Journal of Agricultural Science and Technology A 3 (2013) 297-301 Earlier title: Journal of Agricultural Science and Technology, ISSN 1939-1250

D

DAVID

PUBLISHING

Genetic Biodiversity in Buffalo Population of Iraq Using Microsatellites Markers Talib Ahmed Jaayid1 and Maytham Abdulkadhim Dragh2 1. Animal Production Department, Agriculture College, University of Basrah (UoB), Basrah, Iraq 2. Animal Production Department, Science College, University of Maisan, Maisan, Iraq Received: January 22, 2013 / Published: April 20, 2013. Abstract: Genetic structure of Iraqi buffalo population, in the South, Middle and North area of the country was characterized, using six microsatellite markers (ETH152, ETH02, ETH225, CSSM060, BM1706 and INRA005). Seventy alleles were detected across the six loci. Total number of alleles per locus (TNA) varied from 3 (INRA005 locus) to 16 (ETH152 locus). The mean number of allele (MNA) across the six loci in Iraqi indigenous buffalo was 11.4. The locus ETH152 was the most polymorphic marker according to its number of allele (16), the expected heterozygosity (0.86) and polymorphism information content (0.80) number of alleles (3), expected Heterozygosity (0.1-0.2) and polymorphism information content (0.1-0.2). Results showed that these markers were suitable in population genetics researches. It was concluded that a high degree of genetic diversity exist in the Iraqi buffalo populations. Key words: Biodiversity, Iraqi buffalo, microsatellites marker, gene structure.

1. Introduction The buffalo population in Iraq was domesticated during the long period of time [1]. Domestic animals are product of selection, improvement and domestication processes and they have also undergone the effect of genetic drift, mutation and artificial selection [2]. The domesticated breeds are part of biodiversity, therefore, the conservation of these breeds are important. Appropriate management conservation in development programs in biological and local researches are some ways to preserve these local breeds, in order to maintain their genetic characteristics as part of a breeding system [2]. The word “polymorphisms” means “many forms”. When used in a biological sense, polymorphisms are genetically determined differences. Although polymorphisms could encompass virtually any detectable trait, the polymorphisms of most interest and Corresponding author: Talib Ahmed Jaayid, assistant professor, research fields: molecular genetics, animal breeding and biotechnology. E-mail: [email protected].

usefulness are those at the molecular level, so it also known as molecular variation, such polymorphisms is detected by differences in nucleotide sequence [3]. Genetic marker is a gene or DNA sequence with a known location on a chromosome that can be used to identify cells, individual or species. It can be described as a variation, which may arise due to mutation or alteration in the genomic loci, which can be observed. A genetic marker may be a short DNA sequence, such as a sequence surrounding a single base-pair change (single nucleotide polymorphism (SNP)), or a long one, like minisatellites. Molecular variation or polymorphism includes: changes in nucleotides which could be transition or transversion. In the transition mutation, a pyrimidine (C or T) is substituted by another pyrimidine, or a purine (A or G) is substituted by another purine. The transversion mutation involves the change from a pyrimidine to a purine, or vice versa, Insertion or deletion of single nucleotides and Variation in number of repeat of tandemly repeated sequences [4].

298

Genetic Biodiversity in Buffalo Population of Iraq Using Microsatellites Marker

Microsatellite DNA markers are simple sequence repeats (SSR) [5, 6] or short tandem repeats [7] consist of tandemly arranged reiterated units of noncoding DNA sequence [8] rarely within coding regions [9], typically ranging between 2-5 base pair (bp) in length [10] (e.g., of the nucleotide sequences CA, CAG, or TTTA) with a variable unit from 10 to 60 copies. Microsatellites as DNA markers are advantageous over many other markers as they are highly polymorphic, highly abundant, co-dominant inheritance, analytical simple and readily transferable [11]. Microsatellites are reported to be more variable than RFLPs or RAPDs, and have been widely utilized in animal and plant genomic studies [12]. The advantages of microsatellite over other types of genetic markers will become more important, and more obvious, when they are used to track desirable traits in large-scale breeding programs and as anchor points for map-based gene cloning strategies [13]. We have been evaluating cattle microsatellite primer pairs such as: ETH152, CSSM060, BM1706, ETH02, ETH225 and INRA005. The use of microsatellite in population genetics has so far been mainly reported in buffalo population

