analysed after thin-layer chromatography (TLC) with plate bioassays using strain 95

CHAPTER 4 AEROMONAS HYDROPHILA – PSEUDOMONAS AERUGINOSA INTERACTIONS JM109(pSB1075) as indicator strain. To obtain culture supernatants, co-cultures were incubated for 5 days as described above before two centrifugation steps at maximum speed for 15 min at 15° C . AHLs in the culture supernatant were separated by TLC on a reversed phase RP-2/UV254 plate (Macherey-Nagel) by using methanolwater

(60:40

(v/v))

as

described

previously

(Yates

et

al.,

2002).

After

chromatography, the plate was dried and overlaid with 80 ml LB medium containing 0.4 % (w/v) agar seeded with 4 ml of an overnight culture of strain JM109(pSB1075) grown in LB at 37° C. After incubation for 4 h at 30° C, AHL spots were visualized with the ChemiDoc XRS system (BIO-RAD) with an exposure time of 20 min. Sensitivity assays For sensitivity assays with pyocyanin, cell suspension experiments with strains PAO1∆PA1417 and PAO1∆PA1420, and PAO1 were conducted. Pre-cultures of these strains were incubated as described above and used to inoculate main cultures in 100 ml medium B containing 0.3 % tryptone at OD600=0.01. Main cultures were harvested after 15 hours of incubation by centrifugation at 11000 x g for 5 min at 15° C and washed twice with medium B with ammonium and w ithout complementing solutions (0.01 mM CaCl2, 0.15 mM Na-K-phosphate buffer (pH 7; 0.105 mM K2HPO4, 0.045 mM NaH2PO4), trace element solution SL10 (Widdel et al., 1983; Jagmann et al., 2010)) before resuspension in the same medium containing 10 mM acetate to an OD600 of 1 with the addition of 80 µM pyocyanin (Cayman chemicals; 20 mM stock solution in methanol). As a control, only methanol was added. Cell suspensions were incubated in a volume of 20 ml in 100 ml Erlenmeyer flasks without baffles at 30° C. Directly after starting and at regular intervals thereafter, samples were withdrawn from the suspension for CFU measurements and HPLC analysis. For sensitivity assays with H2O2, a disk assay was applied (Hassett et al., 1995). Precultures of strains PAO1, PAO1∆PA1417::Tn, and PAO1∆PA1420::Tn were incubated as described above and used to inoculate main cultures in medium B containing 0.3 % tryptone at OD=0.01. Main cultures were incubated for 15 hours at 30° C, and 100 µl of each culture was added to 3 ml of medium B with ammonium and complementing solutions containing 10 mM succinate and 0.8 % agar. This mixture was poured onto plates containing the same medium but 1.5 % agar. Plates were allowed to dry before sterile filter paper disks (1 cm diameter) impregnated with 96

QUORUM SENSING OF PSEUDOMONAS

AERUGINOSA IN THE CO-CULTURE

10 µl of 30 % or 0.3 % H2O2 were placed on top. Plates were incubated for 16 hours at 30° C and 37° C, respectively, before clearing zones surro unding the disks were measured.

Results Production of AHLs by strain PAO1 in co-culture We initiated our study by characterizing the AHL production pattern during the course of the co-culture of strains PAO1 and AH-1N with chitin (Fig. 1A,B). Formation of different AHL molecules could be detected using bioassays with E. coli indicator strains. These strains respond to exogenous AHLs with activation of the luxCDABE operon, which is located on a plasmid together with a gene encoding an AHL receptor protein, and the production of luminescence. Strain JM109(pSB401) expresses the LuxR receptor from V. fischeri and responds optimally to 3-oxo-C6HSL. Additionally, this strain responds to C6-HSL, which is produced by the AHL synthase RhlI of strain PAO1 (Winson et al., 1998). In co-cultures, small amounts of C6-HSL could be detected at the first two days of incubation (Fig. 1A). Strain JM109(pSB536) expresses the AhyR receptor from A. hydrophila and responds to C4-HSL (Swift et al., 1997), which is produced by the AHL synthases AhyI of strain AH-1N and RhlI of strain PAO1. In co-cultures, C4-HSL could be detected throughout the time of incubation, and the increasing signal intensity produced by the indicator strain

indicated

increasing

concentrations

over

time

(Fig.

1A).

Strain

JM109(pSB1075) expresses the LasR receptor from P. aeruginosa and responds to 3-oxo-C12-HSL and to 3-oxo-C10-HSL, a minor AHL, both produced by the AHL synthase LasI of P. aeruginosa (Winson et al., 1998; Charlton et al., 2000). In cocultures, 3-oxo-C12-HSL could be detected only at the first two days of incubation (Fig. 1A). At day 3, the co-cultures had turned green indicating the formation of secondary metabolites including pyocyanin. When green co-culture supernatant was added to strain JM109(pSB1075) in the bioassay, luminescence values even dropped below the values of controls, in which only medium B had been added to the cells. To further investigate this, exogenous 3-oxo-C12-HSL was added to green co-culture supernatant, which was submitted to the indicator strain in the bioassay. Again, 3oxo-C12-HSL was not detected by strain JM109(pSB1075), and there was a drastic 97

CHAPTER 4 AEROMONAS HYDROPHILA – PSEUDOMONAS AERUGINOSA INTERACTIONS reduction of the luminescence produced by the indicator strain. Thus, the presence of green co-culture supernatant prevented the production of luminescence by this strain. To test whether 3-oxo-C12-HSL was nevertheless present in green co-culture supernatant the supernatant was separated with thin layer chromatography (TLC) and 3-oxo-C12-HSL was detected by overlaying the TLC plate with the indicator

[ %] of control

140

Fig. 1. Growth of and detection

A

120

of

100

hydrophila strain AH-1N and P.

80

aeruginosa strain PAO1 in co-

60

cultures with chitin. A. Production

40

of C6-HSL (black bar), C4-HSL

20

(light grey bar) and 3-oxo-C12-

0 1

2

3

produced

by

A.

HSL (dark grey bar) in co-

4

cultures. Values are expressed

time [d] 10 9

AHL

as

B

percentages

of

control

measurements (set to 100 %) 10 8 cfu ml-1

with 0.1 µM of C6-HSL, C4-HSL, and 3-oxo-C12-HSL, respectively.

107

B. CFUs of strains AH-1N (
) and

106

PAO1

(
).

Error

bars

indicate standard deviation (n=5). 105 0

1

2

3

4

5

time [d]

strain JM109(pSB1075). Spots corresponding to 3-oxo-C12-HSL could be detected in the supernatant sample indicating that this AHL was present in green co-culture supernatant (Fig. 2). Unlike 3-oxo-C12-HSL, C4-HSL could be detected by strain JM109(pSB536) in green co-culture supernatant. To exclude that strain JM109(pSB1075) showed a higher susceptibility to secondary metabolites in the supernatant compared to strain JM109(pSB536), the plasmids pSB536 and pSB1075 were transformed in cells of E. coli strain DH5α originating from one pre-culture. However, the same effect of green co-culture supernatant on the recognition of 3-oxo-C12-HSL and C4-HSL could be 98

QUORUM SENSING OF PSEUDOMONAS

AERUGINOSA IN THE CO-CULTURE

observed. Strain DH5α(pSB1075) did not respond to the presence of 3-oxo-C12-HSL in green culture supernatant, whereas strain DH5α(pSB536) responded to C4-HSL. One major secondary metabolite present in green co-culture supernatant is pyocyanin (Jagmann et al., 2010). Therefore, we investigated, whether the inhibiting effect of green co-culture supernatant on the detection of 3-oxo-C12-HSL by the indicator strain was caused by the presence of pyocyanin. For this, medium B

3-oxo-C12HSL

A

B

C

Fig. 2. TLC chromatogram of 3-oxo-C12-HSL present in green co-culture supernatant and detected by using an E. coli strain JM109(pSB1075) bioindicator overlay. A. 0.05 nmol 3-oxoC12-HSL B. 20 µl of green co-culture supernatant C. 20 µl of green co-culture supernatant containing 0.05 nmol 3-oxo-C12-HSL. The spot migrating faster than 3-oxo-C12-HSL corresponds either to the open-ring form of 3-oxo-C12-HSL alone, which has recyclized during chromatography (A) or to this open-ring form together with 3-oxo-C10-HSL (B,C) (Yates et al., 2002 ).

containing 100 µM pyocyanin and 0.1 µM 3-oxo-C12-HSL or C4-HSL was added to strain DH5α(pSB1075) or strain DH5α(pSB536), respectively, and luminescence values and CFU numbers were measured after 4 h of incubation. For comparison and as solvent controls, medium B containing only acetonitrile (solvent of AHLs) and medium B containing methanol (solvent of pyocyanin) and 3-oxo-C12-HSL or C4-HSL were added to the indicator strains. Specific luminescence and CFU numbers were expressed as percentages of control measurements (set to 100 %), in which 99

CHAPTER 4 AEROMONAS HYDROPHILA – PSEUDOMONAS AERUGINOSA INTERACTIONS medium B containing 0.1 µM 3-oxo-C12-HSL or C4-HSL, respectively, was added to strains DH5α(pSB1075) and DH5α(pSB536) (Fig. 3). When medium B containing acetonitrile or methanol and AHLs was added to both indicator strains, CFU numbers did not decrease. When AHLs were present in medium B, specific luminescence reached the same values as in control measurements. When pyocyanin was present, CFU numbers of both indicator strains dropped about 30 % compared to the control. However, specific luminescence of strain DH5α(pSB536) did not decrease, while the specific luminescence of strain DH5α(pSB1075) decreased about 80 % and even dropped below the specific luminescence produced by this strain in the solvent

[ %] of control

CF U

120

RL U /C

140

FU ml -1 ml -1

control with medium B containing acetonitrile.

100 80 60 40 20 0 pSB 1075

pSB 536

MediumB +AcNi

pSB 1075

pSB 536

MediumB +AHL +MetOH

pSB 1075

pSB 536

MediumB +AHL +Pyo

Fig. 3. Effect of pyocyanin on the response of E. coli indicator strain DH5α(pSB1075) to 3oxo-C12-HSL and of strain DH5α(pSB536) to C4-HSL. CFUs ml-1 (dark grey bars) and specific bioluminescence (luminescence values divided by CFUs ml-1; light grey bars) after incubation of the indicator strains with medium B containing acetonitrile (AcNi), with medium B containing methanol (MetOH) and the respective AHLs, and with medium B containing 100 µM pyocyanin (Pyo) and the respective AHLs. Values are expressed as percentage of controls (set to 100 %) with medium B containing the respective AHLs only and represent means of two independent cultures.

These results showed that the presence of pyocyanin caused an inhibition of the response of strain DH5α(pSB1075) to 3-oxo-C12-HSL. This effect was not caused by cell damage, as the viability of both indicator strains was equally affected by the 100

QUORUM SENSING OF PSEUDOMONAS

AERUGINOSA IN THE CO-CULTURE

presence of pyocyanin, whereas the response to cognate AHLs was only affected in strain DH5α(pSB1075). This effect could be explained by an inhibition of the LasR protein by pyocyanin. However, activity of elastase, which is under control of LasR in P. aeruginosa (Toder et al., 1991), did not decrease in cultures of strain PAO1 grown in medium B with 0.1 % tryptone in the presence of pyocyanin compared to cells grown in the presence of methanol (data not shown). This indicated that at least in strain PAO1 LasR was not inhibited by pyocyanin. Contribution of the rhl system to secondary metabolite production by strain PAO1 in co-culture In order to define the respective contributions of the rhl and the las QS systems to the production of secondary metabolites by strain PAO1 in co-culture with strain AH-1N mutants of strain PAO1 were constructed that lacked either the AHL synthase or the AHL receptor/transcriptional regulator of these QS systems. These mutants were incubated with strain AH-1N in co-culture with chitin. When strain PAO1∆rhlR was co-incubated with strain AH-1N, the culture did not turn green and strain AH-1N was not inactivated (Fig. 4A). This indicated that RhlR was crucial for strain PAO1 in order to enter the second phase of the co-culture by producing pyocyanin and other secondary metabolites. When strain PAO1∆rhlI, which did not produce C4-HSL any more, was co-incubated with strain AH-1N, however, no difference in green colour formation and inactivation of strain AH-1N could be observed compared to co-cultures with the wildtype. Luminescence production by indicator strains indicated the presence of both C6-HSL and 3-oxo-C12-HSL in equal amounts compared to co-cultures with the wildtype. Luminescence intensity indicated that amounts of C4-HSL were lower compared to these co-cultures (data not shown). As strain AH-1N also produces C4-HSL, this might have been responsible for activating the rhl system of strain PAO1. Therefore, strain PAO1∆rhlI was co-incubated with strain AH-1N∆ahyI. This co-culture did not turn green and strain AH-1N was not inactivated (Fig. 4B). No C4-HSL could be detected in the co-culture, while strain PAO1∆rhlI produced both C6-HSL and 3-oxoC12-HSL. The latter could be detected in bioassays with strain JM109(pSB1075) throughout the time of incubation, because no pyocyanin was present (see above) (Fig. 4C).

101

CHAPTER 4 AEROMONAS HYDROPHILA – PSEUDOMONAS AERUGINOSA INTERACTIONS Fig. 4. Growth of A. hydrophila 1 09

strain AH-1N and P. aeruginosa

A

strains PAO1 and PAO1∆rhlR in

1 08 cfu ml -1

co-cultures with chitin and growth of and AHL production by A.

10 7

10 6

strain

and

aeruginosa

P.

AH-1N∆ahyI strain

PAO1∆rhlI in co-cultures with

10 5 1

0

2

4

3

5

time [d ] 101 0

chitin. A. CFUs of strain AH-1N () in co-cultures with strain

B

PAO1∆rhlR()

109 cfu ml -1

hydrophila

and

CFUs

of

strain AH-1N (
) in co-cultures with strain PAO1 (
). Values are

10 8

means

10 7

of

two

independent

cultures. B. CFUs of strain AH10 6

1N∆ahyI () in co-cultures with strain PAO1∆rhlI (). Error bars

10 5 0

20

40

60

80

100

represent

time [h ] 14 0

[ %] of control

1 20

1 20

standard

deviation

(n=3). C. Production of C4-HSL

C

(not detected), C6-HSL (black

10 0

bars) and 3-oxo-C12-HSL (grey

80

bars) in co-cultures of strains AH-

60

1N∆ahyI and PAO1∆rhlI. Values

40

are expressed as percentages of

20

control measurements (set to

0 1

2

3 tim e [d]

4

100 %) with 0.1 µM of C6-HSL, C4-HSL,

and

3-oxo-C12-HSL,

respectively. Error bars represent standard deviation (n=3).

When strain PAO1∆rhlI was co-incubated with strain AH-1N∆ahyR no difference in green colour formation and inactivation of strain AH-1N could be observed compared to co-cultures with both wildtypes, but lower amounts of C4-HSL were indicated by luminescence of the indicator strains (data not shown). When ahyR is inactivated in A. hydrophila, the presence of C4-HSL does not lead to an increased expression of ahyI by binding of the AhyR/C4-HSL complex. Thus, only basal levels of C4-HSL 102

QUORUM SENSING OF PSEUDOMONAS

AERUGINOSA IN THE CO-CULTURE

should be produced by strain AH-1N∆ahyR. Nevertheless, the concentration of C4HSL was sufficient to activate the rhl system of strain PAO1 leading to production of secondary metabolites. These results indicated that the rhl system was crucial for strain PAO1 to be able to enter the second phase of the co-culture. Interestingly, loss of rhlI could be compensated by responding to AHLs produced by strain AH-1N. Contribution of the las system to secondary metabolite production by strain PAO1 in co-culture When strains PAO1∆lasR and PAO1∆lasI were co-incubated with strain AH-1N, no differences in inactivation of strain AH-1N could be observed compared to co-cultures with both wildtypes (data not shown). However, co-cultures with the mutant strains showed a blue rather than a green coloration (Fig. 5). This indicated either the production of higher amounts of pyocyanin or of less amounts of yellow-green coloured secondary metabolites like pyoverdine (Hohnadel et al., 1986). Additionally, colour formation in co-cultures with strain PAO1∆lasR occurred about one day earlier than in co-cultures with the wildtype. In co-cultures with both strains PAO1∆lasR and PAO1∆lasI, no formation of 3-oxo-C12-HSL and only traces of C6-HSL could be observed, whereas the same amounts of C4-HSL as in wildtype co-cultures could be detected (not shown). As described above, C4-HSL produced by strain AH-1N could be used by strain PAO1∆rhlI to activate the rhl system via RhlR. As the las and the rhl system are thought to be hierarchically organised in P. aeruginosa with the las system controlling the rhl system, it could have been possible that in strain PAO1∆lasR the rhl system was activated by C4-HSL produced by strain AH-1N despite loss of the las system. Co-cultures of strains PAO1∆lasR and AH-1N∆ahyI, however, showed no difference compared to co-cultures with both wildtypes. These results indicated that the las system was dispensable for strain PAO1 to be able to enter the second phase of the co-culture. Taken together both the rhl and the AQ quorum sensing systems (see also Jagmann et al., 2010) were crucial for strain PAO1 in co-culture with strain AH-1N. However, neither system could be substituted by the other, but both systems had to be functioning for the production of pyocyanin and, thus, the ability of strain PAO1 to enter the second phase of the co-culture.

103

CHAPTER 4 AEROMONAS HYDROPHILA – PSEUDOMONAS AERUGINOSA INTERACTIONS Fig.

5.

Colour

formation

caused

by

the

production of secondary metabolites by strains of P. aeruginosa in co-culture with A. hydrophila strain AH-1N. A. Co-culture of strain AH-1N with strain PAO1; B. Co-culture of strain AH-1N with strain PAO1∆lasR; C. Co-culture of strain AH-

A

B

C

1N with strain PAO1∆lasI.

