100337 (333) Biosci. Biotechnol. Biochem., 74 (9), 100337-1–6, 2010

Effects of Organic Solvents on the Reverse Transcription Reaction Catalyzed by Reverse Transcriptases from Avian Myeloblastosis Virus and Moloney Murine Leukemia Virus Kiyoshi Y ASUKAWA,y Atsushi K ONISHI, and Kuniyo I NOUYE Division of Food Science and Biotechnology, Graduate School of Agriculture, Kyoto University, Sakyo-ku, Kyoto 606-8502, Japan Received May 6, 2010; Accepted June 8, 2010; Online Publication, September 7, 2010 [doi:10.1271/bbb.100337]

The use of certain organic chemicals has been found to improve yields and specificity in PCR. In this study, we examined the effects of dimethyl sulfoxide (DMSO), formamide, and glycerol on the reverse transcription reaction catalyzed by reverse transcriptases (RTs) from avian myeloblastosis virus (AMV) and Moloney murine leukaemia virus (MMLV). At 42  C, DMSO at 24% v/v and formamide at 12–14% inhibited the cDNA synthesis reaction, but DMSO at 12% and formamide at 6–8% improved the efficiency of the cDNA synthesis reaction at low temperatures (25–34  C). Glycerol at 10% improved the efficiency of the cDNA synthesis reaction at high temperatures (49–61  C). The effects of DMSO and formamide appeared to be accompanied by decreases in the melting temperatures of the primers, and the effect of glycerol was due to increases in the thermal stabilities of AMV RT and MMLV RT.

Adv

anc

Key words:

for example. In polymerase chain reaction (PCR), various organic additives have been reported to improve yields and specificity.9,10) Of these, dimethyl sulfoxide (DMSO) and formamide are frequently used for the reaction with a G þ C-rich DNA to improve specificity,11,12) but very little is known about the effects of organic solvents on the reverse transcription reaction, although DMSO has been used empirically in the RNA amplification reaction.4,5) One of the difficult points in this evaluation is that from a practical viewpoint, the efficiency of the reverse transcription reaction is evaluated by the yields and specificity of the subsequent PCR process. Another difficult point is that organic solvents might act on the primer and the RNA as well as on the RT itself. The purpose of this study was to show that organic solvents can improve the efficiency of the RT reaction under certain conditions. We expected that organic solvents at appropriate concentrations would decrease the secondary structures of RNA and non-specific binding of primer without much affecting RT activity. In this study, we examined the effects of DMSO, formamide, and glycerol on the reverse transcription reaction catalyzed by AMV RT and MMLV RT. DMSO and formamide improved the reaction at low temperatures while glycerol improved it at high temperatures.

eV iew Pro ofs

dimethyl sulfoxide; formamide; glycerol; organic solvent; reverse transcriptase

Reverse transcriptase (RT) [EC 2.7.7.49] is the enzyme responsible for viral genome replication. It possesses RNA- and DNA-dependent DNA polymerase and RNase H activities.1,2) RTs from Moloney murine leukemia virus (MMLV) and avian myeloblastosis virus (AMV) are the most extensively used in cDNA synthesis3) and RNA amplification reactions4,5) due to their high catalytic activity and fidelity.6) The AMV RT is a heterodimer consisting of a 63-kDa
subunit and a 95kDa  subunit, while MMLV RT is a 75-kDa monomer. The
subunit of AMV RT comprises the fingers, palm, thumb, connection, and RNase H domains, and the  subunit comprises these five domains and the C-terminal integrase domain.7) MMLV RT also contains these five domains.8) The active site of the DNA polymerase reaction resides in the finger/palm/thumb domain, while that of the RNase H reaction lies in the RNase H domain. Enzymes, in general, are inactivated in the presence of organic solvents. However, enzymatic reactions in media containing organic additives can sometimes make previously problematic processes feasible through increased substrate solubility or diminished side reactions,