method [17]. Agarose gel and spectrophotometer were used to determine the qualification and quantification of DNA. Extracted DNA was diluted in TE (Tris HCl 10 mM, Na2 EDTA 0.2 mM, PH = 7.5) and the concentration was adjusted to 50 ng µL-1. The gels were reading in new equipments (gel documentation). 2.3 Microsatellite Selection and Amplification Six microsatellite markers were chosen from joint international society of animal genetics and FAO working group for biodiversity study [18]. Information on the six microsatellite investigated is presented in Table 1. The PCR reaction were conducted in a 15 µL reaction mixture, which included 0.25 µm of each primer, 200 µm deoxynucleoside triphosphate, 1.5-3 mM MgCl2, 1 unit of Taq DNA polymerase, 1  PCR buffer and approximately 150 ng of genomic DNA as a template. Optimum PCR amplification conditions were determined for each marker separately. The PCR product are run on the DNA analyzer (ABI 3730) which

contains

specific

software

programs

for

analyzing the results and allele sizes.

[14-16]. There is a considerable potential for using such polymorphic tools in this kind of analysis. In this study,

2.4 Data Analysis

genetic structure of Iraqi buffalo population was

The results analyzed by using specific programs for microsatellite Gene POP, F stat, Microsatellite toolkit and MEGA program for construction of the genetic map. In preliminary, genetic analysis, allele number (Na) and frequencies were determined by direct counting. Effective number of allele (Ne) was calculated using the following formula [24]:

evaluated by considering the individual locus genotype.

2. Material and Methods 2.1 Sampling A total of 96 blood and hair samples of buffalo were collected from unrelated animals from three main regions in Iraq, South, Middle and North, each of these regions included certain provinces located in these regions. The blood was stored in test tubes containing anticoagulation EDTA while the hair was put in small labeled plastic bags. 2.2 DNA Extraction Genomic DNA was extracted from 5 mL of the whole blood samples, using the modified salting out

Ne =

1



n

p2 i 1 i

(1)

Observed Heterozygosity (Ho) was calculated as the proportion of total heterozygous individuals. Expected Heterozygosity (He) was estimated as the following formula [25, 26]: n

He  1   pi 2 i 1

I  1   pi InPi

(2)

299

Genetic Biodiversity in Buffalo Population of Iraq Using Microsatellites Marker

Table 1

The six microsatellite primers used in the study.

Markers

Pair base

ETH152

192-231

CSSM060

85-141

BM1706

211-271

ETH02

191-202

ETH225

140-156

INRA005

137-143

Primer sequence (5-3) TACTCGTAGGGCAGGCTGCCTG GAGACCTCAGGGTTGGTGATCAG AACATGTGATCCAAGAGAGAGGCA AGGACCAGATCGTGAAAGGCATAG ACAGGACGGTTTCTCCTTATG CTTGCAGTTTCCCATACAAGG TACTCGTAGGGCAGGCTGCCTG GAGACCTCAGGGTTGGTGATCAG GATCACCTTGCCACTATTTCCT ACATGACAGCCAGCTGCTACT CAATCTGCATGAAGTATAAATAT CTTCAGGCATACCCTACACC

Deviation from Hardy-Weinberg equilibrium (HWE) 2

was estimated with x test. The total number of alleles and their frequencies, effective number of alleles, observed and expected Heterozygosity were estimated by the statistics program (Microsatellite Toolkit 2007), and the polymorphism information content (PIC) was calculated using HET software [27], version 1.8 as the following formula [28]: 2

2

PIC  1   i 1 Pi   i 1  j i 1 2 Pi Pj 2 (3) n

n 1

n

where, Pi and Pj are the frequency of i and j and n is the number of alleles in all above equations.