Identification of transposon mutants with defects in genes involved in quorum sensing regulated processes In addition to defining the contributions of the las and rhl quorum sensing systems of strain PAO1 to the outcome of the co-culture, we aimed at identifying novel genes of this strain that were involved in QS regulated processes in the co-culture. For this, we carried out transposon mutagenesis and selected mutants in co-culture with chitin or chitin and tryptone. Mutants were screened for altered production of pyocyanin as production of this secondary metabolite is dependent on QS. When mutants were incubated in co-cultures with chitin, we could isolate 7 mutants in total with 5 producing no (PA0997, PA1417, PA1419 hit twice, PA1420), one producing less (PA1803) and one producing higher amounts of pyocyanin (PA5185) compared to the wildtype (Table 3). The mutant producing higher amounts of pyocyanin had the transposon inserted in the gene PA5185. This gene encodes an unknown protein that shows similarity to proteins belonging to the thioesterase superfamily. It is organized in a putative operon comprising PA5185, PA5186, a probable ironcontaining alcohol dehydrogenase, PA5187, a probable acyl-CoA dehydrogenase, and PA5188, a probable 3-hydroxyacyl-CoA dehydrogenase. It is hypothesized that this operon is involved in lipid metabolism (Chruszcz et al., 2008). The mutant producing less pyocyanin in co-culture than the wildtype had the transposon inserted in the gene encoding Lon protease, which is a member of the ATP-dependent protease family. However, it was reported that disruption of lon in P. aeruginosa leads to overproduction of pyocyanin (Takaya et al., 2008) One of the mutants that did not produce pyocyanin had the transposon inserted in pqsB. The gene pqsB is part of the pqsABCDE operon that is responsible for AQ biosynthesis, and it has been shown that disruption of pqsB leads to strongly reduced pyocyanin formation (Lindsey et al., 2008). The other mutants that did not produce pyocyanin had 104

QUORUM SENSING OF PSEUDOMONAS

AERUGINOSA IN THE CO-CULTURE

transposons inserted in the genes PA1417, PA1419, and PA1420, respectively. Transposon insertion in the genomes of two mutants was mapped to PA1419 but at different sites inside the gene. These genes belong to a gene cluster that comprises seven genes (PA1421 to PA1415; Fig. 6). A function has only been assigned to the product

of

PA1421

(GbuA),

a

guanidinobutyrase

that

belongs

to

the

arginase/agmatinase family of proteins and catalyzes the conversion of 4guanidinobutyrate (4-GB) to 4-aminobutyrate and urea (Nakada and Itoh, 2002). This reaction is part of the arginine transaminase pathway for the degradation of arginine to succinate via 2-ketoarginine (Yang and Lu, 2007). Expression of gbuA (PA1421) can be induced by exogenous 4-GB, which is regulated by PA1422 (GbuR), a LysRfamily transcriptional regulator upstream of gbuA (Nakada and Itoh, 2002). No function has yet been assigned to the remaining genes of the cluster. PA1420 encodes a hypothetical protein without homologies to any proteins with known functions. PA1419 and PA1418 encode putative membrane transport proteins. PA1417 encodes a putative TPP-containing enzyme. PA1416 shows homology to FAD-containing oxidoreductases, and PA1415 is predicted to belong to the metalloβ-lactamase superfamily.

* PA1422

PA1421

(gbuR)

(gbuA) PA1420

* PA1419

PA1418

PA1417

PA1416

PA1415 1 kb

Fig. 6. Map of the gene cluster comprising the inactivated genes PA1417, PA1419, and PA1420 of transposon mutants that showed no formation of pyocyanin during their selection in co-cultures with strain AH-1N. PA1422 (gbuR) regulates the expression of PA1421(gbuA). The black arrows marked with asterisks indicate the promoters predicted in the gene cluster. The directions of the unmarked black arrows indicate the orientation of the promoter of the tetracycline resistance gene located on the transposon.

When mutants were incubated in co-cultures with chitin and tryptone, 2 mutants could be isolated that showed no production of pyocyanin. The mutants had the transposon inserted in pqsR and PA4701, respectively. The gene pqsR encodes the 105

CHAPTER 4 AEROMONAS HYDROPHILA – PSEUDOMONAS AERUGINOSA INTERACTIONS LysR-family transcriptional regulator PqsR and regulates expression of the pqsABCDE operon for AQ biosynthesis. It was shown previously that a pqsR mutant is unable to produce pyocyanin (Gallagher et al., 2002). PA4701 encodes a hypothetical protein of unknown function.

Tab. 3. Mutants obtained by transposon mutagenesis with altered formation of pyocyanin in co-cultures with strain AH-1N Strain

Interrupted gene

Encoded protein

PAO1∆PA5185::Tn

PA5185

probable thioesterase

PAO1∆lon::Tn

PA1803 (lon)

Lon protease

Degradation of regulatory proteins

-

PAO1∆PA0997::Tn

PA0997 (pqsB)

3-oxo-acyl-carrier protein

quinolone synthesis

--

PAO1∆PA1417::Tn

PA1417

probable TPP-binding enzyme

Part of the gene cluster PA1421-PA1415

--

PAO1∆PA1419::Tn

PA1419

probable permease

Part of the gene cluster PA1421-PA1415

--

PAO1∆PA1420::Tn

PA1420

hypothetical protein

Part of the gene cluster PA1421-PA1415

--

PAO1∆PA1003::Tn

PA1003 (pqsR)

transcriptional regulator

AQ quorum sensing

--

PAO1∆PA4701::Tn

PA4701

hypothetical protein

a

Description

Pyocyanin formationa

Part of the putative operon PA5188-PA5185

++

--

pyocyanin formation by mutant strains in co-cultures with strain AH-1N incubated in 96-well plates

compared pyocyanin formation by strain PAO1 in co-cultures: ++ formation of higher amounts of pyocyanin; - formation of lower amounts of pyocyanin; -- formation of no pyocyanin.

Growth of and production of signal molecules and secondary metabolites by transposon mutants in co-culture Strains PAO1∆lon::Tn, PAO1∆PA1417::Tn and PAO1∆1420::Tn that had been obtained by a first mutagenesis were chosen for investigating the effect of the gene disruptions on their growth and production of signal molecules and secondary metabolites in co-culture with strain AH-1N. When strain PAO1∆lon::Tn was coincubated with strain AH-1N, no difference in CFU numbers or inactivation of strain AH-1N could be observed compared to co-cultures with the wildtype, although strain 106

QUORUM SENSING OF PSEUDOMONAS

AERUGINOSA IN THE CO-CULTURE

PAO1∆lon::Tn produced only about 20 % of the amount of pyocyanin produced by the wildtype. Additionally, higher amounts of C6-HSL could be detected compared to wildtype co-cultures, which is in agreement with previous findings (Takaya et al., 2008) (data not shown). Strains PAO1∆PA1417::Tn and PAO1∆PA1420::Tn produced no pyocyanin in cocultures with strain AH-1N during incubation in microtiter plates or test tubes. When incubated in Erlenmeyer flasks, however, both mutants produced pyocyanin in coculture with strain AH-1N, although the onset of pyocyanin formation was delayed, and both strains produced only about 20 % of the amount of pyocyanin produced by the wildtype (Fig. 7C). Again, this amount of pyocyanin was sufficient to inactivate strain AH-1N, although inactivation was also delayed compared to the wildtype coculture (Fig. 7A,B). Both mutant strains displayed the same C4- and 3-oxo-C12-HSL formation pattern, but produced higher amounts of C6-HSL compared to the wildtype (not shown). Thus, transposon insertion into the genes PA1417 and PA1420 led to an impaired formation of pyocyanin by these strains, that varied dependent on the culture conditions. Physiological and metabolic characterisation of mutant strains with defects in the PA1421-PA1415 gene cluster Due to the high ratio of transposon insertions in genes belonging to the PA1421PA1415 gene cluster we investigated the physiological and metabolic effects of these gene disruptions. As GbuA (PA1421) takes part in arginine degradation, and a mutant lacking gbuA cannot grow with 4-GB (Nakada and Itoh, 2002), we incubated strains PAO1∆PA1417::Tn and PAO1∆PA120::Tn with 4-GB, D-arginine, and Larginine. Both strains could grow with these substrates, indicating that the genes PA1417 and PA1420 were not involved in arginine degradation. To further characterize the influence of the gene disruptions on metabolic properties of both strains a BIOLOG phenotypic microarray was applied. With this microarray utilization of 190 different carbon sources can be investigated. Differences in substrate utilization by strains PAO1, PAO1∆PA1417::Tn, and PAO1∆PA1420::Tn indicated by the microarray were checked by incubation of these strains in a larger volume in test tubes with the respective substrates. The only substrate with which a difference could be

verified

was

the

branched-chain

amino

acid

L-isoleucine.

Strain

PAO1∆PA1417::Tn showed a slightly faster growth with this substrate (not shown). 107

CHAPTER 4 AEROMONAS HYDROPHILA – PSEUDOMONAS AERUGINOSA INTERACTIONS

1 010

Fig. 7. Growth of and pyocyanin

A

production

cfu ml -1

1 09

strains

10 8

P.

aeruginosa

PAO1,

PAO1

∆PA1417::Tn 10 7

and

PAO1

∆PA1420::Tn in co-cultures with

10 6

A. hydrophila strain AH-1N with chitin. A. CFUs of strain AH-1N

10 5 20

0

40

60

80

1 00

12 0

140

160

tim e [h] 1 010

() in co-cultures with strain PAO1∆PA1417::Tn (); CFUs of

B

strain AH-1N (
) in co-cultures

1 09 cfu ml -1

by

with strain PAO1 (
). B. CFUs

10 8

of strain AH-1N () in co-

10 7

cultures

with

strain

PAO1∆PA1420::Tn (); CFUs of 10 6

strain AH-1N (
) in co-cultures 10 5 0

20

40

60

80

10 0

1 20

140

PAO1

(
).

C.

PAO1 (), PAO1∆PA1417::Tn

C

(
), and PAO1∆PA1420::Tn (
)

80 concentration [µM]

strain

Pyocyanin production by strains

tim e [h] 100

with

in co-cultures with strain AH-1N. 60

Error bars represent standard 40

deviation (n=3). CFUs of co-

20

cultures with both wildtypes are means

of

two

independent

0 0

20

40

60

80

100

1 20

14 0

cultures.

time [h ]

As described above, the protein encoded by the gene PA1417 shows similarity to TPP-containing enzymes. Such an enzyme is for example the α-ketoisovalerate dehydrogenase, a multi-enzyme complex that participates in degradation of branched-chain amino acids (McCully et al., 1986). However, incubation of the cleanknockout mutant strain PAO1∆PA1417 showed no differences in growth with Lisoleucine or with the other branched chain amino acids L-valine and L-leucine 108

QUORUM SENSING OF PSEUDOMONAS

AERUGINOSA IN THE CO-CULTURE

compared to the wildtype. The same was true for the clean knockout strains PAO1∆PA1416 and PAO1∆PA1419 when incubated with this substrates. As GbuA (PA1421) belongs to the arginase/agmatinase family of proteins (see above), growth of strains PAO1∆PA1416, PAO1∆PA1417, and PAO1∆PA1419 was tested with the polyamines agmatine, spermine, and putrescine. No differences in growth of these mutants with agmatine and putrescine could be observed compared to the wildtype. However, these mutants showed accelerated growth with spermine compared to the wildtype, which became obvious as well by an earlier formation of pyocyanin resulting in bluish coloration of the cultures (Fig. 8).

1

OD600

0.1

0.01 a b c

0.001 0

20

40

60

80

time [h]

Fig. 8. Growth of P. aeruginosa strains PAO1 (
),PAO1∆PA1416 (),PAO1∆PA1417 (), and PAO1∆PA1419 (
) in single cultures with spermine. The points in time of visible blue colouration of the cultures of strains PAO1∆PA1417 and PAO1∆PA1419 (a), strain PAO1∆PA1416 (b), and strain PAO1 (c) are indicated by arrows. Error bars indicate standard deviation (n=3).

Polyamines are involved in the protection of cells against oxidative stress (Wortham et al., 2007). If the gene cluster PA1421-PA1415 participated in polyamine metabolism, the knockout of genes in this cluster might lead to an increased susceptibility of the mutant strains to oxidative stress. As pyocyanin is a redox active pigment that can lead to the formation of reactive oxygen species (ROS), cell suspensions of strains PAO1, PAO1∆PA1417::Tn, and PAO1∆PA1420::Tn were incubated in the presence of pyocyanin, and CFUs were measured over time. Additionally, acetate was added to these cell suspensions to investigate whether the 109

CHAPTER 4 AEROMONAS HYDROPHILA – PSEUDOMONAS AERUGINOSA INTERACTIONS presence of ROS had an effect on the aconitase, which is crucial for the dissimilation of acetate. This effect has been observed in strain AH-1N (chapter 2). Within 32 hours of incubation, however, CFUs of the mutant strains did not decrease, and degradation of acetate showed no difference compared to the wildtype. In addition, we investigated the effect of hydrogen peroxide (H2O2) on these strains. Exposure to 3 % and 30 % H2O2 in a disk assay did not lead to an increased halo formation on agar plates containing mutant cells compared to the wildtype. Production of pyocyanin by mutant strains with defects in the PA1421-PA1415 gene cluster As described above, strains PAO1∆PA1417::Tn and PAO1∆PA1420::Tn produced lower amounts of pyocyanin in co-cultures with strain AH-1N. To characterise the general ability of strains defective in genes of the PA1421-PA1415 cluster to produce pyocyanin, mutant strains including strain PAO1∆PA1422 were incubated in single cultures in medium B with 20 mM succinate. The concentration of pyocyanin produced was normalized to the optical density (OD600) of the cultures. After incubation for 24 h, all mutant strains tested showed a decrease in pyocyanin production of about 40 % compared to the wildtype (Fig. 9). Consistent with this, production of the pyocyanin precursor phenazine-1-carboxylate (PCA) was also reduced. Strains PAO1∆PA1415, PAO1∆PA1416, and PAO∆PA1417 showed a decrease of 50 – 60 % in HHQ formation, whereas strains PAO1∆PA1419 and PAO1∆PA1422 showed an increased formation of HHQ compared to the wildtype. Thus, inactivation of genes belonging to the gene cluster PA1421-PA1415 resulted in the production of lower amounts of pyocyanin also in single cultures. Transcriptional analysis of the gene cluster PA1421-PA1415 With the bacterial promoter prediction program BProm (www.softberry.com) two putative promoters in the gene cluster PA1421-PA1415 could be identified, one located upstream of PA1417 and the other located upstream of gbuA (PA1421) (Fig. 6). Regulation of the gbuA promoter by GbuR (PA1422) has been shown previously (Nakada and Itoh, 2002). To analyse whether the genes PA1421-PA1415 are organised as an operon under the control of the gbuA promoter and are, thus, cotranscribed, RT-PCR was performed using RNA isolated from strain PAO1. Primer

110

QUORUM SENSING OF PSEUDOMONAS

AERUGINOSA IN THE CO-CULTURE

sets were designed to amplify the intergenic regions of the genes PA1421-PA1415. No PCR product of the intergenic region between PA1417 and PA1418 could be

140

[ %] of wildtype

120 100 80 60 40 20 0 ∆PA1415 ∆PA1416 ∆PA1417 ∆PA1419 ∆PA1420 ∆PA1422

Fig. 9. Production of pyocyanin (dark grey bars), PCA (light grey bars), and HHQ (black bars) by mutants defective in genes of the cluster PA1421-PA1415 after incubation in medium B with succinate. Concentrations of metabolites are normalized to the optical density of the cultures, and values are expressed as percentage of controls (set to 100 %) consisting of cultures of strain PAO1. Values represent means of two independent cultures.

obtained using cDNA as a template (Fig. 10). This indicated that the gene cluster PA1421-PA1415 was not organised as an operon, but that two different transcripts existed comprising PA1417, PA1416, and PA1415 and PA1421, PA1420, PA1419, and PA1418, respectively. To analyse whether the putative promoter upstream of PA1417 was under control of GbuR (PA1422) as well, a transcriptional lacZ fusion of the upstream region of PA1417 was introduced into strain PAO1∆gbuR. Activity of βgalactosidase in this strain reached the same level as in strain PAO1 indicating that the putative promoter of the genes PA1417-PA1415 was not under control of GbuR. Control of the transcriptional regulator GbuR (PA1422) by quorum sensing Inactivation of gbuR (PA1422) led to a decrease in pyocyanin formation by the mutant strain (see above). As the formation of pyocyanin in P. aeruginosa is regulated by QS, we investigated whether expression of gbuR was QS regulated as well. For this, a transcriptional lacZ fusion of the gbuR promoter region was constructed

and

introduced

into

strains

PAO1,

PAO1∆rhlR,

PAO1∆lasR, 111

CHAPTER 4 AEROMONAS HYDROPHILA – PSEUDOMONAS AERUGINOSA INTERACTIONS PAO1∆pqsR, and PAO1∆pqsE. Activity of β-galactosidase reached the same level in all strains (not shown) indicating that expression of gbuR was neither controlled by the las or rhl system nor by proteins belonging to the AQ system. Consistent with this, overexpression of PqsE in strain PAO1∆gbuR led to a strong formation of pyocyanin (not shown) indicating that the genes regulated by GbuR were not necessary for the action of PqsE.

A

a

b

c

d

e

f E

Fig. 10. The gene cluster PA1421-PA1415 consists of two operons (PA1421-PA1418 and PA1417-PA1415).

PCR

with

primer

sets

amplifying intergenic regions of PA1415/PA1416 (a), PA1416/PA1417 (b), PA1417/PA1418 (c), B

PA1418/PA1419 (d), PA1419/PA1420 (e), and PA1420/PA1421 (f) with cDNA (A) and genomic DNA (B) of P. aeruginosa as template. Arrows indicate 500 bp.

