Forensic DNA Fingerprinting (Week 1)
Instructions
Activity 1. Prediction of restriction enzyme-generated DNA fragments 1.
On the laptop provided for your group, open the web browser (Internet Explorer) and go to Google (http:// www.google.com).
2.
Search for Webcutter.
3.
Click on the first search result. It should be called Webcutter 2.0.
4.
Scroll down to the section where it says “There are three ways to input your sequence.”
5.
On the desktop of your laptop, there is a folder called DNA Fingerprinting Sequences. Inside this folder are five text files, one for each candidate. Each file contains the sequence for that sample.
6.
Click the Choose File button. A dialog box will open. Within the dialog box, navigate to the desktop, open the folder with the sequences, and select the file called candidate_1seq.txt. This is the first “candidate’s” sequence.
7.
When you click OK, you should see the file name show up:
8.
When the file name is listed next to the Choose File button, click the Upload Sequence File button.
9.
Scroll down a bit. You should see a series of choices as to how you want your sequence analyzed. Select your choices based on the figure on the next page.
Call this either Candidate 1 or the person’s name. The sequence will be placed here automatically.
Because our samples have been placed inside plasmids, make sure Circular sequence analysis is selected.
Select both EcoRI and PstI. Ask if you don’t know how to do this.
10. When you click Analyze sequence, you will be brought to a new page that displays the results. 11. Across the top of the page, you will see the sequence name and the total number of base pairs. 12. You will next see a graphical display of the sequence. Note that the restriction sites for both EcoRI and PstI are highlighted in bold. These are the sequences that are recognized by these enzymes and cut. 13. While the graphical display is more visually interesting (if you like to look at long stretches of text!), the more useful information is in the form of a table at the bottom of the page.
This table tells you how many times each enzyme cuts the DNA sequence, as well as the position of these cuts. The nucleotides in the sequence are numbered from 1 to X, depending on the length of the sequence. Because the plasmid is circular, the last nucleotide is joined to the first nucleotide like this:
…gtgagcgaggaagcggaagagcgcccaatacgcaaacc… …cactcgctccttcgccttctcgcgggttatgcgtttgg…
position #1 position #5000
When plasmids are numbered, the first base pair (#1) is in the 12:00 position on the diagram. The numbers proceed clockwise around the circle until the last base pair (#5000, in the case of Candidate 1), attaches to #1. 14. Use the data from the table to fill in one of the plasmid diagrams on the Plasmid Scratch Pad. Mark on the plasmids the approximate location of the cut, as well as the position number. We will do the first one together as a class. 15. Once you have finished with Candidate 1, you will repeat these steps with Candidates 2-5.
PLASMID SCRATCH PAD
______________________ (name)
______________________ (name)
________ bp
________ bp
______________________ (name) ________ bp
______________________ (name)
______________________ (name)
________ bp
________ bp
16. Now that you have performed your restriction enzyme analysis, you must predict the fragment sizes of your five plasmids. Use your data on the Plasmid Scratch Pad to fill in the data table on the Lab Report.
Activity 2. Use of the Micropipette Digital micropipettes are used to transfer small volumes of solutions from one place to another. Each micropipette has a specific volume range. These pipettes are expensive precision instruments and must be used with care. Their accuracy is dependent upon their proper use and reliable pipette tips. Please remember these four DON'TS when using a digital micropipette: •
Don't rotate the volume adjuster beyond the upper or lower range of the pipette.
•
Don't use a pipette without a tip in place. Doing so could ruin the precision piston that measures the volume of fluid.
•
Don't lay down or invert a pipette that has a filled tip. Fluid could run back into the piston.
•
Don't let the plunger snap back after withdrawing or ejecting fluid. Doing so could damage the piston.
Specific instructions for using a micropipette: Several brands of micropipettes exist. Although different brands may vary somewhat in construction and specific features, the basic operation of all micropipettes is similar. Read the following instructions carefully before using a micropipette. After you have done so, practice operating the pipette dry (without a sample), and then with a bit of distilled water. Once you are comfortable with basic micropipette operation, complete the practice exercises on the next page. 1.
Select a pipette that has a volume range that includes the volume you will use. Never use micropipettes for volumes beyond their intended range!
2.
Firmly press a new tip onto the pipette. Do not touch the tip with your hands.
3.