3. Results and Discussion The number of alleles per locus (Na), effective number of alleles (Ne), Ho, He and polymorphism information content (PIC) are shown in Table 2. No significant from HWE were detected for all loci. Hardy-Weinberg Equilibrium is a useful indicator of genotype frequencies within a population and whether they are based on a valid definition of alleles and randomly mating samples [29]. HWE assumes a stable population of adequate size without selective pressure and is used to compare observed genotype frequencies to those expected within a population [29]. Therefore, excess of heterozygote individuals than homozygote individuals, association of loci with some genes of economics importance, migration and high mutation rate of microsatellite may be the cause [30]. All loci were polymorphic and generating 70 alleles with means of

Annealing temperature

Reference

59

[19]

57

[20]

59

[21]

60 [22] 58 58

[23]

11.4. The effective number of alleles ranged from 1.27 (INRA005) to 7.09 (ETH152) across all loci. ETH152 and CSSM060 were the polymorphic while INRA005 was the least polymorphic according to their Ne and PIC values. The polymorphism information content PIC is a parameter indicative of the degree of in formativeness of a marker. Loci with many alleles and a PIC near 1 are the most desirable [31]. The PIC showed an average information content displayed by a panel of 6 microsatellite, suggested high utility of these markers for population genetic researches [32, 33]. The He revealed an average of 0.82 with a range of 0.13 (INRA005) to 0.86 (ETH152). The estimated genetic diversity of Iraqi buffalo population (0.85) was, however, higher than buffalo population of Northern India, Anatolian and 11 populations of Asian buffalo [20, 34, 35] and Guilan buffalo in Iran [30].

4. Conclusions Hence, it can be concluded that Iraqi buffalo population possessed a considerable amount of genetic diversity due to low pressure of artificial selection and possibility of random mating beside Iraqi buffalo population require a scientific production system in order to improve the production without losing the significant genetic structure of these economically important animals.

Acknowledgments The authors are thankful to professor Chao from Huazhong university in China for scientific support.

300

Genetic Biodiversity in Buffalo Population of Iraq Using Microsatellites Marker

Table 2

Genetic diversity parameters in Iraqi buffalo population.

Markers

Na

Ne

Ho He PIC Gene diversity S 0.87 0.86 0.80 0.86 ETH152 16 7.09 M 0.72 0.86 0.80 0.86 N 0.75 0.86 0.80 0.87 S 0.91 0.78 0.71 0.77 CSSM060 14 5.38 M 0.83 0.82 0.76 0.82 N 0.79 0.82 0.75 0.82 S 0.75 0.78 0.71 0.78 M 0.79 0.83 0.77 0.82 BM1706 13 6.14 N 0.70 0.85 0.79 0.85 S 0.75 0.74 0.67 0.74 M 0.77 0.75 0.67 0.75 ETH02 13 4.06 N 0.79 0.76 0.69 0.76 S 0.62 0.57 0.49 0.57 M 0.77 0.62 0.54 0.62 ETH225 11 2.66 N 0.75 0.69 0.61 0.69 S 0.20 0.19 0.17 0.19 M 0.29 0.13 0.11 0.13 INRA005 3 1.27 N 0.45 0.36 0.29 0.36 Na, number of alleles per locus; Ne, effective number of alleles; Ho, Observed Heterozygosity; He, expected Heterozygosity; PIC, polymorphism information content; S, Southern Iraq; M, middle Iraq; N, Northern Iraq.

The second author presents a part of thesis in this paper.