Discussion Strain PAO1 commences the second phase of the co-culture with strain AH-1N and with chitin as substrate with the QS-controlled production of pyocyanin, which causes the release of acetate by strain AH-1N and finally the inactivation of this strain. The aim of this study was to investigate QS and QS-regulated processes of strain PAO1 in this co-culture. We did this by monitoring the course of AHL production in the coculture and by investigating the relative contributions of the different quorum sensing systems of strain PAO1 to the outcome of the co-culture. Additionally, we identified novel genes that were involved in QS-regulated processes by transposon mutagenesis.

112

QUORUM SENSING OF PSEUDOMONAS

AERUGINOSA IN THE CO-CULTURE

Production of QS-controlled secondary metabolites by P. aeruginosa is tightly regulated with respect to growth phase and takes place in mid-logarithmic to early stationary phase (Pesci et al., 1997; Diggle et al., 2003; Schuster et al., 2003; Wagner et al., 2003). In contrast to Erwinia carotovora or Vibrio fischeri, addition of exogenous AHLs to cultures of P. aeruginosa does not result in an earlier expression of QS-controlled genes (Whiteley et al., 1999; Winzer et al., 2000; Diggle et al., 2002; Pearson, 2002; Schuster et al., 2003). Furthermore, monitoring expression of lecA, a QS-controlled gene for lectin production, in the presence of exogenous PQS revealed that cell density-dependency but not growth phase-dependency of lecA expression can be overcome (Diggle et al., 2003). Studies investigating QS in P. aeruginosa have been carried out mainly using rich media like LB or PTSB (peptone tryptic soy broth), and cell densities in stationary phase usually reach optical densities above 1 (Pesci et al., 1997; Diggle et al., 2003). In co-culture with strain AH-1N, however, QS-controlled pyocyanin production by strain PAO1 commences at a much lower cell number of about 107 CFU ml-1, which equals an OD600 of 0.01 (Jagmann et al., 2010), indicating that production of AHLs and AQs started at even lower cell numbers. This was consistent with the detection of C4-HSL, C6-HSL, and 3oxo-C12-HSL at day 1 of the co-culture, when pyocyanin had not been produced yet. In the first phase of the co-culture strain PAO1 grows along strain AH-1N, and this growth is dependent on isocitrate lyase activity (Chapter 3). This could be due to the presence of small amounts of acetate released by strain AH-1N or by the presence of small amounts of GlcNAc released from chitin by chitinolytic enzymes of strain AH1N. Towards the end of this first phase of the co-culture and before strain PAO1 starts to produce pyocyanin, there is a reproducible cessation of growth, when strain PAO1 has reached a cell number of about 107 CFU ml-1 (Jagmann et al., 2010; Fig. 1B). Possibly, this cessation of growth was caused by a depletion of substrates and could be viewed as stationary phase. When P. aeruginosa enters stationary phase, expression of the sigma factor RpoS is induced (Fujita et al., 1994). RpoS can be linked to QS as there is a small QS-controlled induction of rpoS, and as a large number of QS-controlled genes are dependent on RpoS (Schuster et al., 2004). These genes include one phzABCDEF operon for the synthesis of pyocyanin. Thus, there could be an induction rpoS transcription at the end of the first phase of the coculture, which together with QS would lead to the production of pyocyanin. The presence of pyocyanin then forces strain AH-1N to release acetate, and growth of 113

CHAPTER 4 AEROMONAS HYDROPHILA – PSEUDOMONAS AERUGINOSA INTERACTIONS strain PAO1 continues in the second phase of the co-culture. According to this hypothesis, day 1 of the co-culture already reflected a transition of exponential to stationary phase. Thus, statements about the course of AHL production by strain PAO1 during the exponential phase could only be made, if their production pattern was investigated earlier in growth, i.e. before day 1. Besides RpoS, there are other factors affecting the timing of pyocyanin production. As shown previously, addition of higher concentrations of phosphate to the co-culture inhibits the production of pyocyanin by strain PAO1, and co-incubation of strains PAO1 and AH-1N with tryptone only does not lead to pyocyanin formation at all, even when a stationary phase is reached (Jagmann et al., 2010). Thus, there are certain conditions, under which transition into stationary phase alone does not lead to pyocyanin production by strain PAO1. In co-culture with chitin, however, this transition might play a crucial role with regard to pyocyanin production. Expression of proteins of the las and rhl QS systems has been investigated mainly in cultures of P. aeruginosa incubated in rich media like LB or PTSB medium as described above. However, there are no consistent results concerning their expression pattern, which could have been caused by the use of different media or strains from different laboratories. Latifi and colleagues showed that during incubation of P. aeruginosa in LB medium, the lasR and rhlI promoters are expressed at a constant rate throughout growth, whereas expression of the rhlR promoter occurs during exponential but not during stationary phase (Latifi et al., 1996). In contrast, other groups reported that both lasR and rhlR promoters show a basal level of transcription until their activation in late exponential phase (Albus et al., 1997; Pesci et al., 1997; Schuster et al., 2003). In co-cultures of strains PAO1 and AH-1N 3-oxo-C12-HSL and C4-HSL could be detected at all sampling points comprising the end of the first and the second phase of the co-culture. According to the hypothesis described above, the end of the first phase could represent a transition into stationary phase, whereas the second phase of the co-culture comprises both an exponential phase, during which strain PAO1 grows with acetate released by strain AH-1N due to the effect of pyocyanin, and a stationary phase, which is reached after day 4 of incubation (Jagmann et al., 2010; Fig. 1B). Bioassays indicated an increase of C4HSL over time reflecting a rather constant expression of the rhl system during this time period. It could be shown by thin layer chromatography that 3-oxo-C12-HSL was still present at day 4 of incubation, although it could not be detected after day 2 using 114

QUORUM SENSING OF PSEUDOMONAS

AERUGINOSA IN THE CO-CULTURE

bioassays (see below). Thus, no statements about expression of the las system could be made. Pyocyanin production has been described as a rhl-dependent phenotype, because deletion of rhlR or rhlI abolished pyocyanin production (Brint and Ohman, 1995). This is in agreement with our results as strain PAO1∆rhlR did not produce pyocyanin and was, thus, unable to enter the second phase of the co-culture. However, a rhlI mutant of strain PAO1 could be complemented by C4-HSL produced by strain AH-1N in coculture. A similar complementation occurs, when rhlR and rhlI mutants of strain PAO1 are mixed; rhlR mutants still produce basal levels of C4-HSL sufficient to induce the rhl system in rhlI mutants, which in consequence produce pyocyanin (Brint and Ohman, 1995). Consistent with this, the basal level of C4-HSL produced by strain AH1N∆ahyR in co-culture with strain PAO1∆rhlI was sufficient to activate the rhl system of this strain resulting in formation of pyocyanin. QS mutants of P. aeruginosa isolated from infections have mutations predominantly in lasR (Smith et al., 2006; D’Argenio et al., 2007; Hoffman et al., 2009). During in vitro evolution under conditions that favour QS, enrichment of lasR and pqsR, but not of rhlR, rhlI, or lasI mutants can be observed (Wilder et al., 2011). Obviously, enrichment of QS mutants depends on the conditions used as enrichment of lasI mutants could be observed with an animal model or in minimal medium (Diggle et al., 2007; Rumbaugh et al., 2009). However, enrichment of an rhlI mutant has not been described until now. Enrichment of QS mutants is supposed to be caused by a combination of social cheating and other mechanisms like growth advantages on specific carbon sources or enhanced survival (Wilder et al., 2011). Therefore, it would be interesting to investigate, whether QS mutants enrich during long-term incubations of the coculture, and whether rhlI mutants of strain PAO1 emerge that profit from C4-HSL complementation by strain AH-1N. We could show previously that the AQ-mediated QS system is crucial for the production of pyocyanin by strain PAO1 as well (Jagmann et al., 2010). This is consistent with the finding that rhl-dependent phenotypes like pyocyanin production are abolished by mutating pqsE or pqsR (Diggle et al., 2003). Additionally, expression of rhl-dependent genes can be inhibited by adding methyl anthranilate to the cultures, which inhibits the synthesis of PQS. Therefore, it was concluded that rhldependent genes are not expressed, when there is a lack of PQS (Diggle et al., 2003). However, we could show previously that PQS was not important for strain 115

CHAPTER 4 AEROMONAS HYDROPHILA – PSEUDOMONAS AERUGINOSA INTERACTIONS PAO1 in co-culture, but that the presence of HHQ is sufficient to produce pyocyanin (Jagmann et al., 2010). As HHQ is the direct precursor of PQS, the addition of methyl anthranilate should also inhibit the production of HHQ. This indicates that rhldependent phenotypes should also be abolished in the absence of HHQ signalling. When incubated in medium B with succinate, single cultures of strain PAO1∆lasR showed a blue coloration and contained higher amounts of pyocyanin compared to cultures of the wildtype (data not shown). Co-cultures of strain AH-1N with strains PAO1∆lasR or PAO1∆lasI showed a blue coloration as well, which is probably also caused by production of higher amounts of pyocyanin. The QS systems of strain PAO1 are described as hierarchically organised, because the las system exerts both transcriptional and translational control over the rhl system (Pesci et al., 1997). When lasR is mutated, the rhl system should not be expressed therefore leading to an abolished production of pyocyanin (Latifi et al., 1996). However, Diggle and colleagues showed that under certain growth conditions, there is lasR-independent activation of the rhl system. They postulated that this is mediated via lasRindependent production of PQS (Diggle et al., 2003). Thus, the co-culture with strains PAO1 and AH-1N seemed to represent a condition, under which a lasR-independent activation of the rhl system occurred. As described above, we could show that PQS is not important in the co-culture. Thus, it would be interesting to investigate, whether a co-culture of strain AH-1N with a pqsH mutant of strain PAO1 carrying an additional mutation in the las system would show a similar blue coloration as co-cultures with strain PAO1∆lasR. This would indicate that the las-independent activation of the rhl system could be mediated via HHQ as well. The strong induction of pyocyanin production in the absence of las-signalling could be due to several reasons. First, in the absence of LasR another regulator could take over leading to lasR-independent activation of the rhl system and pyocyanin production as described above. Second, LasR could have a negative regulatory function with regard to pyocyanin production, which would lead to the production of higher amounts of pyocyanin, when lasR is inactivated. In this case, the onset of pyocyanin production could also be affected. Therefore, it would be interesting to monitor pyocyanin production by this mutant in co-culture to investigate whether the production would start earlier in growth compared to the wildtype, thus overcoming the growth phase-dependency.

116

QUORUM SENSING OF PSEUDOMONAS

AERUGINOSA IN THE CO-CULTURE

In the general model for QS it is assumed that the amount of signal molecules has to increase to a certain threshold concentration, before they can bind to their cognate receptors in order to trigger gene expression (Fuqua et al., 1996). As described above, however, addition of exogenous signals cannot advance the expression of QS-controlled genes. Thus, the activation of most QS-controlled genes is not triggered by an accumulation of signal molecules, but it was shown that expression of many QS-controlled genes depends on the level of receptor protein (Schuster and Greenberg, 2007). The transcription of lasR in P. aeruginosa is controlled by several proteins such as MvaT, Vfr, GacA or proteins involved in stringent response (Albus et al., 1997; Reimmann et al., 1997; van Delden et al., 2001; Castang et al., 2008). Two proteins, QtsE and QslA, have been found to affect the stability of LasR, thus setting the quorum threshold for gene activation (Siehnel et al., 2010; Seet and Zhang, 2011). However, nothing is known about the repression of AHL-dependent gene expression during late stationary phase, when the production of virulence factors is no longer necessary, and energy is limited (Jimenez et al., 2012). One possibility would be the regulation of LasR stability. It is known from other LuxR-type transcriptional regulators like TraR from Agrobacterium tumefacies, that they are rapidly degraded when not bound to their cognate AHL (Zhu and Winans, 2001). However, LasR remains in a properly folded state, even if 3-oxo-C12-HSL is absent, and signal binding is reversible (Sappington et al., 2011). In our study, bioassays with E. coli indicator strains revealed that 3-oxo-C12-HSL could not be detected in the presence of pyocyanin, while the presence of C4-HSL resulted in bioluminescence production by the indicator strain. This was not caused by cell damage of the indicator strain for detection of 3-oxo-C12-HSL as the presence of pyocyanin led to a similar decrease in CFU numbers of both indicator strains. Whereas the plasmid pSB536 for the recognition of C4-HSL carries the ahyR gene from A. hydrophila, pSB1075 for the recognition of 3-oxo-C12-HSL carries lasR encoding for the native LasR receptor protein from P. aeruginosa. After binding of 3-oxo-C12-HSL, the LasR/AHL complex binds to the native lasI promoter fused in front of the lux operon on pSB1075. Possibly, pyocyanin affected LasR stability and, thus, could be involved in a negative regulation of LasR in late growth phase. On the other hand, the effect of pyocyanin on 3-oxo-C12-HSL detection by the E. coli indicator strain could be caused by a lack of protective mechanisms for LasR that could be present in cells of

117

CHAPTER 4 AEROMONAS HYDROPHILA – PSEUDOMONAS AERUGINOSA INTERACTIONS P. aeruginosa. Nevertheless, a possible influence of pyocyanin on LasR stability would be interesting and should be pursued by further studies with purified LasR. In order to identify novel genes involved in QS-regulated processes, we screened for transposon mutants of strain PAO1 in co-culture with strain AH-1N that showed an altered formation of pyocyanin. Besides mutants with defects in AQ-mediated QS we obtained a mutant with a defect in the gene encoding for Lon protease. When incubated in LB medium, a lon mutant of P. aeruginosa produces higher amounts of C4-HSL, C6-HSL, and pyocyanin compared to the wildtype (Takaya et al., 2008). In co-culture with strain AH-1N strain PAO1∆lon showed an enhanced production of C6HSL as well, but produced the same amounts of C4-HSL and distinctly lower amounts of pyocyanin compared to the wildtype. Possibly, this is again an example of the influence of culture conditions on the expression of QS-controlled genes. Additionally, we identified six mutants with altered pyocyanin formation that had defects in genes encoding for proteins without known functions. Four of these mutants had transposon insertions in genes that belong to the gene cluster PA1421PA1415 (PA1417, PA1420, PA1419). As these mutants comprised about 40 % of all mutants with altered pyocyanin formation, this region of the genome of strain PAO1 was likely to be a hotspot for transposon insertion. Transcript analysis indicated that this gene cluster consisted of two operons comprising PA1421-PA1418 and PA1417PA1415. However, mutants with defects in genes belonging to either operon showed similar phenotypes with regard to spermine degradation and pyocyanin formation indicating a similar function of these genes. The mutation of genes of the gene cluster as well as mutation of PA1422 led to a reduced formation of pyocyanin by the respective mutant strains. This phenotype was not restricted to co-culture conditions, as these mutants also produced 30 % less pyocyanin in single culture compared to the wildtype. However, this phenotype became most obvious in co-culture. The amount of pyocyanin produced by the mutants depended on the culture conditions applied. Strains PAO1∆PA1417::Tn and PAO1∆PA1420::Tn, for example, produced no pyocyanin in co-culture with strain AH1N when incubated in microtiter plates, no or small amounts of pyocyanin when incubated in test tubes, and the highest amounts when incubated in Erlenmeyer flasks, although still significantly lower amounts compared to the wildtype. The most remarkable difference concerning these incubation conditions was the oxygen transfer rate, which should be lowest in microtiter plates and highest in Erlenmeyer 118

QUORUM SENSING OF PSEUDOMONAS

AERUGINOSA IN THE CO-CULTURE

flasks due to more efficient mixing and a more suitable surface to volume-ratio. Possibly, this difference in the oxygen transfer rate would lead to the production of different amounts of pyocyanin by the wildtype as well. However, pyocyanin production by the wildtype in co-culture incubated in microtiter plates was still sufficient to inactivate strain AH-1N, whereas it was not inactivated by mutants with defects in the gene cluster PA1421-PA1415. Thus, the production of lower amounts of pyocyanin by these mutants gained in importance, when oxygen supply was low, because virulence of strain PAO1 decreased. There is a connection of this gene cluster with the degradation of arginine as GbuA (PA1421) takes part in the arginine transaminase (ATA) pathway, an alternative pathway for arginine degradation under oxic conditions (Nakada and Itoh, 2002; Yang and Lu, 2007). In this pathway, L-arginine is transaminated to α-keto-arginine by AruH (PA4976), which is further decarboxylated by AruI (PA4977) to 4guanidinobutyraldehyde. This compound is further oxidized to 4-guanidinobutyrate (4-GB) by KauB (PA5312), which is converted to 4-aminobutyrate (GABA) by GbuA. GABA is eventually converted via succinate-semialdehyde to succinate via transamination and oxidation reactions catalyzed by GabT (PA0266) and GabD (PA0265). Two further arginine degradation pathways exist in strain PAO1, the arginine succinyltransferase (AST) pathway, which is the main degradation pathway for arginine under oxic conditions, and the arginine deiminase (ADI) pathway for arginine degradation under anoxic conditions (Gamper et al., 1991; Itoh, 1997). However, there was no difference in growth with D- and L-arginine of strains PAO1∆PA1417::Tn, PAO1∆PA1420::Tn, and PAO1∆PA1422 compared to the wildtype. There are several indications that GbuA and the other enzymes of the ATA pathway may not be primarily involved in arginine degradation. First, the genes of both the AST and ADI pathways are located in operons, the aru and arc operon, respectively, whereas the genes of the ATA pathway are scattered across the genome at three different loci. Additionally, enzymes of the ATA pathway (KauB, GabT, and GabD) are known to take part in other degradation pathways of for example polyamines, as well (Yao et al., 2011). Second, both the AST and ADI pathways are positively regulated by ArgR, the arginine responsive regulator protein, which is encoded in the aot-argR operon for arginine uptake and regulation (Nishijyo et al., 1998), whereas enzymes of the ATA pathway are only induced, when ArgR is absent, or when the AST pathway is defect (Yang and Lu, 2007). Thus, when 119