Materials and Methods Materials. DMSO and glycerol were purchased from Nacalai Tesque (Kyoto, Japan), and formamide was from Wako Pure Chemical (Osaka, Japan). Native AMV RT purified from AMV was from Life Sciences Advanced Technologies (St. Petersburg, FL). The MMLV RT gene was expressed under the T7 promoter in Escherichia coli, and recombinant MMLV RT was purified from the cells as described previously.13,14) p(dT)15 was from Sigma-Aldrich Japan (Ishikari, Japan). [methyl-3 H]dTTP (1.52 TBq/mmol) and poly(rA) were from GE Healthcare (Buckinghamshire, UK). Glass filter GF/C 2.5 cm was from Whatman (Middlesex, UK). The RT concentration was determined by the method of Bradford15) using Protein Assay CBB Solution (Nacalai Tesque) with bovine serum albumin (Nacalai Tesque) as standard. Standard RNA, an RNA of 1,014 nucleotides corresponding to DNA sequence 8353–9366 of the cesA gene of Bacillus cereus (GenBank accession no. DQ360825), was prepared by in vitro transcription, as described previously.16)

y To whom correspondence should be addressed. Tel: +81-75-753-6267; E-mail: [email protected] Abbreviations: AMV, avian myeloblastosis virus; MMLV, Moloney murine leukemia virus; RT, reverse transcriptase; Tm , melting temperature; T/P, template primer

100337-2

K. YASUKAWA et al. Table 1. Primers

Primers

Base positiona

Sequences (50 –30 )b

Tm (
C)c

RV-R12 RV-R26 RV F5

9308-9319 9308-9333

TGTGGAATTGTGAGCGGCAACACGACGTAG TGTGGAATTGTGAGCGGTGTCGCAATCACCGTAACACGACGTAG TGTGGAATTGTGAGCGG TGCGCGCAAAATGGGTATCAC

36 66 53 60

8725–8745

a

The base position corresponds to that described in the sequences deposited in GenBank (DQ360825). The italicized sequence is the same as that for the RV primer. c Tm of the primers calculated according to the formula Tm ¼ 69:3 þ 0:41(GC)%  650=L, where L is the number of nucleotides.27) The underlined sequence was used for the calculation of Tm .

Adv

A

anc

100 80 60 40 20 0 5

10

15

20

25

30

[organic solvent] (% for v/v)

B

Effect of dilution after incubation of RT with organic solvents. The effect of dilution after incubation of RT with DMSO or formamide on the RT-catalyzed incorporation of dTTP into poly(rA)-p(dT)15 was examined. AMV RT at 300 nM or MMLV RT at 900 nM in 10 mM potassium phosphate (pH 7.6), 2 mM DTT, 0.2% v/v Triton X-100 (buffer A) containing 16% DMSO or formamide was incubated at 4
C for 30 min, and then diluted 4 times with buffer A to bring the concentration of DMSO or formamide to 4%. Then the reaction was initiated immediately in the presence of 4% DMSO or formamide, as described above.

120

0

Relative activity (%)

Measurement of RT activity to incorporate dTTP into poly(rA)p(dT)15 . The reaction was carried out in 25 mM Tris–HCl (pH 8.3), 50 mM KCl, 2 mM DTT, 5 mM MgCl2 , 25 mM poly(rA)-p(dT)15 (concentration expressed as that of p(dT)15 ), 0.4 mM [3 H]dTTP (1.85 Bq/pmol), 0–30% organic solvent (DMSO, formamide, or glycerol), and 5 nM AMV RT or 15 nM MMLV RT at 42
C. An aliquot (20 ml) was taken from the reaction mixture at a predetermined time and immediately spotted onto the glass filter. Unincorporated [3 H]dTTP was removed by three washes of chilled 5% w/v trichloroacetic acid (TCA) for 10 min each time, followed by one wash of chilled 95% ethanol. The radioactivity of the dried filters was counted in 2.5 ml of Ecoscint H (National Diagnostics, Yorkshire, UK). The initial reaction rate was determined by the time course of the amounts of [3 H]dTTP incorporated.