Adjust the pipette to the desired volume within the range of the pipette. (Be sure to locate the decimal point —a line—properly when reading the volume setting!) OUR models are adjusted using the plunger button that has a locking mechanism. You must press in the black tab while turning the plunger button. Ask your instructor if you need help with your micropipette.
4.
To draw liquid into the micropipette tip: a.
Depress the plunger button to the FIRST STOP (there are three) and hold in that position.
b.
Holding the micropipette nearly vertical, immerse the tip 1-3 mm into the liquid to be pipetted.
c.
Draw the fluid into the tip by SLOWLY letting the plunger button slide back. Wait 1-2 seconds to be sure that the full volume of sample is drawn into the tip.
d.
Slip the filled tip out, moving it along the inside of the vessel to dislodge excess liquid adhering to the outside of the tip. Before proceeding, check to be sure that liquid fills the tip and that no air is at the end of the tip. To avoid pipetting errors, learn to recognize the approximate level to which particular volumes fill the tip. If air is noted in the tip during intake, dispense the sample back into the reagent vessel, and repeat more slowly and evenly. If air is noted a second time, discard the tip and use a new one.
5.
To dispense the liquid: a.
Touch the tip near the bottom of whatever will be receiving the liquid (e.g., another tube).
b.
Slowly depress the control button to the FIRST STOP and wait 1-3 seconds; most of the liquid will be expelled.
c.
Press the control button to the SECOND STOP to blow out any residual liquid in the tip.
d.
To remove the pipette from the dispensing location, keep the button depressed and slide the tip along the inside of the vessel or the gel well. This prevents sucking liquid back into the tip.
e.
Eject the tip into a tip disposal container by pressing the control button to the THIRD STOP.
f.
Attach a new tip and proceed, or store the micropipette.
Practicing with the Micropipette 6.
Obtain a sheet of Parafilm.
7.
Place a fresh tip on the micropipettor.
8.
Practice making a line of six 50-µl drops of water on the Parafilm. As you become more experienced, you should find that the drops are of equal size.
Activity 3. Restriction Digestion of DNA Samples Upon careful observation, it is apparent that the only difference between the DNA of different individuals is the linear sequence of their base pairs. In the lab, your team will be given 6 DNA samples. Recall that your task is to determine if any of them came from the same individual or if they came from different individuals. Thus far you have learned the following: •
The similarities and differences between the DNA from different individuals.
•
How restriction enzymes cut (hydrolyze) DNA molecules.
•
How adding the same restriction enzymes to two samples of DNA might provide some clues about differences in their linear base pair sequence.
Now that you have a fairly clear understanding of these three items you are ready to proceed to the first phase of the DNA fingerprinting procedure—performing a restriction digest of your DNA samples.
Your Workstation Checklist. Make sure the materials listed below are present prior to beginning the lab. Material Needed EcoRI/PstI enzyme mix
Quantity 1 tube (80 µl)
Pipette tips, 10–100 µl
15 tips
Micropipette, 10–100 µl
1
Colored micro test tubes with DNA samples: green, blue, orange, violet, red, yellow Waste container
1
Foam micro test tube holder
1
Laboratory tape
1
(!)
" " " "
1
" " "
Procedure 1.
Using a new pipette tip for each sample, pipet 10 µl of the enzyme mix “ENZ” to each reaction tube as shown below. Gently pipet up and down carefully to mix well. Note: Change tips whenever you switch reagents, or, if the tip touches any of the liquid in one of the tubes accidentally. When in doubt, change the tip! DNA goes in the tube before the enzyme. Always add the enzyme last.
EOP
2.
C1
C2
C3
C4
C5
Now your DNA samples should contain:
DNA Samples 10 µl each
EcoRI/PstI Enzyme Mix
Total Reaction Volume
10
20
Marianne [C1]
10
20
Françoise [C2]
10
20
Astrid [C3]
10
20
Geneviève [C4]
10
20
Bernadette [C5]
10
20
E. O. Pennypincher [EOP]
3.
Mix the tube contents. Tightly cap on each tube. Mix the components by gently flicking the tubes with your finger. Tapping the tubes on the lab bench will also help to combine and mix the contents.
EOP C1
4.
C2
C3
C4
C5
Incubate the samples. Place the tubes in the foam micro tube holder and incubate them at 37°C for 45 min. After the incubation, store the DNA digests in the refrigerator until the next lab period.