CHAPTER 4 AEROMONAS HYDROPHILA – PSEUDOMONAS AERUGINOSA INTERACTIONS arginine is present in the medium, the ATA pathway is inhibited. Additionally, all genes of the cluster PA1421-PA1415 are upregulated in an argR mutant (Yang and Lu, 2007), even though no connection of PA1420-PA1415 could be established to arginine or 4-GB degradation. Third, GbuA has a rather high Km value of 49 mM for 4-GB (Nakada and Itoh, 2002) indicating a low affinity of the enzyme to this substrate, which is therefore unlikely to be the physiological substrate. Fourth, it is not obvious why strain PAO1 would possess two different pathways for arginine degradation under oxic conditions, with the ATA pathway being only active when the AST pathway is inhibited. Thus, participation of GbuA and maybe of the other enzymes in the ATA pathway could represent a secondary activity of these proteins. There are indications, however, that the gene cluster PA1421-PA1415 might be involved in polyamine metabolism. Biogenic polyamines are polycations found in all organisms and participate in many physiological functions in bacteria (Wortham et al., 2007). The group of polyamines include the diamines diaminopropane, putrescine, and cadaverine, the triamine spermidine, and the tetraamine spermine. Arginine and polyamine metabolisms are connected as arginine can be decarboxylated to agmatine, which is further converted to putrescine. This pathway was described as arginine decarboxylase (ADC) pathway being the fourth pathway of arginine degradation besides the ADI, ATA, and AST pathways, but serves the formation of polyamines when arginine is abundant rather than the utilization of arginine (Nakada and Itoh, 2003; Yang and Lu, 2007). Recently, it was shown that, similar to E. coli, strain PAO1 degrades polyamines via a γ-glutamylation pathway (Yao et al., 2011). The gene cluster PA1421-PA1415 might be connected with polyamine metabolism for several reasons. First, as mentioned above, three enzymes of the ATA pathway (KauB, GabT, GabD) are also involved in the degradation of agmatine, putrescine, spermidine, and spermine, which all yield GABA by the action of KauB being the central enzyme for polyamine degradation (Yao et al., 2011). GABA is converted to succinate by GabT and GabD. Second, strains PAO1∆PA1416, PAO1∆PA1417, and PAO1∆PA1419 grew faster with spermine compared to the wildtype. Spermine degradation is not fully clear, but it is probably cleaved to spermidine and 3aminopropanaldehyde. The latter is converted by KauB to β-alanine (Dasu et al., 2006). Third, PA1421 shows similarities to an agmatinase, even though no enzyme activity can be detected with agmatine (Nakada and Itoh, 2002). Fourth, PA1409 and PA1410, which are located downstream of the gene cluster PA1421-PA1415 are also 120

QUORUM SENSING OF PSEUDOMONAS

AERUGINOSA IN THE CO-CULTURE

connected to polyamine metabolism and are induced in the presence of agmatine. PA1409 encodes for AphA, an acetylpolyamine aminohydrolase that catalyses the degradation of acetylpolyamines. These compounds are produced and secreted for example by E. coli to keep the homeostasis of intracellular polyamines. No homologue of an acetylpolyamine synthase could be found in strain PAO1 (Chou et al., 2008). To gain more insight into the metabolic roles of the proteins encoded by the gene cluster PA1421-PA1415, however, further experiments with defined mutants with defects in this gene cluster have to be carried out. GbuR (PA1422) is the regulator of GbuA (Nakada and Itoh, 2002), and should, thus, regulate PA1420, PA1419, and PA1418 as well. We could show, however, that GbuR did not regulate the expression of the operon PA1415-PA1417, the second operon of the gene cluster. As described above, however, strains with defects in genes belonging to both operons showed the same phenotypes with regard to spermine degradation and pyocyanin formation. Thus, another regulatory protein could be responsible for the regulation of both operons. As described above, both operons are directly or indirectly regulated by argR in a negative way. Another candidate could be PA1413, which encodes a putative transcriptional regulator. The transposon insertions in PA1420, PA1419, and PA1417 could cause polar effects, which would be dependent on the direction of transposon insertion. Thus, transposon insertion in PA1420 and PA1419 could lead to overexpression of PA1419-PA1415 and PA1418-PA1415, respectively, whereas transposon insertion in PA1417 could lead to overexpression of PA1422 (Fig. 6). However, both transposon and gene deletion mutants showed the same phenotype regarding the impaired production of pyocyanin indicating that this phenotype was not affected or caused by polar effects due to transposon insertion. There was a difference between the transposon mutant strain PAO1∆PA1417::Tn and the gene deletion mutant PAO1∆PA1417 regarding growth with L-isoleucine with strain PAO1∆PA1417::Tn growing faster with this substrate compared to the wildtype and strain PAO1∆PA1417. This could be caused by an above mentioned polar effect caused by transposon insertion. Thus, further experiments should be carried out with gene deletion mutants instead of mutants with transposon insertions. Taken together, by selecting mutants of strain PAO1 during interaction with AH-1N in co-culture novel genes could be identified that were involved in QS-controlled processes. As similar QS-based interactions are likely to occur in natural 121

CHAPTER 4 AEROMONAS HYDROPHILA – PSEUDOMONAS AERUGINOSA INTERACTIONS environments, the co-culture represents a good model system to study QS of P. aeruginosa under conditions that are closer related to its environmental habitats than single cultures.

Acknowledgements The authors like to thank the group of Paul Williams (Nottingham) for the gift of pRIC380∆lasR, pRIC380∆rhlI, and pDM4∆rhlR. Continuous support from Bernhard Schink and experimental support from Nadine Dreser is acknowledged.

122

GENERAL DISCUSSION

GENERAL DISCUSSION In their natural habitats, bacteria are part of multispecies microbial communities. In oligotrophic habitats in particular, competition for nutrients will inevitably lead to interspecific interactions of bacteria. In order to persist or prevail in such interactions, bacteria have developed multiple strategies. In the studies included in this thesis, we characterized strategies that were employed by bacteria in interspecific interactions during polymer degradation. For this, we established two co-culture model systems consisting of investor and opportunistic bacteria and chitin as substrate. Aeromonas hydrophila strain AH-1N was employed as investor bacterium in both co-cultures. As opportunistic bacteria, we employed Flavobacterium sp. strain 4D9 in the first coculture (Chapter 1), and Pseudomonas aeruginosa strain PAO1 in the second coculture (Chapter 2-4). Strategies of Flavobacterium sp. strain 4D9 in co-culture with A. hydrophila strain AH1N during growth with embedded chitin In our first co-culture model system with A. hydrophila as investor bacterium, we employed Flavobacterium sp. strain 4D9, a member of the phylum Bacteroidetes, as opportunistic bacterium and embedded chitin as substrate. We hypothesized that strain 4D9 would not be able to access embedded chitin due to the predicted association of its chitinases to the cell (see below). This hypothesis could be confirmed as strain 4D9 did not degrade embedded chitin. Additionally, no chitinolytic activities could be detected in culture supernatant of strain 4D9 grown with suspended chitin, which would have been indicative of released chitinases. When both strains were co-incubated with embedded chitin, strain 4D9 was able to outgrow strain AH-1N in the biofilm formed on the chitin beads, which was visible by the formation of orange colonies. As strain 4D9 could not grow with acetate, which was transiently released by strain AH-1N during chitin degradation, this strain was dependent on other strategies in order to access nutrients for growth. We demonstrated that these strategies included active integration into the biofilm formed by strain AH-1N on the chitin bead and interception of GlcNAc, which was released from chitin by chitinolytic enzymes of strain AH-1N. In order to intercept GlcNAc, strain 4D9 must be more efficient in the uptake of GlcNAc than strain AH1N. Degradation of GlcNAc by Flavobacteria has not been investigated, but enzymes 123

GENERAL DISCUSSION necessary for GlcNAc degradation are encoded in the genome of F. johnsoniae (McBride et al., 2009). These include a GlcNAc kinase, a GlcNAc-6-phosphate deacetylase, and six glucosamine-6-phosphate isomerases/deaminases, which together would be sufficient to convert GlcNAc into fructose-6-phosphate, which is further degraded via the citric acid cycle. However, nothing is known about the uptake of GlcNAc by Flavobacteria. Chitin degradation by F. johnsoniae is predicted to be similar to the degradation of starch by Bacteroides thetaiotaomicron via its starch utilization system (McBride et al., 2009). This suggests that chitin is bound and initially digested by cell surface proteins, explaining the need for cell surface contact to the polymer. Chitin oligomers are subsequently transported into the periplasm and cleaved to GlcNAc. Thus, there is no uptake of GlcNAc during chitin degradation as GlcNAc monomers are not produced outside the cell. Many bacteria, for example E. coli

and

P.

aeruginosa,

employ

PEP:GlcNAc

phosphotransferase

systems

(PEP:GlcNAc-PTS) for the uptake of GlcNAc (Peri and Waygood, 1988; Reizer et al., 1999). However, no homologue of NagE, the GlcNAc-binding protein of the PEP:GlcNAc-PTS, could be detected in the genome of F. johnsoniae using BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Thus, the mechanism of GlcNAc uptake by Flavobacteria and the affinity of the respective uptake system to GlcNAc remain to be identified. Bacteroidetes

are

abundant

in

the

particle-associated

fraction

in

aquatic

environments (DeLong et al., 1993; Kirchman, 2002; Azam and Malfatti, 2007). For Lake Constance, this could be confirmed by a community composition analysis of the bacterioplankton using culture-independent metagenome sequencing. This analysis showed that sequences belonging to members of the Bacteroidetes were mainly detected in the particulate fraction (>3 µm) (Kesberg, 2011). Integration into biofilms by members of the Flavobacterium-Cytophaga group in particular is a common phenomenon, and they have been reported to be part of biofilms from various environments like oyster reefs, reed stems, oligotrophic and urban rivers, and glacial streams (Battin et al., 2001; Araya et al., 2003; Nocker et al., 2004; Rusznyák et al., 2007; Honma et al., 2009). The ability for biofilm formation has been studied with Flavobacterium sp. isolates as well as their ability to form mixed-species biofilms with A. hydrophila and V. cholerae (Basson et al., 2007), which both degrade chitin via released enzymes (Janda, 1985; Meibom et al., 2004). However, the manner, in which Flavobacteria form biofilms has not been elucidated yet (Basson et al., 2007). 124

GENERAL DISCUSSION Flavobacteria species do not possess flagella, pili, or fimbriae, which facilitate adhesion in other bacteria. It has been hypothesized that surface hydrophobicity, capsule formation, or specific lectins and lectin-like carbohydrate-binding substances are important (Basson et al., 2008; McBride et al., 2009). Members of the Bacteroidetes in general and Flavobacteria in particular are known polymer degraders (Glöckner et al., 1999; Kirchman, 2002), and members of the Flavobacterium-Cytophaga group were highly abundant during phytoplankton blooms, when large amounts of polymers are released (Eiler and Bertilsson, 2007; Zeder et al., 2009). Proteins of the starch utilization system of B. thetaiotaomicron are encoded in a so-called polysaccharide utilization locus (PUL) (Bjursell et al., 2006). Similar proteins are common in the phylum Bacteroidetes (McBride et al., 2009). In Cytophaga hutchinsonii, for example, such proteins may be involved in the utilization of cellulose. In the genome of F. johnsoniae several PULs are present encoding for proteins likely to be involved in utilization of chitin (see above), starch, and hemicellulose. Thus, employing such utilization systems for the degradation of insoluble polymers seems to be a general strategy of the Bacteroidetes (McBride et al., 2009). As describe above, contact to the substrate is required for this mode of degradation. Therefore, a general problem of these bacteria could be the access to entangled polymers, and integration into biofilms of bacteria producing extracellular hydrolytic enzymes and interception of degradation intermediates could be general strategies. In addition, strains of F. johnsoniae produce a variety of secondary metabolites, among them antimicrobial compounds like monobactam and quinolone antibiotics (Evans et al., 1978; Kato et al., 1987a, Kato et al., 1987b). However, our study indicated that these compounds were not involved in the outcome of the interaction with strain AH-1N. In order to prevail in interactions with opportunistic bacteria, A. hydrophila itself has to develop certain protective strategies. During degradation of embedded chitin, strain AH-1N forms a biofilm on the chitin bead, which could serve as a means to prevent loss of chitinolytic enzymes and of degradation products. This strategy could be successful in interactions with opportunistic bacteria that are not able to integrate into this biofilm. Additionally, strain AH-1N exhibited a tight coupling between chitin hydrolysis and uptake of degradation products, which would protect this strain from exploitation by opportunistic bacteria containing uptake systems with lower affinity to 125

GENERAL DISCUSSION the degradation products. However, in the co-culture investigated in our study, strain AH-1N cannot protect itself from exploitation by the opportunistic strain 4D9. Strategies of P. aeruginosa strain PAO1 in co-culture with A. hydrophila strain AH-1N during growth with suspended chitin Many virulence traits of P. aeruginosa that are important in human infections have a particular function in the environment (Coggan and Wolfgang, 2012). Thus, in order to fully understand these traits, it is important to identify the strategies, in which they are employed, and to investigate the primary function of these strategies in the environment. This may lead to the identification of environmental cues as triggers of these traits. Therefore, it is necessary to study P. aeruginosa in surroundings that resemble its natural environment including interactions with other bacteria or organisms, which it encounters in its natural habitat. This approach can be transferred to the investigation of other opportunistic pathogens that primarily live in the environment like Vibrio cholerae, or species of Legionella and Staphylococcus. P. aeruginosa strain PAO1 was employed as opportunistic bacterium in the second co-culture model system. We confirmed the inability of this strain to grow with suspended chitin, which was used as substrate in this co-culture. Thus, in order to acquire nutrients, strain PAO1 depended on employing other strategies. The coculture of strains PAO1 and AH-1N was characterized by a green colour formation after about two days of incubation caused by the quorum sensing (QS)-controlled production of secondary metabolites by strain PAO1. Concomitant with this colour formation, CFU numbers of strain AH-1N rapidly decreased, while CFU numbers of strain PAO1 eventually increased to the same number that strain AH-1N had reached before. We characterized the strategy of strain PAO1 underlying this outcome of the coculture (Fig. 1) (Chapter 2). In the first phase of the co-culture strain PAO1 likely grew with ammonium and organic compounds as nitrogen, carbon, and energy sources, which were produced by strain AH-1N. The subsequent production of QS-controlled secondary metabolites by strain PAO1 in the second phase of the co-culture was dependent on the action of isocitrate lyase (Chapter 3). Besides its role in the utilization of acetate, we demonstrated that this enzyme was crucial for the utilization of GlcNAc by strain PAO1 as well, which has not been observed previously. Thus, the importance of isocitrate lyase for strain PAO1 in the first phase of the co-culture 126

GENERAL DISCUSSION was either due to utilization of acetate transiently released by strain AH-1N or of GlcNAc formed by chitinolytic enzymes of strain AH-1N or both. Pyocyanin was the most important secondary metabolite of strain PAO1 in the second phase of the co-culture. This was supported by the fact that the presence of pyocyanin alone was sufficient to complement

a pqsA mutant of strain

PAO1(Jagmann et al., 2010), which itself is unable to enter the second phase of the co-culture. Pyocyanin is an important virulence factor of P. aeruginosa, which may be reflected by the fact that this bacterium possesses two operons for pyocyanin biosynthesis (Mavrodi et al., 2001). The damages that are caused in many different organisms by pyocyanin are often associated with oxidative stress (Lau et al., 2004). Pyocyanin can easily penetrate biological membranes and transfers electrons from the electron transport chain or NADH to oxygen, thereby creating reactive oxygen species (ROS) like the superoxide radical and hydrogen peroxide (Hassan and Fridovich, 1980). In strain AH-1N the production of ROS by pyocyanin leads to an inhibition of aconitase, which causes a block of the citric acid cycle and, thus, a massive release of acetate by this strain, which is used as growth substrate by strain PAO1. Aconitase and fumarase are both iron-sulfur cluster-containing dehydratases of the citric acid cycle and are, among various other enzymes, damaged by the superoxide radical and hydrogen peroxide (Imlay, 2003). When P. aeruginosa is grown in single culture under laboratory conditions, pyocyanin production commences at the end of exponential phase and at the beginning of stationary phase (Price-Wheelan et al., 2006). There is no obvious reason for this under these conditions, as production of pyocyanin and other secondary metabolites is costly in terms of carbon and energy. However, in the presence of other organisms, as it is the case in the natural environment of P. aeruginosa, the production of pyocyanin at this point of time is very effective. The damaging and killing of other organisms, once nutrients become limited, can provide P. aeruginosa with fresh nutrients. As this bacterium is metabolically very versatile, it can grow with a variety of nutrients that are released by damaged cells. If substrates that cannot be degraded by P. aeruginosa are the only nutrients available, there are two facts that support growth of and eventually secondary metabolite production by P. aeruginosa in the presence of substrate-degrading bacteria. First, cells of P. aeruginosa have been described to attach to a number of surfaces and particles (Tolker-Nielson and Molin, 2004). We

127

GENERAL DISCUSSION

2

ox

2

red

+

Fig. 1. Proposed model for the course of the co-culture of A. hydrophila strain AH-1N (in blue) and P. aeruginosa strain PAO1 (in green) with chitin as substrate (strands of grey circles). In the first phase of the co-culture, chitin is cleaved by extracellular chitinases released by strain AH-1N (blue arrows), and GlcNAc and di- and trimers of chitin are taken up into the cell. GlcNAc is further degraded to CO2 via the citric acid cycle (TCC) (solid black arrows). Acetate and ammonium (NH4+) are transiently released by strain AH-1N and, possibly in addition to GlcNAc, serve as carbon, nitrogen, and energy sources for strain PAO1 (dashed black arrows). This allows small growth of strain PAO1 in the first phase of the co-culture and is the basis for the formation of QS signal molecules and the subsequent biosynthesis of secondary metabolites (green arrows). QS is triggered by certain environmental cues including phosphate limitation. Pyocyanin, the central secondary metabolite in the co-culture, enters the cell of strain AH-1N and transfers electrons presumably from NADH to oxygen thereby creating reactive oxygen species (ROS) like the superoxide radical (O2-). ROS inhibit the aconitase causing a block of the TCC. In consequence, acetyl-CoA accumulates and large amounts of acetate are released serving as growth substrate for strain PAO1 (solid red arrows).