Relative activity (%)

b

120 100 80

eV iew Pro ofs

Measurement of RT activity for cDNA synthesis. The reaction mixture (20 ml) was prepared by mixing of water (0–12 ml), 2 ml of 10 RT buffer (250 mM Tris–HCl pH 8.3, 500 mM KCl, 20 mM DTT), 1 ml of 2.0 mM dNTP, 1 ml of 10 mM R12 or R26 primer, 1 ml of 1.6 pg/ml standard RNA, 1 ml of 1.0 mg/ml E. coli RNA, 0–12 ml of 50% DMSO, formamide, or glycerol, and 2 ml of 50 nM AMV RT or 100 nM MMLV RT in a PCR tube. The reaction was run at 22–64
C for 30 min and stopped by heating at 95
C for 5 min. The PCR reaction mixture (30 ml) was then prepared by mixing water (18 ml), the product of the reverse transcription reaction (3 ml), 3 ml of 10 PCR buffer (500 mM KCl, 100 mM Tris–HCl pH 8.3, 15 mM MgCl), 1 ml of 10 mM of F5 primer, 1 ml of 10 mM RV primer, 3 ml of 2.0 mM dNTP, and 1 ml of 1 U/ml recombinant Taq polymerase (Toyobo, Osaka, Japan). The cycling parameters were 95
C for 30 s, followed by 30 cycles at 95
C for 30 s, 55
C for 30 s, and 72
C for 30 s. The amplified products were separated on 1.0% agarose gels and stained with ethidium bromide (1 mg/ml). The experimental scheme is shown in Fig. 2A, and the nucleotide sequences of the primers are shown in Table 1. Irreversible thermal inactivation of RT. RT (100 nM) in 25 mM Tris– HCl (pH 8.3), 50 mM KCl, 2 mM DTT, and 5 mM MgCl2 was incubated in the presence and the absence of 10% v/v glycerol at 46
C (for AMV RT) and 43
C (for MMLV RT) for predetermined durations, followed by incubation on ice for 30–60 min. The remaining activity of the RT toward the incorporation of dTTP into poly(rA)-p(dT)15 was determined at 37
C, as described above.

Results Inhibitory effects of organic solvents on the RTcatalyzed reverse transcription reaction One aim of the present study was to find appropriate concentrations of organic solvents to modify the

60 40 20 0

0

5

10

15

20

25

30

[organic solvent] (% for v/v)

Fig. 1. Dependence on the Organic Solvent Concentration of the Incorporation of dTTP into poly(rA)-p(dT)15 by Reverse Transcriptases (RTs) at 42
C. The reaction was carried out with 5 nM AMV RT (A) or 15 nM MMLV RT (B) in the presence of 0–30% v/v DMSO (open circle), formamide (open triangle), or glycerol (open square) at 42
C. The concentrations of poly(rA)-p(dT)15 and [3 H]dTTP were 25 mM and 0.2 mM respectively. Relative activity was defined as the ratio of the initial reaction rate in the presence of the indicated organic solvent to that in its absence (25:0  109 M s1 for AMV RT and 25:4  109 M s1 for MMLV RT).

secondary structures of RNA and non-specific binding of primer without substantially affecting RT activity. To do this, first we examined the effects of organic solvents on the AMV RT and MMLV RT-catalyzed incorporation of dTTP into poly(rA)-p(dT)15 . The reaction was carried out in the presence of various concentrations (0–30% v/v) of DMSO, formamide, and glycerol, at 42
C (Fig. 1). Glycerol did not inhibit MMLV RT activity, but did inhibit AMV RT activity weakly. The relative activity of AMV RT was about 60% in the presence of 22–30% glycerol. DMSO at 4–30% and 12– 30% inhibited the activities of AMV RT and MMLV RT respectively in a dose-dependent manner. Formamide at 4–30% and 2–30%, respectively, also inhibited them in a dose-dependent manner. The IC50 values, the concentrations required to decrease the RT activities to 50% of the maximum activity, of DMSO were 11% for AMV RT and 13% for MMLV RT, and those of formamide were 8% for AMV RT and 7% for MMLV RT. The activities of AMV RT and MMLV RT were lost with