[8]

References [1] [2]

[3]

[4]

[5]

[6]

[7]

W.R. Cockrill, The domestic buffalo, The Blue Book 25 (1985) 121-131. E.H. Giacomoni, G.P. Fernandez-Stolez, T.R.O. Freitas, Genetic diversity in the Pantaneiro horse breed assessed using microsatellite DNA markers, Genet. Mol. Res. 7 (1) (2008) 261-270. C. Nottenburg, J. Sharples, Analysis of “Junk DNA” Patents, CAMBIA and Carol Nottenburg, Canberra ACT Australia, 2004, pp. 1-20. E.L. Milford, C.B. Carpenter, Immunogenetics of Disease: Genetic Polymorphism, in: Immunology/Allergy, ACP Medicine, [Online], 2000, http:// www. acpmedicine.com. D. Tautz, Hypervariability of simple sequences as a general source for polymorphic DNA markers, Nucleic Acids Research 17 (1989) 6463-6471. A. karp, The use of polymorphic microsatellite for assessing genetic diversity in coconut, in: C. Oropeza, J.L. Verdeil, G.R. Ashburner, R. Cardeña, J. Santamaría (Eds.), Current Advances in Coconut Biotechnology, Kluwer Academic Publishers (Dordrecht/Boston/London), 1999, pp. 121-130. C.J. Edwards, C. Gaillard, D.G. Bradley, D.E. MacHugh, Y-specific microsatellite in a range of bovid species,

[9]

[10]

[11] [12]

[13]

[14]

Animal Genetics 31 (2000) 127-130. J. Weber, P.E. May, Abundant class of human DNA polymorphisms which can be typed using the polymerase chain reaction, Amer. J. Human Genetics 44 (1989) 388-396. J.M. Hancock, The contribution of slippage-like processes to genome evolution, J. Mol. Evol. 41 (1995) 1038-1047. D.G. Bradley, Genetic documentation of animal domestication, in: M.A. Zeder (Ed.), Documenting Domestication: New Genetic and Archaeological Paradigms, University of California Press, USA, 2006 pp. 273-354. J.L. Weber, In formativeness of human (dC-dA) n (dG-dT) n polymorphism, Genomics 7 (1990) 524-530. M.S. Akkaya, A.A. Bhagwat, P.B. Cregan, Length polymorphisms of simple sequence repeat DNA in soybean, Genetics 132 (1992) 1131-1139. S.M. Brown, A.K. Szewc-McFadden, S. Kresovich, Development and application of simple sequence repeat (SSR) loci for plant genome analysis, in: P.P. Jauhar (Ed.), Methods of Genome Analysis in Plants, CRC Press, Inc. Boca Raton New York London Tokyo, 1996, pp. 147-159. W.F Vanhooft, A.F Groen, H.H.T. Prins, Microsatellite analysis of genetic diversity in African buffalo population throughout Africa, Mol. Ecol. 9 (2002) 2017-2025.