128

GENERAL DISCUSSION could demonstrate such an attachment to particles of suspended chitin. Thus, if insoluble polysaccharides like cellulose and chitin serve as substrates, the cells are in proximity to the zone of polysaccharide degradation by other bacteria. Second, its metabolic versatility enables P. aeruginosa to grow with a variety of exudates from or compounds released by other bacteria in order to get sufficient carbon and energy for the production of secondary metabolites. The production of pyocyanin in particular can have a direct effect on the composition of nutrients that are forced to be released by other bacteria. Blocking of the citric acid cycle in these bacteria by inhibition of fumarase and aconitase will lead to an accumulation of mainly acetyl-CoA, αketoglutarate, succinyl-CoA, or fumarate within in the cells dependent on the substrates degraded and the entry point of their degradation products in citric acid cycle. It is likely that, in consequence, intermediates of the citric acid cycle are released by the cells. This intermediates are among the preferred substrates of P. aeruginosa (Collier et al., 1996). Thus, forcing the release of such intermediates by the action of pyocyanin could be a general strategy of P. aeruginosa. The synthesis of pyocyanin and the subsequent acquisition of nutrients by damaging other bacteria may be more effective than possessing and inducing competitive degradative pathways. Until now, it is not known, how cells of P. aeruginosa can protect themselves from the impacts of pyocyanin. Investigation of QS of strain PAO1 in the co-culture revealed, that the las system was dispensable for the outcome of the co-culture, whereas the rhl and AQ systems were crucial (Chapter 4). Thus, secondary metabolites that are controlled by the las system alone, such as elastase, were not important in the co-culture. Most of the studies for investigating the QS network of P. aeruginosa were conducted with single cultures. However, an approach with single cultures is limited, because, as described above, bacteria naturally live in multispecies environments and are also in contact with higher organisms (Atkinson and Williams, 2009). In most of the studies the molecular aspects were put in focus, and the ecological context as well as the environmental factors triggering QS are often not clear (Keller and Surette, 2006). In our co-culture, an environmental cue as trigger of QS could not be explicitly specified. We demonstrated the role of phosphate limitation and suggested that stationary phase-like conditions were involved as well. However, by employing our co-culture model system, we could identify several genes that were important in QS-controlled processes of strain PAO1. Mutations in the gene cluster PA1421-PA1415 led to 129

GENERAL DISCUSSION production of lower amounts of pyocyanin and, thus, to decreased virulence of strain PAO1. This effect became obvious only in co-cultures, as the production of lower amounts of pyocyanin was hardly visible in single cultures. Possibly, the enzymes encoded in this gene cluster participate in the formation of a metabolite that is somehow involved in the regulation of pyocyanin synthesis. Even though auxotrophic mutants of strain PAO1 grew normally in single cultures with tryptone, they produced no or significantly lower amounts of pyocyanin in co-culture with chitin and tryptone as additional amino acid source, even if PqsE was overexpressed. Investigations with regard to the gene cluster PA1421-PA1415 and the relation of auxotrophy to the action of PqsE are in progress. Altogether, we could demonstrate that our co-culture model system with strains AH-1N and PAO1 is suitable for studying QS, environmental triggers of QS, and QS-regulated processes in strain PAO1 under more natural conditions compared to incubation in single culture. The application of co-culture model systems to identify bacterial strategies As the study of environmental systems as a whole is often very complicated, it is necessary to establish laboratory model systems or microcosms. However, model systems are not intended to entirely mimic natural systems, but they are intended to simplify these systems in order to deconstruct natural complexity in its component parts, which then can be investigated on their own (Jessup et al., 2004). Finally, the knowledge gained from these reductionistic approaches is combined in order to describe complex networks, for example microbial communities and processes therein (Haruta et al., 2009). One important argument against microbial model systems in the laboratory is that they are highly artificial (Hutchinson, 1978; Carpenter, 1996). However, even though the composition of a model system can be controlled, the dynamics of bacterial interactions in a model system are beyond control (Jessup et al., 2004). It is important, however, that the species and substrates used in the model systems occur in the same environmental habitat. The bacterial strains used in our co-culture model systems co-exist in aquatic habitats, and chitin is the most abundant polysaccharide in these habitats. Of course, the physiological characteristics will differ between the test tube and the natural environment due to complex environmental factors, such as soil particles, water currents, and temperature changes (Haruta et al., 2009). Therefore, it should be tested whether the theory derived from laboratory experiments is transferable to the natural situation. 130

GENERAL DISCUSSION With regard to our co-culture model systems, it should be examined, whether the strategies employed by the opportunistic bacteria are relevant in the environment. This could be done for example by establishing microcosms directly in Lake Constance. Alternatively, the model systems could be conducted in a more complex manner by adding for example another bacterial species, by using freshwater from the Lake as growth medium, by changing physico-chemical parameters such as temperature or mixing, or by using chitin in its naturally occurring form as substrate, e.g. incorporated in Daphnia shells. Another argument against model systems like the ones established in this thesis, is the application as batch cultures. Often, continuous cultivation has many advantages over batch cultures (Hoskisson and Hobbs, 2005). However, continuous cultivation is difficult to apply when insoluble compounds are used as growth substrates, because the maintenance of homogenous suspensions poses a major problem (Pavlostathis et al., 1988). Moreover, degradation of organic particles in aquatic systems rather resembles a batch culture, as the particle will be completely degraded after a while without further input of nutrients. However, applying continuous cultivation as it was done with cellulose (Pavlostathis et al., 1988) could be helpful to investigate certain aspects of the co-cultures. It could be tested, for example, whether strain AH-1N could be forced to degrade chitin and to release acetate due to a blocked citric acid cycle for a longer time period, when only sublethal concentration of pyocyanin are present. Additionally, the co-culture could be kept in early exponential phase, in which strain PAO1 does not produce pyocyanin yet, in order to search for triggers that lead to an earlier activation of QS by this strain. Altogether, we believe that it is feasible to study interspecific interactions of bacteria during polymer degradation using a batch culture approach and to discuss a potential relevance of the identified bacterial strategies in the environment.

131

RECORD OF ACHIEVEMENT

RECORD OF ACHIEVEMENT Unless stated otherwise, all experiments described in this thesis were planned, performed and analyzed by myself or under my direct supervision.

Chapter 1: Katharina Styp von Rekowski developed the cultivation method with embedded chitin (see also Styp von Rekowski et al., 2008) and did initial experiments on this project.

Chapter 2: Bodo Philipp performed the oxygen consumption experiments and the aconitase assay. Hans-Philipp Brachvogel developed the HPLC method for quantifying phenazines and alkylquinolones, the method for quantifying rhamnolipids, and measured elastolytic activity and cyanide in the work for his bachelor thesis under my supervision.

Chapter 3: Mario Hupfeld performed the experiments regarding carbon catabolite repression analysis and constructed the respective mutants in the work for his bachelor thesis under my supervision.

Chapter 4: Vera Bleicher helped with the construction of mutants and growth experiments during her work as student research assistant.

133

REFERENCES

REFERENCES Aendekerk, S., Diggle, S.P., Song, Z., Høiby, N., Cornelis, P., Williams, P., and Cámara, M. (2005) The MexGHI-OpmD multidrug efflux pump controls growth, antibiotic susceptibility and virulence in Pseudomonas aeruginosa via 4quinolone-dependent cell-to-cell communication. Microbiology 151: 1113-1125. Ahmer, B.M.M. (2004) Cell-to-cell signalling in Escherichia coli and Salmonella enterica. Mol Microbiol 52: 933-945. Albus, A.M., Pesci, E.C., Runyen-Janecky, L.J., West, S.E., and Iglewski, B.H. (1997) Vfr controls quorum sensing in Pseudomonas aeruginosa. J Bacteriol 179: 3928-3935. Allison, S.D. (2005) Cheaters, diffusion and nutrients constrain decomposition by microbial enzymes in spatially structured environments. Ecology Lett 8: 626-635. Alonso, A., Rojo, F., and Martínez, J.L. (1999) Environmental and clinical isolates of Pseudomonas aeruginosa show pathogenic and biodegradative properties irrespective of their origin. Environ Microbiol 1: 421-430. Alonso, C., Warnecke, F., Amann, R., and Pernthaler, J. (2007) High local and global diversity of Flavobacteria in marine plankton. Environ Microbiol 9: 1253-1266. Araya, R., Tani, K., Takagi, T., Yamaguchi, N., and Nasu, M. (2003) Bacterial activity and community composition in stream water and biofilm from an urban river determined by fluorescent in situ hybridization and DGGE analysis. FEMS Microbiol Ecol 43: 111-119. van Asperen, I.A., de Rover, C.M., Schijven, J.F., Oetomo, S.B., Schellekens, J.F., van Leeuwen, N.J. et al. (1995) Risk of otitis externa after swimming in recreational fresh water lakes containing Pseudomonas aeruginosa. BMJ 311: 1407-1410. Atkinson, S., and Williams, P. (2009) Quorum sensing and social networking in the microbial world. J R Soc Interface 6: 959-978. Azam, F., and Malfatti, F. (2007) Microbial structuring of marine ecosystems. Nat Rev Microbiol 5: 782-791. Bainton, N.J., Stead, P., Chhabra, S.R., Bycroft, B.W., Salmond, G.P., Stewart, G.S., and Williams, P. (1992) N-(3-oxohexanoyl)-L-homoserine lactone regulates carbapenem antibiotic production in Erwinia carotovora. Biochem J 288: 9971004. Baron, S.S., and Rowe, J.J. (1981) Antibiotic action of pyocyanin. Antimicrob Agents Chemother 20: 814-820. Barth, A.L., and Pitt, T.L. (1995) Auxotrophic variants of Pseudomonas aeruginosa are selected from prototrophic wild-type strains in respiratory infections in patients with cystic fibrosis. J Clin Microbiol 33: 37-40. Barth, A.L., and Pitt, T.L. (1996) The high amino-acid content of sputum from cystic fibrosis patients promotes growth of auxotrophic Pseudomonas aeruginosa. J Med Microbiol 45: 110-119. Basson, A., Flemming, L.A., and Chenia, H.Y. (2008) Evaluation of adherence, hydrophobicity, aggregation, and biofilm development of Flavobacterium johnsoniae-like isolates. Microb Ecol 55: 1-14. 135

REFERENCES Battin, T.J., Wille, A., Sattler, B., and Psenner, R. (2001) Phylogenetic and functional heterogeneity of sediment biofilms along environmental gradients in a glacial stream. Appl Environ Microbiol 67: 799-807. Baty, A.M., Diwu, Z., Dunham, G., Eastburn, C.C., Geesey, G.G., Goodman, A.E. et al. (2000) Characterization of extracellular chitinolytic activity in biofilms. Methods Enzymol 336: 279-301. Bauer, M., Kube, M., Teeling, H., Richter, M., Lombardot, T., Allers, E. et al. (2006) Whole genome analysis of the marine Bacteroidetes 'Gramella forsetii' reveals adaptations to degradation of polymeric organic matter. Environ Microbiol 8: 2201-2213. Bazire, A., Dheilly, A., Diab, F., Morin, D., Jebbar, M., Haras, D., and Dufour, A. (2005) Osmotic stress and phosphate limitation alter production of cell-to-cell signal molecules and rhamnolipid biosurfactant by Pseudomonas aeruginosa. FEMS Microbiol Lett 253: 125-131. Beatson, S.A., Whitchurch, C.B., Semmler, A.B.T., and Mattick, J.S. (2002) Quorum sensing is not required for twitching motility in Pseudomonas aeruginosa. J Bacteriol 184: 3598-3604. Beier, S., and Bertilsson, S. (2011) Uncoupling of chitinase activity and uptake of hydrolysis products in freshwater bacterioplankton. Limnol Oceanogr 56: 11791188. Biswas, L., Biswas, R., Schlag, M., Bertram, R., and Götz, F. (2009) Small-colony variant selection as a survival strategy for Staphylococcus aureus in the presence of Pseudomonas aeruginosa. Appl Environ Microbiol 75: 6910-6912. Bjursell, M.K., Martens, E.C., and Gordon, J.I. (2006) Functional genomic and metabolic studies of the adaptations of a prominent adult human gut symbiont, Bacteroides thetaiotaomicron, to the suckling period. J Biol Chem 281: 3626936279. Bleves, S., Soscia, C., Nogueira-Orlandi, P., Lazdunski, A., and Filloux, A. (2005) Quorum sensing negatively controls type III secretion regulon expression in Pseudomonas aeruginosa PAO1. J Bacteriol 187: 3898-3902. Bochner, B.R., Gadzinski, P., and Panomitros, E. (2001) Phenotype microarrays for high-throughput phenotypic testing and assay of gene function. Genome Res 11: 1246-1255. Bollinger, N., Hassett, D.J., Iglewski, B.H., Costerton, J.W., and McDermott, T.R. (2001) Gene expression in Pseudomonas aeruginosa: evidence of iron override effects on quorum sensing and biofilm-specific gene regulation. J Bacteriol 183: 1990-1996. Brencic, A., and Lory, S. (2009) Determination of the regulon and identification of novel mRNA targets of Pseudomonas aeruginosa RsmA. Mol Microbiol 72: 612632. Brint, J.M., and Ohman, D.E. (1995) Synthesis of multiple exoproducts in Pseudomonas aeruginosa is under the control of RhlR-RhlI, another set of regulators in strain PAO1 with homology to the autoinducer-responsive LuxRLuxI family. J Bacteriol 177: 7155-7163.

136

REFERENCES Bruhn, J.B., Dalsgaard, I., Nielsen, K.F., Buchholtz, C., Larsen, J.L., and Gram, L. (2005) Quorum sensing signal molecules (acylated homoserine lactones) in gram-negative fish pathogenic bacteria. Dis Aquat Organ 65: 43-52. Burrowes, E., Baysse, C., Adams, C., and O'Gara, F. (2006) Influence of the regulatory protein RsmA on cellular functions in Pseudomonas aeruginosa PAO1, as revealed by transcriptome analysis. Microbiology 152: 405-418. Carpenter, S.R. (1996) Microcosm experiments have limited relevance for community and ecosystem ecology. Ecology 77(3): 677-680. Castang, S., McManus, H.R., Turner, K.H., and Dove, S.L. (2008) H-NS family members function coordinately in an opportunistic pathogen. Proc Natl Acad Sci U S A 105: 18947-18952. Charlton, T.S., de Nys, R., Netting, A., Kumar, N., Hentzer, M., Givskov, M., and Kjelleberg, S. (2000) A novel and sensitive method for the quantification of N-3oxoacyl homoserine lactones using gas chromatography-mass spectrometry: application to a model bacterial biofilm. Environ Microbiol 2: 530-541. Chayabutra, C., Wu, J., and Ju, L.K. (2001) Rhamnolipid production by Pseudomonas aeruginosa under denitrification: effects of limiting nutrients and carbon substrates. Biotechnol Bioeng 72: 25-33. Chen, X., Schauder, S., Potier, N., Dorsselaer, A.V., Pelczer, I., Bassler, B.L., and Hughson, F.M. (2002) Structural identification of a bacterial quorum-sensing signal containing boron. Nature 415: 545-549. Chou, H.T., Kwon, D.-H., Hegazy, M., and Lu, C.-D. (2008) Transcriptome analysis of agmatine and putrescine catabolism in Pseudomonas aeruginosa PAO1. J Bacteriol 190: 1966-1975. Chróst, R.J., and Rai, H. (1993) Ectoenzyme activity and bacterial secondary production in nutrient-impoverished and nutrient-enriched freshwater mesocosms. Microb Ecol 25: 131-150. Chruszcz, M., Zimmerman, M.D., Wang, S., Koclega, K.D., Zheng, H., Evdokimova, E. et al. (2008) Function-biased choice of additives for optimization of protein crystallization - the case of the putative thioesterase PA5185 from Pseudomonas aeruginosa PAO1. Cryst Growth Des 8: 4054-4061. Chuanchuen, R., Narasaki, C.T., and Schweizer, H.P. (2002) Benchtop and microcentrifuge preparation of Pseudomonas aeruginosa competent cells. Biotechniques 33: 760-763. Chugani, S.A., Whiteley, M., Lee, K.M., D'Argenio, D., Manoil, C., and Greenberg, E.P. (2001) QscR, a modulator of quorum-sensing signal synthesis and virulence in Pseudomonas aeruginosa. Proc Natl Acad Sci U S A 98: 27522757. Clarke, P.H. (1982) The metabolic versatility of pseudomonads. Antonie Van Leeuwenhoek 48: 105-130. Coggan, K.A., and Wolfgang, M.C. (2012) Global regulatory pathways and cross-talk control Pseudomonas aeruginosa environmental lifestyle and virulence phenotype. Curr Issues Mol Biol 14: 47-70. Collier, D.N., Hager, P.W., and Phibbs, P.V. (1996) Catabolite repression control in the Pseudomonads. Res Microbiol 147: 551-561. 137