Effects of Organic Solvents on Reverse Transcription Reaction

24% DMSO and 18% formamide, suggesting that formamide affects AMV RT and MMLV RT more potently than does DMSO. However, DMSO and formamide might also act to dissociate poly(rA)p(dT)15 into poly(rA) and p(dT)15 . Thus there is a possibility that effects of DMSO and formamide on poly(rA)-p(dT)15 are involved in the inhibition of RT activities to some extent. Next we examined the effects of organic solvents on the AMV RT and MMLV RT-catalyzed cDNA synthesis. The experimental scheme is shown in Fig. 2A. Standard RNA, the 1,014-nucleotide RNA corresponding to DNA sequence 8353–9366 of the cesA gene of Bacillus cereus (GenBank accession no. DQ360825) was used as a target RNA for cDNA synthesis. Its G þ C content is 37%. To suppress the effects of organic solvents by decreasing the melting temperature (Tm ) of the primer, the RV-R26 primer, which has a 26nucleotide sequence complementary to the standard RNA at its 30 terminus and whose calculated Tm value is 66
C (Table 1), was used for the cDNA synthesis reaction. The reaction was carried out in the presence of various concentrations (0–30%) of DMSO, formamide, and glycerol at 42
C. The product of the reverse transcription reaction was subjected to PCR, followed by agarose gel electrophoresis. The production of PCRamplified products was not monitored in the presence of 24–30% DMSO or 16–30% formamide for AMV RT (Fig. 2B), or in the presence of 24–30% DMSO or 12– 30% formamide for MMLV RT (Fig. 2C). This result agreed well with that presented in Fig. 1, to the effect that the activity incorporating dTTP into poly(rA)p(dT)15 was completely lost in the presence of 24–30% DMSO and of 18–30% formamide for AMV RT, and of 24–30% DMSO and of 18–30% formamide for MMLV RT. We hypothesized that half of the DMSO and formamide concentrations required to abolish RT activity would modify the secondary structures of RNA and the non-specific binding of the primer without substantially affecting RT activity. Thus we determined the DMSO concentrations to be 12% for both RTs, and the formamide concentrations to be 8% for AMV RT and 6% for MMLV RT. We determined the glycerol concentrations to be 10% for both RTs, based on the results (Fig. 1) to the effect that their relative activities were almost 100% at 0–14% glycerol. These concentrations were used in the subsequent experiments.

Adv

anc

A

100337-3

5ʼ

RNA (1014 nt)

3ʼ

cDNA synthesis

cDNA (937 or 951 nt)

3ʼ

3ʼ 5ʼ RV-R12 (30 nt) or RV-R26 (44 nt)

F5 (21 nt) 5ʼ 3ʼ

PCR Amplified DNA (612 or 626 bp)

B

5ʼ 3ʼ

5ʼ 5ʼ 3ʼ RV (17 nt) 3ʼ 5ʼ

[organic solvent] (% for v/v)

DMSO

0

2 4

6 8 10 12 14 16 18 20 22 24 26 30

0

2 4

6 8 10 12 14 16 18 20 22 24 26 30

(bp) 1353 1078 872 603

Formamide

eV iew Pro ofs

Enhancing effects of organic solvents on RT-catalyzed cDNA synthesis We examined to determine whether organic solvents would improve the efficiency of cDNA synthesis, and if so, under what conditions. RV-R12 primer, which has a 12-nucleotide sequence complementary to the standard RNA at its 30 terminus and whose calculated Tm value is 36
C (Table 1), was used for the reaction at 22–46
C. RV-R26 primer, described above, was used for the reaction at 49–64
C. The reaction was carried out in the presence of 12% DMSO, 8 or 6% formamide, and 10% glycerol. The product of the reverse transcription reaction was subjected to PCR, followed by agarose gel electrophoresis (Fig. 3). For

Glycerol

C

[organic solvent] (% for v/v)

0

2 4

6 8 10 12 14 16 18 20 22 24 26 30

DMSO

Formamide Glycerol

Fig. 2. RT-PCR. A, Schematic illustration of the cDNA synthesis reaction and PCR. See ‘‘Measurement of the RT activity for cDNA synthesis’’ in ‘‘Materials and Methods.’’ B and C, Dependence on the organic solvent concentration of cDNA synthesis at 42
C. cDNA synthesis was carried out with the 1.6 pg of cesA RNA, 0.2 mM RV-R26 primer, and 5 nM AMV RT (B) or MMLV RT (C) in the presence of 0–30% v/v DMSO, formamide, or glycerol at 42
C. PCR was carried out with a primer combination of RV and F5. The amplified products were applied to 1% agarose gel, followed by staining with ethidium bromide (1 mg/ml).

the RV-R12 primer in the absence of organic solvents, no PCR-amplified products were detected with AMV RT at 22–34
C or with MMLV RT at 22–28
C. However, in the presence of 12% DMSO and of 6–8% formamide, PCR products were detected at 34 and 28–34
C respectively with AMV RT, and at 28 and 25–28
C respectively with MMLV RT. This indicates that DMSO and formamide improved cDNA synthesis at low temperatures (25–34
C). In the reaction with the RV-R26 primer in the absence of organic solvents, no PCR-amplified products were detected at 61–64
C with AMV RT or at 49–64
C with MMLV RT. However, in the presence of 10% glycerol, PCR products were detected at 61
C with AMV RT and at 49–52
C with MMLV RT. This indicates that glycerol improved cDNA synthesis at high temperatures (49–61
C).