Genetic Biodiversity in Buffalo Population of Iraq Using Microsatellites Marker [15] S. Kumar, J. Gupta, N. Kumar, K. Dikshit, N. Navani, P. Jain, et al., Genetic variation and relationships among eight Indian riverine buffalo breeds, Molecular Ecology 15 (2006) 593-600. [16] Y. Zhang, D. Sun, Y. Yu, Y. Zhang, Genetic diversity and differentiation of Chinese domestic buffalo based on 30 microsatellite markers, Animal Genetics 38 (2007) 6-17. [17] S.A. Miller, D.D. Dykes, H.F. Polesky, A simple salting out procedure for extracting DNA from human nucleated cells, Nucl. Acid. Res. 16 (1988) 12-15, PMID: 3344216. [18] D. Hoffmann, P.A. Marsan, J.S.F Barker, E.G. Cothram, O. Hanotte, I. Lenstra, et al., New MoDAD marker sets to be used in diversity studies for the major farm animal species recommendation of a joint ISAG/FAO working group, Proc. 29th, Int Conf. Anim. Genet., 2004, p. 107. [19] A. Mezzelani, S. Solinas Toldo, M. Nocart, G. Guérin, L. Ferretti, R. Fries, Mapping of syntenic groups U7 and U27 to bovine Chromosomes 25 and 12, respectively. Mammalian Genome 9 (1993) 574-576. [20] J.S. Barker, S.S. Moore, D.J. Hetzel, D. Evans, S.G. Tan, K. Byrne, Genetic diversity of Asian water buffalo (Bubalus bubalis): Microsatellite variation and a comparison with protein coding loci., Anim. Genet. 28 (2) (1997) 103-115. [21] T.N. Coulson, S.D. Albon, J.M. Pemberton, J. Slate, F.E. Guiness, T.H. Clutton-Brock, Genotype by environment interactions in calf winter survival in red deer, J. Anim. Ecol. 47 (1998) 434-445. [22] P. Steffen, A. Eggen, G. Stranzinger, R. Fries, A.B. Dietz, Isolation and mapping of polymorphic microsatellites in cattle, Animal Genetics 24 (1993) 121. [23] J. Kaukinen, S.L. Varvio, Eight polymorphic bovine microsatellites, Animal Genetics 2 (1993) 148. [24] F.C. Yeh, T. Boyle, Y. Rongcai, Z. Ye, J.M. Xian, Popgene Version, 1999, 3.1. [25] PW, Hedrick, Genetics and populations, 2nd ed., Boston: Science Books Int., 2000. [26] B. Roman, R. Hernández, A.S. Pujadas, J. Cubero, D. Rubiales, Z. Satovic, Genetic diversity in two variants of Orobanche gracilis Sm. [var. gracilis and var. deludens

[27]

[28]

[29]

[30]

[31]

[32]

[33]

[34]

[35]

301

(Beck) A. Pujadas] (Orobanchaceae) from different regions of Spain, Electronic Journal of Biotechnology 10 (2007) 221-229. J. Ott, Program HET Version 1.8, Utility programs for analysis of genetic linkage, Rockefeller University, New York, NY, USA, 2001. R.G. Mateescu, Z. Zhang, K.J. Pavaphotanon, N.I. Burton-Wurster, Analysis of allele fidelity, polymorphic information content and density of microsatellite in a genome-wide screening for hip dysplasia in a crossbreed pedigree, J. Hered. 96 (7) (2005) 847-853. A.D. Short, L.J. Kennedy, Hardy-Weinberg Expectations in Canine Breed: Implications for genetic studies, J. Hered. 98 (5) (2007) 445-451. M. Aminafshar, C. Amirinia, R.V. Torshizi, Genetic diversity in buffalo population of guilan using microsatellite markers, Journal of Animal and Veterinary Advances 11 (2008) 1499-1502. D. Botstein, R.L. White, M. Skolnick, R.W. Davis, Construction of genetic linkage maps in man using restriction fragment length polymorphism, Am. J. Hum. Genet. 32 (3) (1980) 314-331. D.E. Mac-Hugh, R.T. Loftus, P. Cunningham, D.G. Bradley, Genetic structure of seven European cattle breeds assessed using 20 microsatellite markers, Animal Genetics 29 (1998) 333-340. B.B. Kayang, M. Inoue-Murayama, T. Hoshi, K. Matsuo, H. Takahashi, M. Minezawa, et al., Microsatellite loci in Japanese quail and cross-species amplification in chicken and guinea fowl, Genetics Selection Evolution 34 (2002) 233-253. R. Arora, B.D. Lakhchaura, R.B. Prasad, M.S. Tantia, R.K. Vijh, Genetic diversity analysis of two buffalo population of northern India using microsatellite markers, J. Anim. Breed. Genet. 121 (2) (2004) 111-118. M.İ. Soysal, Y.T. Tuna, E.K. Gürcan, An investigation on the water buffalo breeding in Danamandıra village of silivri district of Istanbul province of Turkey, Journal of Tekirdag Agricultural Faculty 2 (2005) 73-78.