REFERENCES Colussi, P.A., Specht, C.A., and Taron, C.H. (2005) Characterization of a nucleusencoded chitinase from the yeast Kluyveromyces lactis. Appl Environ Microbiol 71: 2862-2869. Costerton, J.W., Lewandowski, Z., Caldwell, D.E., Korber, D.R., and Lappin-Scott, H.M. (1995) Microbial biofilms. Annu Rev Microbiol 49: 711-745. Cottrell, M.T., and Kirchman, D.L. (2000) Natural assemblages of marine proteobacteria and members of the Cytophaga-Flavobacter cluster consuming low- and high-molecular-weight dissolved organic matter. Appl Environ Microbiol 66: 1692-1697. Cox, C.D., and Adams, P. (1985) Siderophore activity of pyoverdin for Pseudomonas aeruginosa. Infect Immun 48: 130-138. D'Argenio, D.A., Wu, M., Hoffman, L.R., Kulasekara, H.D., Déziel, E., Smith, E.E. et al. (2007) Growth phenotypes of Pseudomonas aeruginosa lasR mutants adapted to the airways of cystic fibrosis patients. Mol Microbiol 64: 512-533. Dasu, V.V., Nakada, Y., Ohnishi-Kameyama, M., Kimura, K., and Itoh, Y. (2006) Characterization and a role of Pseudomonas aeruginosa spermidine dehydrogenase in polyamine catabolism. Microbiology 152: 2265-2272. Defoirdt, T., Miyamoto, C.M., Wood, T.K., Meighen, E.A., Sorgeloos, P., Verstraete, W., and Bossier, P. (2007) The natural furanone (5Z)-4-bromo-5(bromomethylene)-3-butyl-2(5H)-furanone disrupts quorum sensing-regulated gene expression in Vibrio harveyi by decreasing the DNA-binding activity of the transcriptional regulator protein luxR. Environ Microbiol 9: 2486-2495. van Delden, C., Comte, R., and Bally, A.M. (2001) Stringent response activates quorum sensing and modulates cell density-dependent gene expression in Pseudomonas aeruginosa. J Bacteriol 183: 5376-5384. Dekimpe, V., and Déziel, E. (2009) Revisiting the quorum-sensing hierarchy in Pseudomonas aeruginosa: the transcriptional regulator RhlR regulates LasRspecific factors. Microbiology 155: 712-723 DeLong, E.F., Franks, D.G., and Alldredge, A.L. (1993) Phylogenetic diversity of aggregate attached vs. free-living marine bacterial assemblages. Limnol Oceanogr 38: 924-934. Déziel, E., Lépine, F., Milot, S., He, J.X., Mindrinos, M.N., Tompkins, R.G., and Rahme, L.G. (2004) Analysis of Pseudomonsa aeruginosa 4-hydroxy-2alkylquinolines (HAQs) reveals a role for 4-hydroxy-2-heptylquinoline in cell-tocell communication. Proc Natl Acad Sci U S A 101:1339-1344 Déziel, E., Gopalan, S., Tampakaki, A.P., Lépine, F., Padfield, K.E., Saucier, M. et al. (2005) The contribution of MvfR to Pseudomonas aeruginosa pathogenesis and quorum sensing circuitry regulation: multiple quorum sensing-regulated genes are modulated without affecting lasRI, rhlRI or the production of N-acyl-Lhomoserine lactones. Mol Microbiol 55: 998-1014. Diggle, S.P., Winzer, K., Lazdunski, A., Williams, P., and Cámara, M. (2002) Advancing the quorum in Pseudomonas aeruginosa: MvaT and the regulation of N-acylhomoserine lactone production and virulence gene expression. J Bacteriol 184: 2576-2586.

138

REFERENCES Diggle, S.P., Winzer, K., Chhabra, S.R., Worrall, K.E., Cámara, M., and Williams, P. (2003) The Pseudomonas aeruginosa quinolone signal molecule overcomes the cell density-dependency of the quorum sensing hierarchy, regulates rhldependent genes at the onset of stationary phase and can be produced in the absence of LasR. Mol Microbiol 50: 29-43. Diggle, S.P., Griffin, A.S., Campbell, G.S., and West, S.A. (2007) Cooperation and conflict in quorum-sensing bacterial populations. Nature 450: 411-414. Dötsch, A., Eckweiler, D., Schiederjans, M., Zimmermann, A., Jensen, V., Scharfe, M., Geffers, R., Häussler, S. (2012) The Pseudomonas aeruginosa transcriptome in planktonic cultures and static biofilms using RNA sequencing. PLoS One 7: e31092 Driscoll, J.A., Brody, S.L., and Kollef, M.H. (2007) The epidemiology, pathogenesis and treatment of Pseudomonas aeruginosa infections. Drugs 67: 351-368. Duan, K., and Surette, M.G. (2007) Environmental regulation of Pseudomonas aeruginosa PAO1 las and rhl quorum-sensing systems. J Bacteriol 189: 48274836. Dubern, J.-F., and Diggle, S.P. (2008) Quorum sensing by 2-alkyl-4-quinolones in Pseudomonas aeruginosa and other bacterial species. Mol Biosyst 4: 882-888. Duchaud, E., Boussaha, M., Loux, V., Bernardet, J.-F., Michel, C., Kerouault, B. et al. (2007) Complete genome sequence of the fish pathogen Flavobacterium psychrophilum. Nat Biotechnol 25: 763-769. Dunny, G.M., Brickman, T.J., and Dworkin, M. (2008) Multicellular behavior in bacteria: communication, cooperation, competition and cheating. Bioessays 30: 296-298. Eberhard, A., Burlingame, A.L., Eberhard, C., Kenyon, G.L., Nealson, K.H., and Oppenheimer, N.J. (1981) Structural identification of autoinducer of Photobacterium fischeri luciferase. Biochemistry 20: 2444-2449. Eiler, A., and Bertilsson, S. (2007) Flavobacteria blooms in four eutrophic lakes: linking population dynamics of freshwater bacterioplankton to resource availability. Appl Environ Microbiol 73: 3511-3518. Engebrecht, J., Nealson, K., and Silverman, M. (1983) Bacterial bioluminescence: isolation and genetic analysis of functions from Vibrio fischeri. Cell 32: 773-781. Evans, J.R., Napier, E.J., and Fletton, R.A. (1978) G1499-2, a new quinoline compound isolated from the fermentation broth of Cytophaga johnsonii. J Antibiot (Tokyo) 31: 952-958. Farrow, J.M., and Pesci, E.C. (2007) Two distinct pathways supply anthranilate as a precursor of the Pseudomonas quinolone signal. J Bacteriol 189: 3425-3433. Farrow, J.M., Sund, Z.M., Ellison, M.L., Wade, D.S., Coleman, J.P., and Pesci, E.C. (2008) PqsE functions independently of PqsR-Pseudomonas quinolone signal and enhances the rhl quorum-sensing system. J Bacteriol 190: 7043-7051. Favero, M.S., Carson, L.A., Bond, W.W., and Petersen, N.J. (1971) Pseudomonas aeruginosa: growth in distilled water from hospitals. Science 173: 836-838. Figurski, D.H., and Helinski, D.R. (1979) Replication of an origin-containing derivative of plasmid RK2 dependent on a plasmid function provided in trans. Proc Natl Acad Sci U S A 76: 1648-1652. 139

REFERENCES Fletcher, M.P., Diggle, S.P., Cámara, M., and Williams, P. (2007) Biosensor-based assays for PQS, HHQ and related 2-alkyl-4-quinolone quorum sensing signal molecules. Nat Protoc 2: 1254-1262. Folders, J., Tommassen, J., van Loon, L.C., and Bitter, W. (2000) Identification of a chitin-binding protein secreted by Pseudomonas aeruginosa. J Bacteriol 182: 1257-1263. Folders, J., Algra, J., Roelofs, M.S., van Loon, L.C., Tommassen, J., and Bitter, W. (2001) Characterization of Pseudomonas aeruginosa chitinase, a gradually secreted protein. J Bacteriol 183: 7044-7052. Fujita, M., Tanaka, K., Takahashi, H., and Amemura, A. (1994) Transcription of the principal sigma-factor genes, rpoD and rpoS, in Pseudomonas aeruginosa is controlled according to the growth phase. Mol Microbiol 13: 1071-1077. Fuqua, C., Winans, S.C., and Greenberg, E.P. (1996) Census and consensus in bacterial ecosystems: the LuxR-LuxI family of quorum-sensing transcriptional regulators. Annu Rev Microbiol 50: 727-751. Fuqua, C., Parsek, M.R., and Greenberg, E.P. (2001) Regulation of gene expression by cell-to-cell communication: acyl-homoserine lactone quorum sensing. Annu Rev Genet 35: 439-468. Gallagher, L.A., McKnight, S.L., Kuznetsova, M.S., Pesci, E.C., and Manoil, C. (2002) Functions required for extracellular quinolone signalling by Pseudomonas aeruginosa. J Bacteriol 184: 6472-6480. Gambello, M.J., and Iglewski, B.H. (1991) Cloning and characterization of the Pseudomonas aeruginosa lasR gene, a transcriptional activator of elastase expression. J Bacteriol 173: 3000-3009. Gambello, M.J., Kaye, S., and Iglewski, B.H. (1993) LasR of Pseudomonas aeruginosa is a transcriptional activator of the alkaline protease gene (apr) and an enhancer of exotoxin A expression. Infect Immun 61: 1180-1184. Gamper, M., Zimmermann, A., and Haas, D. (1991) Anaerobic regulation of transcription initiation in the arcDABC operon of Pseudomonas aeruginosa. J Bacteriol 173: 4742-4750. Gang, R.K., Bang, R.L., Sanyal, S.C., Mokaddas, E., and Lari, A.R. (1999) Pseudomonas aeruginosa septicaemia in burns. Burns 25: 611-616. Gesellschaft Deutscher Chemiker (GDCH) (1996) German Standard Methods for the Laboratory Examination of Waste, Waste Water and Sludge: VCH, Weinheim. Ghysels, B., Dieu, B.T.M., Beatson, S.A., Pirnay, J.-P., Ochsner, U.A., Vasil, M.L., and Cornelis, P. (2004) FpvB, an alternative type I ferripyoverdine receptor of Pseudomonas aeruginosa. Microbiology 150: 1671-1680. Gibson, J., Sood, A., and Hogan, D.A. (2009) Pseudomonas aeruginosa-Candida albicans interactions: localization and fungal toxicity of a phenazine derivative. Appl Environ Microbiol 75: 504-513. Glöckner, F.O., Fuchs, B.M., and Amann, R. (1999) Bacterioplankton compositions of lakes and oceans: a first comparison based on fluorescence in situ hybridization. Appl Environ Microbiol 65: 3721-3726. Gooday, G.W. (1990) The Ecology of chitin degradation. Adv Microb Ecol 11: 387430. 140

REFERENCES von Graevenitz, A. (1987) Research on Aeromonas and Plesiomonas. Experentia 43: 347-472. Haba, E., Pinazo, A., Jauregui, O., Espuny, M.J., Infante, M.R., and Manresa, A. (2003) Physicochemical characterization and antimicrobial properties of rhamnolipids produced by Pseudomonas aeruginosa 47T2 NCBIM 40044. Biotechnol Bioeng 81: 316-322. Hardalo, C., and Edberg, S.C. (1997) Pseudomonas aeruginosa: assessment of risk from drinking water. Crit Rev Microbiol 23: 47-75. Haruta, S., Kato, S., Yamamoto, K., and Igarashi, Y. (2009) Intertwined interspecies relationships: approaches to untangle the microbial network. Environ Microbiol 11: 2963-2969. Hassan, H.M., and Fridovich, I. (1980) Mechanism of the antibiotic action pyocyanine. J Bacteriol 141: 156-163. Hassett, D.J., Charniga, L., Bean, K., Ohman, D.E., and Cohen, M.S. (1992) Response of Pseudomonas aeruginosa to pyocyanin: mechanisms of resistance, antioxidant defenses, and demonstration of a manganese-cofactored superoxide dismutase. Infect Immun 60: 328-336. Hassett, D.J., Schweizer, H.P., and Ohman, D.E. (1995) Pseudomonas aeruginosa sodA and sodB mutants defective in manganese- and iron-cofactored superoxide dismutase activity demonstrate the importance of the iron-cofactored form in aerobic metabolism. J Bacteriol 177: 6330-6337. Hausladen, A., and Fridovich, I. (1996) Measuring nitric oxide and superoxide: rate constants for aconitase reactivity. Methods Enzymol 269: 37-41. Heath, H.E., and Gaudy, E.T. (1978) Relationship between catabolism of glycerol and metabolism of hexosephosphate derivatives by Pseudomonas aeruginosa. J Bacteriol 136: 638-646. Heeb, S., Fletcher, M.P., Chhabra, S.R., Diggle, S.P., Williams, P., and Cámara, M. (2011) Quinolones: from antibiotics to autoinducers. FEMS Microbiol Rev 35: 247-274. Hentzer, M., Eberl, L., Nielsen, J., and Givskov, M. (2003) Quorum sensing : a novel target for the treatment of biofilm infections. BioDrugs 17: 241-250. Heurlier, K., Dénervaud, V., Pessi, G., Reimmann, C., and Haas, D. (2003) Negative control of quorum sensing by RpoN (sigma54) in Pseudomonas aeruginosa PAO1. J Bacteriol 185: 2227-2235. Hibbing, M.E., Fuqua, C., Parsek, M.R., and Peterson, S.B. (2010) Bacterial competition: surviving and thriving in the microbial jungle. Nat Rev Microbiol 8: 15-25. Hilbi, H., Weber, S.S., Ragaz, C., Nyfeler, Y., and Urwyler, S. (2007) Environmental predators as models for bacterial pathogenesis. Environ Microbiol 9: 563-575. Ho, S.N., Hunt, H.D., Horton, R.M., Pullen, J.K., and Pease, L.R. (1989) Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 77: 51-59.

141

REFERENCES Hoang, T.T., Karkhoff-Schweizer, R.R., Kutchma, A.J., and Schweizer, H.P. (1998) A broad-host-range Flp-FRT recombination system for site-specific excision of chromosomally-located DNA sequences: application for isolation of unmarked Pseudomonas aeruginosa mutants. Gene 212: 77-86. Hoben, H.J., and Somasegaran, P. (1982) Comparison of the Pour, Spread, and Drop Plate Methods for enumeration of Rhizobium spp. in inoculants made from presterilized peat. Appl Environ Microbiol 44: 1246-1247. Hoffman, L.R., Déziel, E., D'Argenio, D.A., Lépine, F., Emerson, J., McNamara, S. et al. (2006) Selection for Staphylococcus aureus small-colony variants due to growth in the presence of Pseudomonas aeruginosa. Proc Natl Acad Sci U S A 103: 19890-19895. Hoffman, L.R., Kulasekara, H.D., Emerson, J., Houston, L.S., Burns, J.L., Ramsey, B.W., and Miller, S.I. (2009) Pseudomonas aeruginosa lasR mutants are associated with cystic fibrosis lung disease progression. J Cyst Fibros 8: 66-70. Hogan, D.A., and Kolter, R. (2002) Pseudomonas-Candida interactions: an ecological role for virulence factors. Science 296: 2229-2232. Hogan, D.A., Vik, A., and Kolter, R. (2004) A Pseudomonas aeruginosa quorumsensing molecule influences Candida albicans morphology. Mol Microbiol 54: 1212-1223. Hohnadel, D., Haas, D., and Meyer, J.-M. (1986) Mapping of mutations affecting pyoverdine production in Pseudomonas aeruginosa. FEMS Microbiol Lett 36: 195-199. Honma, H., Asano, R., Obara, M., Otawa, K., Suyama, Y., and Nakai, Y. (2009) Bacterial populations in epilithic biofilms along two oligotrophic rivers in the Tohoku region in Japan. J Gen Appl Microbiol 55: 359-371. Hooper, L.V., Bry, L., Falk, P.G., and Gordon, J.I. (1998) Host-microbial symbiosis in the mammalian intestine: exploring an internal ecosystem. Bioessays 20: 336343. Hoskisson, P.A., and Hobbs, G. (2005) Continuous culture-making a comeback? Microbiology 151: 3153-3159. Hutchinson, G.E. (1978) An introduction to population ecology: Yale University Press. Imlay, J.A. (2003) Pathways of oxidative damage. Annu Rev Microbiol 57: 395-418. Itoh, Y. (1997) Cloning and characterization of the aru genes encoding enzymes of the catabolic arginine succinyltransferase pathway in Pseudomonas aeruginosa. J Bacteriol 179: 7280-7290. Iwamoto, R., and Imanaga, Y. (1991) Direct evidence of the Entner-Doudoroff pathway operating in the metabolism of D-glucosamine in bacteria. J Biochem 109: 66-69. Jagmann, N., Brachvogel, H.-P., and Philipp, B. (2010) Parasitic growth of Pseudomonas aeruginosa in co-culture with the chitinolytic bacterium Aeromonas hydrophila. Environ Microbiol 12: 1787-1802. Janda, J.M. (1985) Biochemical and exoenzymatic properties of Aeromonas species. Diagn Microbiol Infect Dis 3: 223-232.