100337-4

K. YASUKAWA et al. Temperature (°C)

A

22 25 28 31 34 37 40 43 46 49 52 55 58 61 64

Table 2. Effects of Dilution of Organic Solvents on Reverse Transcriptase (RT) Activity

None

16%b

4%c

16 ! 4%d

Recovery (%)e

(AMV RT) DMSO formamide

11  7 90

92  2 71  0

86  10 70  4

93 98

(MMLV RT) DMSO formamide

25  3 91

105  10 78  7

102  10 60  6

97 76

DMSO Formamide Glycerol Temperature (°C)

B

22 25 28 31 34 37 40 43 46 49 52 55 58 61 64 None

a

DMSO Formamide Glycerol

Fig. 3. Dependence on the Reaction Temperature of cDNA Synthesis in the Presence of Organic Solvents. A, cDNA synthesis was carried out with 1.6 pg of cesA RNA, 0.2 mM RV-R12 (22–46
C) or RV-R26 (49–64
C) primer, and 5 nM AMV RT in the presence of 12% DMSO, 8% formamide, or 10% glycerol. B, cDNA synthesis was carried out with 1.6 pg of cesA RNA, 0.2 mM RV-R12 (22–46
C) or RV-R26 (49–64
C), and 10 nM MMLV RT in the presence of 12% DMSO, 6% formamide, or 10% glycerol. The experimental conditions for PCR and gel electrophoresis corresponded to those in Fig. 2.

Adv 0

2

4

1

2

50°C

anc [DMSO] (% for v/v)

6

8

[formamide] (% for v/v) 0

46°C

3

4

5

6

7

Reverse transcription reaction was carried out with 5 nM AMV RT or 15 nM MMLV RT in the presence of organic solvent at 42
C. The concentrations of poly(rA)-p(dT)15 and [3 H]dTTP were 25 mM and 0.2 mM respectively. The activity in the absence of organic solvent was taken as 100% relative activity. The average of triplicate determinations with the SD value is shown. b,c The concentration of an organic solvent in the reaction was 16 or 4%. d AMV RT at 300 nM or MMLV RT at 900 nM in 10 mM potassium phosphate (pH 7.6), 2 mM DTT, 0.2% v/v Triton X-100 (buffer A) containing 16% DMSO or formamide was incubated at 4
C for 30 min, and then diluted 4 times with buffer A to bring the concentration of the organic solvent to 4%. Then the reaction was initiated immediately in the presence of 4% DMSO or formamide. e Recovery is the percentage of activity recovered upon dilution (16 ! 4%) of an organic solvent as compared to the activity at 4% of the organic solvent.

tion of RT by DMSO and formamide is reversible or irreversible, we examined the effects of dilution. The RTs were incubated with DMSO or formamide at 4
C for 30 min, and then RT activity was measured (Table 2). In the case of DMSO, the AMV RT activities in the presence of 16 and 4% DMSO were 11 and 92% respectively of that obtained in the absence of DMSO. When 16% DMSO was diluted to 4%, the activity recovered to 86%, indicating that full activity can be recovered almost completely by dilution of the final concentration of the organic solvent. Similar results were obtained for the inhibition of AMV RT by formamide and that of MMLV RT by DMSO and by formamide. These results suggest that inhibition is reversible for concentrations of up to 16% for DMSO and formamide.

eV iew Pro ofs

10 12 14 16 18 20

46°C

50°C

Relative activity (%)a

Organic solvent

8

9

10

Fig. 4. Dependence on the DMSO and Formamide Concentrations of cDNA Synthesis in the Presence of Organic Solvents. cDNA synthesis was carried out with 1.6 pg of cesA RNA, 0.2 mM RV-R12, and 5 nM AMV RT in the presence of 0–20% DMSO or 0–10% formamide at 46 and at 50
C. The experimental conditions for PCR and gel electrophoresis corresponded to those in Fig. 2.