142

REFERENCES Jander, G., Rahme, L.G., and Ausubel, F.M. (2000) Positive correlation between virulence of Pseudomonas aeruginosa mutants in mice and insects. J Bacteriol 182: 3843-3845. Jayaraman, A., and Wood, T.K. (2008) Bacterial quorum sensing: signals, circuits, and implications for biofilms and disease. Annu Rev Biomed Eng 10: 145-167. Jensen, V., Löns, D., Zaoui, C., Bredenbruch, F., Meissner, A., Dieterich, G. et al. (2006) RhlR expression in Pseudomonas aeruginosa is modulated by the Pseudomonas quinolone signal via PhoB-dependent and -independent pathways. J Bacteriol 188: 8601-8606. Jessup, C.M., Kassen, R., Forde, S.E., Kerr, B., Buckling, A., Rainey, P.B., and Bohannan, B.J.M. (2004) Big questions, small worlds: microbial model systems in ecology. Trends Ecol Evol 19: 189-197. Jimenez, P.N., Koch, G., Thompson, J.A., Xavier, K.B., Cool, R.H., and Quax, W.J. (2012) The Multiple Signaling Systems Regulating Virulence in Pseudomonas aeruginosa. Microbiol Mol Biol Rev 76: 46-65. Jones, S., Yu, B., Bainton, N.J., Birdsall, M., Bycroft, B.W., Chhabra, S.R. et al. (1993) The lux autoinducer regulates the production of exoenzyme virulence determinants in Erwinia carotovora and Pseudomonas aeruginosa. EMBO J 12: 2477-2482. Jones, A.M., Dodd, M.E., Morris, J., Doherty, C., Govan, J.R.W., and Webb, A.K. (2010) Clinical outcome for cystic fibrosis patients infected with transmissible Pseudomonas aeruginosa: an 8-year prospective study. Chest 137: 1405-1409. Juhas, M., Eberl, L., and Tümmler, B. (2005) Quorum sensing: the power of cooperation in the world of Pseudomonas. Environ Microbiol 7: 459-471. Kato, T., Hinoo, H., Shoji, J., Matsumoto, K., Tanimoto, T., Hattori, T., Hirooka, K., and Kondo, E. (1987)a PB-5266 A, B and C, new monobactams. I. Taxonomy, fermentation and isolation. J Antibiot (Tokyo) 40: 135-138. Kato, T., Hinoo, H., Terui, Y., Nishikawa, J., Nakagawa, Y., Ikenishi, Y., and Shoji, J. (1987)b PB-5266 A, B and C, new monobactams. II. Physico-chemical properties and chemical structures. J Antibiot (Tokyo) 40: 139-144. Kay, E., Humair, B., Dénervaud, V., Riedel, K., Spahr, S., Eberl, L. et al. (2006) Two GacA-dependent small RNAs modulate the quorum-sensing response in Pseudomonas aeruginosa. J Bacteriol 188: 6026-6033. Keller, L., and Surette, M.G. (2006) Communication in bacteria: an ecological and evolutionary perspective. Nat Rev Microbiol 4: 249-258. Kesberg, A.I. (2011) Characterization of the Bacterioplankton Community Composition in Lake Constance. Master thesis, University of Konstanz. Keyhani, N.O., and Roseman, S. (1999) Physiological aspects of chitin catabolism in marine bacteria. Biochim Biophys Acta 1473: 108-122. Kim, E.-J., Wang, W., Deckwer, W.-D., and Zeng, A.-P. (2005) Expression of the quorum-sensing regulatory protein LasR is strongly affected by iron and oxygen concentrations in cultures of Pseudomonas aeruginosa irrespective of cell density. Microbiology 151: 1127-1138. Kirchman, D.L. (2002) The ecology of Cytophaga-Flavobacteria in aquatic environments. FEMS Microbiol Ecol 39: 91-100. 143

REFERENCES

Klebensberger, J., Rui, O., Fritz, E., Schink, B., and Philipp, B. (2006) Cell aggregation of Pseudomonas aeruginosa strain PAO1 as an energy-dependent stress response during growth with sodium dodecyl sulfate. Arch Microbiol 185: 417-427. Klebensberger, J., Lautenschlager, K., Bressler, D., Wingender, J., and Philipp, B. (2007) Detergent-induced cell aggregation in subpopulations of Pseudomonas aeruginosa as a preadaptive survival strategy. Environ Microbiol 9: 2247-2259. Klebensberger, J., Birkenmaier, A., Geffers, R., Kjelleberg, S., and Philipp, B. (2009) SiaA and SiaD are essential for inducing autoaggregation as a specific response to detergent stress in Pseudomonas aeruginosa. Environ Microbiol 11: 30733086. van der Kooij, D., Oranje, J.P., and Hijnen, W.A. (1982) Growth of Pseudomonas aeruginosa in tap water in relation to utilization of substrates at concentrations of a few micrograms per liter. Appl Environ Microbiol 44: 1086-1095. Korgaonkar, A.K., and Whiteley, M. (2011) Pseudomonas aeruginosa enhances production of an antimicrobial in response to N-acetylglucosamine and peptidoglycan. J Bacteriol 193: 909-917. Koval, S.F., and Bayer, M.E. (1997) Bacterial capsules: no barrier against Bdellovibrio. Microbiology 143: 749-753. Kulasakara, H., Lee, V., Brencic, A., Liberati, N., Urbach, J., Miyata, S. et al. (2006) Analysis of Pseudomonas aeruginosa diguanylate cyclases and phosphodiesterases reveals a role for bis-(3'-5')-cyclic-GMP in virulence. Proc Natl Acad Sci U S A 103: 2839-2844. Kwon, Y.M., and Ricke, S.C. (2000) Efficient amplification of multiple transposonflanking sequences. J Microbiol Methods 41: 195-199. Lan, X., Zhang, X., Kodaira, R., Zhou, Z., and Shimosaka, M. (2008) Gene cloning, expression, and characterization of a second beta-N-acetylglucosaminidase from the chitinolytic bacterium Aeromonas hydrophila strain SUWA-9. Biosci Biotechnol Biochem 72: 492-498. Latifi, A., Foglino, M., Tanaka, K., Williams, P., and Lazdunski, A. (1996) A hierarchical quorum-sensing cascade in Pseudomonas aeruginosa links the transcriptional activators LasR and RhIR (VsmR) to expression of the stationaryphase sigma factor RpoS. Mol Microbiol 21: 1137-1146. Lau, G.W., Hassett, D.J., Ran, H., and Kong, F. (2004) The role of pyocyanin in Pseudomonas aeruginosa infection. Trends Mol Med 10: 599-606. Lazazzera, B.A. (2005) Lessons from DNA microarray analysis: the gene expression profile of biofilms. Curr Opin Microbiol 8: 222-227. Ledgham, F., Ventre, I., Soscia, C., Foglino, M., Sturgis, J.N., and Lazdunski, A. (2003) Interactions of the quorum sensing regulator QscR: interaction with itself and the other regulators of Pseudomonas aeruginosa LasR and RhlR. Mol Microbiol 48: 199-210. Lemarchand, C., Jardillier, L., Carrias, J.-F., Richardot, M., Debroas, D., SimeNgando, T., and Amblard, C. (2006) Community composition and activity of

144

REFERENCES prokaryotes associated to detrital particles in two contrasting lake ecosystems. FEMS Microbiol Ecol 57: 442-451. Lequette, Y., Lee, J.-H., Ledgham, F., Lazdunski, A., and Greenberg, E.P. (2006) A distinct QscR regulon in the Pseudomonas aeruginosa quorum-sensing circuit. J Bacteriol 188: 3365-3370. Lessie, T.G., and Phibbs, P.V. (1984) Alternative pathways of carbohydrate utilization in pseudomonads. Annu Rev Microbiol 38: 359-388. Li, Q., Xiao, X., and Wang, F. (2007) Screening of genes involved in chitinase production in Aeromonas caviae CB101 via transposon mutagenesis. J Appl Microbiol 102: 640-649. Lindsey, T.L., Hagins, J.M., Sokol, P.A., and Silo-Suh, L.A. (2008) Virulence determinants from a cystic fibrosis isolate of Pseudomonas aeruginosa include isocitrate lyase. Microbiology 154: 1616-1627. Loomis, W.F., and Magasanik, B. (1967) Glucose-lactose diauxie in Escherichia coli. J Bacteriol 93: 1397-1401. Lynch, M.J., Swift, S., Kirke, D.F., Keevil, C.W., Dodd, C.E.R., and Williams, P. (2002) The regulation of biofilm development by quorum sensing in Aeromonas hydrophila. Environ Microbiol 4: 18-28. Lynd, L.R., Weimer, P.J., van Zyl, W.H., and Pretorius, I.S. (2002) Microbial cellulose utilization: fundamentals and biotechnology. Microbiol Mol Biol Rev 66: 506-577. Malone, J.G., Jaeger, T., Spangler, C., Ritz, D., Spang, A., Arrieumerlou, C. et al. (2010) YfiBNR mediates cyclic di-GMP dependent small colony variant formation and persistence in Pseudomonas aeruginosa. PLoS Pathog 6: e1000804. Manos, J., Arthur, J., Rose, B., Bell, S., Tingpej, P., Hu, H. et al. (2009) Gene expression characteristics of a cystic fibrosis epidemic strain of Pseudomonas aeruginosa during biofilm and planktonic growth. FEMS Microbiol Lett 292: 107114. Mashburn, L.M., Jett, A.M., Akins, D.R., and Whiteley, M. (2005) Staphylococcus aureus serves as an iron source for Pseudomonas aeruginosa during in vivo coculture. J Bacteriol 187: 554-566. Martens, E.C., Koropatkin, N.M., Smith, T.J., and Gordon, J.I. (2009) Complex glycan catabolism by the human gut microbiota: the Bacteroidetes Sus-like paradigm. J Biol Chem 284: 24673-24677. Mathee, K., McPherson, C.J., and Ohman, D.E. (1997) Posttranslational control of the algT (algU)-encoded sigma22 for expression of the alginate regulon in Pseudomonas aeruginosa and localization of its antagonist proteins MucA and MucB (AlgN). J Bacteriol 179: 3711-3720. Mavrodi, D.V., Bonsall, R.F., Delaney, S.M., Soule, M.J., Phillips, G., and Thomashow, L.S. (2001) Functional analysis of genes for biosynthesis of pyocyanin and phenazine-1-carboxamide from Pseudomonas aeruginosa PAO1. J Bacteriol 183: 6454-6465. McBride, M.J., Xie, G., Martens, E.C., Lapidus, A., Henrissat, B., Rhodes, R.G. et al. (2009) Novel features of the polysaccharide-digesting gliding bacterium

145

REFERENCES Flavobacterium johnsoniae as revealed by genome sequence analysis. Appl Environ Microbiol 75: 6864-6875. McCully, V., Burns, G., and Sokatch, J.R. (1986) Resolution of branched-chain oxo acid dehydrogenase complex of Pseudomonas aeruginosa PAO. Biochem J 233: 737-742. McGrath, S., Wade, D.S., and Pesci, E.C. (2004) Dueling quorum sensing systems in Pseudomonas aeruginosa control the production of the Pseudomonas quinolone signal (PQS). FEMS Microbiol Lett 230: 27-34. McInerney, M.J., Struchtemeyer, C.G., Sieber, J., Mouttaki, H., Stams, A.J.M., Schink, B. et al. (2008) Physiology, ecology, phylogeny, and genomics of microorganisms capable of syntrophic metabolism. Ann N Y Acad Sci 1125: 5872. Meibom, K.L., Li, X.B., Nielsen, A.T., Wu, C.-Y., Roseman, S., and Schoolnik, G.K. (2004) The Vibrio cholerae chitin utilization program. Proc Natl Acad Sci U S A 101: 2524-2529. Mena, K.D., and Gerba, C.P. (2009) Risk assessment of Pseudomonas aeruginosa in water. Rev Environ Contam Toxicol 201: 71-115. Miller, J.H. (1972) Experiments in molecular genetics: Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. Morales, D.K., Jacobs, N.J., Rajamani, S., Krishnamurthy, M., Cubillos-Ruiz, J.R., and Hogan, D.A. (2010) Antifungal mechanisms by which a novel Pseudomonas aeruginosa phenazine toxin kills Candida albicans in biofilms. Mol Microbiol 78: 1379-1392. Nakada, Y., and Itoh, Y. (2002) Characterization and regulation of the gbuA gene, encoding guanidinobutyrase in the arginine dehydrogenase pathway of Pseudomonas aeruginosa PAO1. J Bacteriol 184: 3377-3384. Nakada, Y., and Itoh, Y. (2003) Identification of the putrescine biosynthetic genes in Pseudomonas aeruginosa and characterization of agmatine deiminase and Ncarbamoylputrescine amidohydrolase of the arginine decarboxylase pathway. Microbiology 149: 707-714. Namdari, H., and Cabelli, V.J. (1990) Glucose-mediated catabolite repression of the tricarboxylic acid cycle as an explanation for increased acetic acid production in suicidal Aeromonas strains. J Bacteriol 172: 4721-4724. Nealson, K.H., Platt, T., and Hastings, J.W. (1970) Cellular control of the synthesis and activity of the bacterial luminescent system. J Bacteriol 104: 313-322. Nealson, K.H., and Hastings, J.W. (1991) The luminous bacteria. In The Prokaryotes, a handbook on the biology of bacteria: ecophysiology, isolation, identification, applications. Balows, A., Truper, H.G., Dworkin, M., Harder, W., and Schleifer, K.H. (eds): Springer, Berlin Heidelberg New York, pp. 625-639. Nishijyo, T., Park, S.M., Lu, C.D., Itoh, Y., and Abdelal, A.T. (1998) Molecular characterization and regulation of an operon encoding a system for transport of arginine and ornithine and the ArgR regulatory protein in Pseudomonas aeruginosa. J Bacteriol 180: 5559-5566.

146

REFERENCES Nocker, A., Lepo, J.E., and Snyder, R.A. (2004) Influence of an oyster reef on development of the microbial heterotrophic community of an estuarine biofilm. Appl Environ Microbiol 70: 6834-6845. Norman, R.S., Moeller, P., McDonald, T.J., and Morris, P.J. (2004) Effect of pyocyanin on a crude-oil-degrading microbial community. Appl Environ Microbiol 70: 4004-4011. Nouwens, A.S., Beatson, S.A., Whitchurch, C.B., Walsh, B.J., Schweizer, H.P., Mattick, J.S., and Cordwell, S.J. (2003) Proteome analysis of extracellular proteins regulated by the las and rhl quorum sensing systems in Pseudomonas aeruginosa PAO1. Microbiology 149: 1311-1322. Ochsner, U.A., Koch, A.K., Fiechter, A., and Reiser, J. (1994) Isolation and characterization of a regulatory gene affecting rhamnolipid biosurfactant synthesis in Pseudomonas aeruginosa. J Bacteriol 176: 2044-2054. Ohman, D.E., Cryz, S.J., and Iglewski, B.H. (1980) Isolation and characterization of Pseudomonas aeruginosa PAO mutant that produces altered elastase. J Bacteriol 142: 836-842. Ohno, M., Okano, I., Watsuji, T., Kakinuma, T., Ueda, K., and Beppu, T. (1999) Establishing the independent culture of a strictly symbiotic bacterium Symbiobacterium thermophilum from its supporting Bacillus strain. Biosci Biotechnol Biochem 63: 1083-1090. O'Malley, Y.Q., Abdalla, M.Y., McCormick, M.L., Reszka, K.J., Denning, G.M., and Britigan, B.E. (2003) Subcellular localization of Pseudomonas pyocyanin cytotoxicity in human lung epithelial cells. Am J Physiol Lung Cell Mol Physiol 284: L420-L430. Palmer, K.L., Mashburn, L.M., Singh, P.K., and Whiteley, M. (2005) Cystic fibrosis sputum supports growth and cues key aspects of Pseudomonas aeruginosa physiology. J Bacteriol 187: 5267-5277. Pavlostathis, S.G., Miller, T.L., and Wolin, M.J. (1988) Fermentation of Insoluble Cellulose by Continuous Cultures of Ruminococcus albus. Appl Environ Microbiol 54: 2655-2659. Pearson, J.P. (2002) Early activation of quorum sensing. J Bacteriol 184: 2569-2571. Pellet, S., Bigley, D.V., and Grimes, D.J. (1983) Distribution of Pseudomonas aeruginosa in a riverine exosystem. Appl environ microbiol 45(1): 328-332. Peri, K.G., and Waygood, E.B. (1988) Sequence of cloned enzyme IINacetylglucosamine of the phosphoenolpyruvate:N-acetylglucosamine phosphotransferase system of Escherichia coli. Biochemistry 27: 6054-6061. Pesci, E.C., Pearson, J.P., Seed, P.C., and Iglewski, B.H. (1997) Regulation of las and rhl quorum sensing in Pseudomonas aeruginosa. J Bacteriol 179: 31273132. Philipp, B., and Schink, B. (1998) Evidence of two oxidative reaction steps initiating anaerobic degradation of resorcinol (1,3-dihydroxybenzene) by the denitrifying bacterium Azoarcus anaerobius. J Bacteriol 180: 3644-3649. Pinzon, N.M., and Ju, L.-K. (2009) Analysis of rhamnolipid biosurfactants by methylene blue complexation. Appl Microbiol Biotechnol 82: 975-981.

147

REFERENCES Price-Whelan, A., Dietrich, L.E.P., and Newman, D.K. (2006) Rethinking 'secondary' metabolism: physiological roles for phenazine antibiotics. Nat Chem Biol 2: 7178. Pruzzo, C., Vezzulli, L., and Colwell, R.R. (2008) Global impact of Vibrio cholerae interactions with chitin. Environ Microbiol 10: 1400-1410. Rahme, L.G., Stevens, E.J., Wolfort, S.F., Shao, J., Tompkins, R.G., and Ausubel, F.M. (1995) Common virulence factors for bacterial pathogenicity in plants and animals. Science 268: 1899-1902. Rahme, L.G., Tan, M.W., Le, L., Wong, S.M., Tompkins, R.G., Calderwood, S.B., and Ausubel, F.M. (1997) Use of model plant hosts to identify Pseudomonas aeruginosa virulence factors. Proc Natl Acad Sci U S A 94: 13245-13250. Ramana, K.V., and Karanth, N.G. (1989) Factors affecting biosurfactant production using Pseudomonas aeruginosa CFTR-6 under submerged conditions. J Chem Tech Biotechnol 45: 249-257. Rampioni, G., Pustelny, C., Fletcher, M.P., Wright, V.J., Bruce, M., Rumbaugh, K.P. et al. (2010) Transcriptomic analysis reveals a global alkyl-quinoloneindependent regulatory role for PqsE in facilitating the environmental adaptation of Pseudomonas aeruginosa to plant and animal hosts. Environ Microbiol 12: 1659-1673. Rath, J., and Herndl, G.J. (1994) Characteristics and Diversity of beta-d-Glucosidase (EC 3.2.1.21) Activity in Marine Snow. Appl Environ Microbiol 60: 807-813. Reichenbach, H., Kohl, W., Böttger-Vetter, A., and Achenbach, H. (1980) FlexirubinType Pigments in Flavobacterium. Arch Microbiol 126: 291-293. Reichenbach, H. (2006) The genus Lysobacter. In The Prokaryotes. Dworkin, M., Falkow, S., Rosenberg, E., Schleifer, K.H., and Stackebrandt, E. (eds), pp. 939957. Reimmann, C., Beyeler, M., Latifi, A., Winteler, H., Foglino, M., Lazdunski, A., and Haas, D. (1997) The global activator GacA of Pseudomonas aeruginosa PAO positively controls the production of the autoinducer N-butyryl-homoserine lactone and the formation of the virulence factors pyocyanin, cyanide, and lipase. Mol Microbiol 24: 309-319. Reizer, J., Reizer, A., Lagrou, M.J., Folger, K.R., Stover, C.K., and Saier, M.H. (1999) Novel phosphotransferase systems revealed by bacterial genome analysis: the complete repertoire of pts genes in Pseudomonas aeruginosa. J Mol Microbiol Biotechnol 1: 289-293. Riedel, K., Hentzer, M., Geisenberger, O., Huber, B., Steidle, A., Wu, H. et al. (2001) N-acylhomoserine-lactone-mediated communication between Pseudomonas aeruginosa and Burkholderia cepacia in mixed biofilms. Microbiology 147: 32493262. Ringen, L.M., and Drake, C.H. (1952) A study of the incidence of Pseudomonas aeruginosa from various natural sources. J Bacteriol 64: 841-845. Robertson, J.G., Wells, B., Brewin, N.J., Wood, E., Knight, C.D., and Downie, J.A. (1985) The legume-Rhizobium symbiosis: a cell surface interaction. J Cell Sci Suppl 2: 317-331.

148

REFERENCES Rojo, F. (2010) Carbon catabolite repression in Pseudomonas : optimizing metabolic versatility and interactions with the environment. FEMS Microbiol Rev 34: 658684. Römling, U., Wingender, J., Müller, H., and Tümmler, B. (1994) A major Pseudomonas aeruginosa clone common to patients and aquatic habitats. Appl Environ Microbiol 60: 1734-1738. Romero, M., Avendaño-Herrera, R., Magariños, B., Cámara, M., and Otero, A. (2010) Acylhomoserine lactone production and degradation by the fish pathogen Tenacibaculum maritimum, a member of the Cytophaga-FlavobacteriumBacteroides (CFB) group. FEMS Microbiol Lett 304: 131-139. Rumbaugh, K.P., Diggle, S.P., Watters, C.M., Ross-Gillespie, A., Griffin, A.S., and West, S.A. (2009) Quorum sensing and the social evolution of bacterial virulence. Curr Biol 19: 341-345. Rusznyák, A., Szabó, G., Pollák, B., Vágány, V., and Palatinszky, M. (2007) Diversity of reed (Phragmites australis) stem biofilm bacterial communities in two Hungarian soda lakes. Acta Microbiol Immunol Hung 54: 339-352. Ryan, R.P., and Dow, J.M. (2008) Diffusible signals and interspecies communication in bacteria. Microbiology 154: 1845-1858. Sambrook, J., and Russell, D.W. (2001) Molecular Cloning: A Laboratory Manual: Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. Sappington, K.J., Dandekar, A.A., Oinuma, K.-I., and Greenberg, E.P. (2011) Reversible signal binding by the Pseudomonas aeruginosa quorum-sensing signal receptor LasR. MBio 2: e00011-e00011. Sawyer, M.H., Baumann, P., Baumann, L., Berman, S.M., Cánovas, J.L., and Berman, R.H. (1977) Pathways of D-fructose catabolism in species of Pseudomonas. Arch Microbiol 112: 49-55. Schuster, M., Lostroh, C.P., Ogi, T., and Greenberg, E.P. (2003) Identification, timing, and signal specificity of Pseudomonas aeruginosa quorum-controlled genes: a transcriptome analysis. J Bacteriol 185: 2066-2079. Schuster, M., Hawkins, A.C., Harwood, C.S., and Greenberg, E.P. (2004) The Pseudomonas aeruginosa RpoS regulon and its relationship to quorum sensing. Mol Microbiol 51: 973-985. Schuster, M., and Greenberg, E.P. (2006) A network of networks: quorum-sensing gene regulation in Pseudomonas aeruginosa. Int J Med Microbiol 296: 73-81. Schuster, M., and Greenberg, E.P. (2007) Early activation of quorum sensing in Pseudomonas aeruginosa reveals the architecture of a complex regulon. BMC Genomics 8: 287. Seet, Q., and Zhang, L.-H. (2011) Anti-activator QslA defines the quorum sensing threshold and response in Pseudomonas aeruginosa. Mol Microbiol 80: 951965. Shimkets, L.J. (1990) Social and developmental biology of the myxobacteria. Microbiol Rev 54: 473-501. Siehnel, R., Traxler, B., An, D.D., Parsek, M.R., Schaefer, A.L., and Singh, P.K. (2010) A unique regulator controls the activation threshold of quorum-regulated genes in Pseudomonas aeruginosa. Proc Natl Acad Sci U S A 107: 7916-7921. 149

REFERENCES Simon, R., Priefer, U., and Pühler, A. (1983) A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in gram negative bacteria. Biotechnology 1: 784-791. Simon, M., Grossart, H.P., Schweitzer, B., and Ploug, H. (2002) Microbial ecology of organic aggregates in aquatic ecosystems. Aquat Microb Ecol 28: 175-211. Smith, E.E., Buckley, D.G., Wu, Z., Saenphimmachak, C., Hoffman, L.R., D'Argenio, D.A. et al. (2006) Genetic adaptation by Pseudomonas aeruginosa to the airways of cystic fibrosis patients. Proc Natl Acad Sci U S A 103: 8487-8492. Smits, T.H.M., Balada, S.B., Witholt, B., and van Beilen, J.B. (2002) Functional analysis of alkane hydroxylases from gram-negative and gram-positive bacteria. J Bacteriol 184: 1733-1742. Sonnleitner, E., Abdou, L., and Haas, D. (2009) Small RNA as global regulator of carbon catabolite repression in Pseudomonas aeruginosa. Proc Natl Acad Sci U S A 106: 21866-21871. Sonnleitner, E., and Haas, D. (2011) Small RNAs as regulators of primary and secondary metabolism in Pseudomonas species. Appl Microbiol Biotechnol 91: 63-79. Stoodley, P., Sauer, K., Davies, D.G., and Costerton, J.W. (2002) Biofilms as complex differentiated communities. Annu Rev Microbiol 56: 187-209. Straight, P.D., and Kolter, R. (2009) Interspecies chemical communication in bacterial development. Annu Rev Microbiol 63: 99-118. Styp von Rekowski, K., Hempel, M., and Philipp, B. (2008) Quorum sensing by Nacylhomoserine lactones is not required for Aeromonas hydrophila during growth with organic particles in lake water microcosms. Arch Microbiol 189: 475482. Sundarraj, N., and Bhat, J.V. (1972) Breakdown of chitin by Cytophaga johnsonii. Arch Mikrobiol 85: 159-167. Svitil, A.L., and Kirchman, D.L. (1998) A chitin-binding domain in a marine bacterial chitinase and other microbial chitinases: implications for the ecology and evolution of 1,4-beta-glycanases. Microbiology 144 ( 5): 1299-1308. Swift, S., Karlyshev, A.V., Fish, L., Durant, E.L., Winson, M.K., Chhabra, S.R. et al. (1997) Quorum sensing in Aeromonas hydrophila and Aeromonas salmonicida: identification of the LuxRI homologs AhyRI and AsaRI and their cognate Nacylhomoserine lactone signal molecules. J Bacteriol 179: 5271-5281. Swift, S., Lynch, M.J., Fish, L., Kirke, D.F., Tomás, J.M., Stewart, G.S., and Williams, P. (1999) Quorum sensing-dependent regulation and blockade of exoprotease production in Aeromonas hydrophila. Infect Immun 67: 5192-5199. Tait, K., Joint, I., Daykin, M., Milton, D.L., Williams, P., and Cámara, M. (2005) Disruption of quorum sensing in seawater abolishes attraction of zoospores of the green alga Ulva to bacterial biofilms. Environ Microbiol 7: 229-240. Takaya, A., Tabuchi, F., Tsuchiya, H., Isogai, E., and Yamamoto, T. (2008) Negative regulation of quorum-sensing systems in Pseudomonas aeruginosa by ATPdependent Lon protease. J Bacteriol 190: 4181-4188. Thoma, S., and Schobert, M. (2009) An improved Escherichia coli donor strain for diparental mating. FEMS Microbiol Lett 294: 127-132. 150

REFERENCES Thomas, S.R., Ray, A., Hodson, M.E., and Pitt, T.L. (2000) Increased sputum amino acid concentrations and auxotrophy of Pseudomonas aeruginosa in severe cystic fibrosis lung disease. Thorax 55: 795-797. Toder, D.S., Gambello, M.J., and Iglewski, B.H. (1991) Pseudomonas aeruginosa LasA: a second elastase under the transcriptional control of lasR. Mol Microbiol 5: 2003-2010. Tolker-Nielsen, T., and Molin, S. (2004) The biofilm lifestyle of Pseudomonads. In Pseudomonas. Ramos, J.L. (ed): Kluwer Academic/Plenum Publishers, New York, USA, pp. 547-571. Ueda, K., Yamashita, A., Ishikawa, J., Shimada, M., o Watsuji, T., Morimura, K. et al. (2004) Genome sequence of Symbiobacterium thermophilum, an uncultivable bacterium that depends on microbial commensalism. Nucleic Acids Res 32: 4937-4944. Unanue, Ayo, Agis, Slezak, Herndl, and Iriberri (1999) Ectoenzymatic Activity and Uptake of Monomers in Marine Bacterioplankton Described by a Biphasic Kinetic Model. Microb Ecol 37: 36-48. Vendeville, A., Winzer, K., Heurlier, K., Tang, C.M., and Hardie, K.R. (2005) Making 'sense' of metabolism: autoinducer-2, LuxS and pathogenic bacteria. Nat Rev Microbiol 3: 383-396. Verdugo, P., Alldredge, A.L., Azam, F., Kirchman, D.L., Passow, U., and Santschi, P.H. (2004) The oceanic gel phase: a bridge in the DOM-POM continuum. Mar Chem 92: 67-85. Vetter, and Deming (1999) Growth Rates of Marine Bacterial Isolates on Particulate Organic Substrates Solubilized by Freely Released Extracellular Enzymes. Microb Ecol 37: 86-94. Visca, P., Serino, L., and Orsi, N. (1992) Isolation and characterization of Pseudomonas aeruginosa mutants blocked in the synthesis of pyoverdin. J Bacteriol 174: 5727-5731. Wade, D.S., Calfee, M.W., Rocha, E.R., Ling, E.A., Engstrom, E., Coleman, J.P., and Pesci, E.C. (2005) Regulation of Pseudomonas quinolone signal synthesis in Pseudomonas aeruginosa. J Bacteriol 187: 4372-4380. Wagner, V.E., Bushnell, D., Passador, L., Brooks, A.I., and Iglewski, B.H. (2003) Microarray analysis of Pseudomonas aeruginosa quorum-sensing regulons: effects of growth phase and environment. J Bacteriol 185: 2080-2095. Wang, C.H., Stern, I.J., and Gilmour, C.M. (1959) The catabolism of glucose and gluconate in Pseudomonas species. Arch Biochem Biophys 81: 489-492. Wendisch, V.F., Spies, M., Reinscheid, D.J., Schnicke, S., Sahm, H., and Eikmanns, B.J. (1997) Regulation of acetate metabolism in Corynebacterium glutamicum: transcriptional control of the isocitrate lyase and malate synthase genes. Arch Microbiol 168: 262-269. West, S.A., Griffin, A.S., Gardner, A., and Diggle, S.P. (2006) Social evolution theory for microorganisms. Nat Rev Microbiol 4: 597-607. West, S.A., Diggle, S.P., Buckling, A., Gardner, A., and Griffin, A.S. (2007) The Social Life of Microbes. Annu Rev Ecol Evol Syst 38: 53-77.

151

REFERENCES Wetzel, R.G. (1991) Extracellular enzymatic interactions: storage, redistribution, and interspecific communication. In Microbial Enzymes in Aquatic Environments. Chróst, R.J. (ed): Springer, New York, pp. 6-28. Whiteley, M., Lee, K.M., and Greenberg, E.P. (1999) Identification of genes controlled by quorum sensing in Pseudomonas aeruginosa. Proc Natl Acad Sci U S A 96: 13904-13909. Whooley, M.A., and McLoughlin, A.J. (1982) The regulation of pyocyanin production in Pseudomonas aeruginosa. European J Appl Microbiol Biotechnol 15: 161166. Widdel, F., Kohring, G.W., and Mayer, F. (1983) Studies on dissimilatory sulfatereducing bacteria that decompose fatty acids. III. Characterization of the Filamentous Gliding Desulfonema limicola gen. nov. sp. nov., and Desulfonema magnum sp. nov. Arch Microbiol 134: 286-294. Wilder, C.N., Diggle, S.P., and Schuster, M. (2011) Cooperation and cheating in Pseudomonas aeruginosa: the roles of the las, rhl and pqs quorum-sensing systems. ISME J 5: 1332-1343. Williams, P. (2007) Quorum sensing, communication and cross-kingdom signalling in the bacterial world. Microbiology 153: 3923-3938. Williams, P., and Cámara, M. (2009) Quorum sensing and environmental adaptation in Pseudomonas aeruginosa: a tale of regulatory networks and multifunctional signal molecules. Curr Opin Microbiol 12: 182-191. Windgassen, M., Urban, A., and Jaeger, K.E. (2000) Rapid gene inactivation in Pseudomonas aeruginosa. FEMS Microbiol Lett 193: 201-205. Winson, M.K., Swift, S., Fish, L., Throup, J.P., Jørgensen, F., Chhabra, S.R. et al. (1998) Construction and analysis of luxCDABE-based plasmid sensors for investigating N-acyl homoserine lactone-mediated quorum sensing. FEMS Microbiol Lett 163: 185-192. Winzer, K., Falconer, C., Garber, N.C., Diggle, S.P., Camara, M., and Williams, P. (2000) The Pseudomonas aeruginosa lectins PA-IL and PA-IIL are controlled by quorum sensing and by RpoS. J Bacteriol 182: 6401-6411. Winzer, K., Hardie, K.R., Burgess, N., Doherty, N., Kirke, D., Holden, M.T.G. et al. (2002) LuxS: its role in central metabolism and the in vitro synthesis of 4hydroxy-5-methyl-3(2H)-furanone. Microbiology 148: 909-922. Wolff, J.A., MacGregor, C.H., Eisenberg, R.C., and Phibbs, P.V. (1991) Isolation and characterization of catabolite repression control mutants of Pseudomonas aeruginosa PAO. J Bacteriol 173: 4700-4706. Wolfgang, M.C., Lee, V.T., Gilmore, M.E., and Lory, S. (2003)a Coordinate regulation of bacterial virulence genes by a novel adenylate cyclase-dependent signaling pathway. Dev Cell 4: 253-263. Wolfgang, M.C., Kulasekara, B.R., Liang, X., Boyd, D., Wu, K., Yang, Q. et al. (2003)b Conservation of genome content and virulence determinants among clinical and environmental isolates of Pseudomonas aeruginosa. Proc Natl Acad Sci U S A 100: 8484-8489. Wortham, B.W., Patel, C.N., and Oliveira, M.A. (2007) Polyamines in bacteria: pleiotropic effects yet specific mechanisms. Adv Exp Med Biol 603: 106-115. 152

REFERENCES Xavier, K.B., and Bassler, B.L. (2003) LuxS quorum sensing: more than just a numbers game. Curr Opin Microbiol 6: 191-197. Xiao, G., Déziel, E., He, J., Lépine, F., Lesic, B., Castonguay, M.-H. et al. (2006) MvfR, a key Pseudomonas aeruginosa pathogenicity LTTR-class regulatory protein, has dual ligands. Mol Microbiol 62: 1689-1699. Xie, G., Bruce, D.C., Challacombe, J.F., Chertkov, O., Detter, J.C., Gilna, P. et al. (2007) Genome sequence of the cellulolytic gliding bacterium Cytophaga hutchinsonii. Appl Environ Microbiol 73: 3536-3546. Yang, Z., and Lu, C.-D. (2007) Functional genomics enables identification of genes of the arginine transaminase pathway in Pseudomonas aeruginosa. J Bacteriol 189: 3945-3953. Yanisch-Perron, C., Vieira, J., and Messing, J. (1985) Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33: 103-119. Yao, X., He, W., and Lu, C.-D. (2011) Functional characterization of seven γGlutamylpolyamine synthetase genes and the bauRABCD locus for polyamine and β-Alanine utilization in Pseudomonas aeruginosa PAO1. J Bacteriol 193: 3923-3930. Yates, E.A., Philipp, B., Buckley, C., Atkinson, S., Chhabra, S.R., Sockett, R.E. et al. (2002) N-acylhomoserine lactones undergo lactonolysis in a pH-, temperature-, and acyl chain length-dependent manner during growth of Yersinia pseudotuberculosis and Pseudomonas aeruginosa. Infect Immun 70: 56355646. Zaborin, A., Romanowski, K., Gerdes, S., Holbrook, C., Lepine, F., Long, J. et al. (2009) Red death in Caenorhabditis elegans caused by Pseudomonas aeruginosa PAO1. Proc Natl Acad Sci U S A 106: 6327-6332. Zeder, M., Peter, S., Shabarova, T., and Pernthaler, J. (2009) A small population of planktonic Flavobacteria with disproportionally high growth during the spring phytoplankton bloom in a prealpine lake. Environ Microbiol 11: 2676-2686. Zhu, J., and Winans, S.C. (2001) The quorum-sensing transcriptional regulator TraR requires its cognate signaling ligand for protein folding, protease resistance, and dimerization. Proc Natl Acad Sci U S A 98: 1507-1512. Zhu, X., Cai, J., Yang, J., and Su, Q. (2005) Determination of glucosamine in impure chitin samples by high-performance liquid chromatography. Carbohydr Res 340: 1732-1738.

153