We also explored the enhancing effects of DMSO and formamide on the cDNA synthesis reaction at low temperatures. In this case, cDNA synthesis was carried out with AMV RT and the RV-R12 primer at 50 and at 46
C in the presence of 0–20% DMSO and that of 0–10% formamide (Fig. 4). In the cDNA synthesis reactions, with 14 and 16% DMSO and 7 and 8% formamide, no PCR-amplified products were detected at 50
C, but some were detected at 46
C. This suggests that the Tm value was decreased by 4
C by increasing the DMSO concentration from 12 to 16% and the formamide concentration from 6 to 8%. Inactivation of AMV RT and MMLV RT by DMSO and by formamide Because DMSO and formamide are both widely used in the cDNA synthesis reaction, their inhibitory effects on AMV RT and MMLV RT activities should be considered. In order to determine whether the inactiva-

Effects of glycerol on the irreversible thermal inactivation of RT To explore the mechanism of the enhancing effect of glycerol on cDNA synthesis at high temperatures, the irreversible thermal inactivation of RT was examined. AMV RT and MMLV RT were incubated in the absence and the presence of 10% glycerol at 46
C and 43
C respectively for specified durations. The remaining RT activity was determined as the ability to incorporate dTTP into poly(rA)-p(dT)15 at 37
C (Fig. 5). The inactivation rates of AMV RT and MMLV RT were considerably lower in the presence of glycerol than in its absence. Except for heat treatment of MMLV RT with 10% glycerol at 43
C, linear relationships between the natural logarithm of the remaining activity against the incubation time were obtained. The firstorder rate constant of the thermal inactivation of RT (kobs ) was estimated from the slope: AMV RT without glycerol, 1:2  103 s1 ; AMV RT with 10% glycerol, 7:1  104 s1 ; and MMLV RT without glycerol, 1:6  103 s1 .

Relative activity (%)

Effects of Organic Solvents on Reverse Transcription Reaction 120 100 80 60 40 20 0 0

5

10

15

20

Incubation time (min) Fig. 5. Thermal Inactivation of RT in the Presence of Glycerol. AMV RT and MMLV RT, each at 100 nM, were incubated at 46 and 43
C respectively in the absence and the presence of 10% v/v glycerol for the indicated durations. The reverse transcription reaction was carried out with AMV RT at 5 nM and MMLV RT at 15 nM, at 37
C. Relative activity was defined as the ratio of the initial reaction rate with incubation in organic solvent for the indicated durations to that without organic solvent incubation (11:7  109 M s1 for AMV RT and 36:9  109 M s1 for MMLV RT). Symbols: AMV RT without glycerol, open circles; AMV RT with 10% glycerol, solid circles; MMLV RT without glycerol, open triangles; MMLV RT with 10% glycerol, solid triangles.

Adv

Discussion

anc

In this study, we examined the effects of DMSO, formamide, and glycerol on the reverse transcription reaction catalyzed by AMV RT and by MMLV RT. DMSO at 12% and formamide at 6–8% improved the efficiency of cDNA synthesis reaction at low temperatures (25–34
C), while glycerol at 10% improved it at high temperatures (49–61
C) (Fig. 3). Below, we discuss the possible mechanisms of the improvement of the efficiency of cDNA synthesis reaction by DMSO and by glycerol at low temperatures. The results presented in Fig. 4 suggest that an increase in the DMSO concentration by 1% corresponds to a decrease in the Tm of the RV-R12 primer of 1
C, and that an increase in the formamide concentration by 1% corresponds to a decrease of 2
C. We speculate that the enhancement effects of DMSO and formamide are due to an increase in primer specificity on decreasing the secondary structures of RNA and on non-specific binding of the primer. In relation to this, Bonner and Klibanov found that DNA is completely denatured even at 25
C in 99% DMSO or formamide.17) McConaughy et al. found that the Tm of a high molecular DNA-DNA duplex as assessed by the absorbance at 260 nm (A260 ) was 90
C in the absence of an organic solvent, decreased linearly with increasing formamide concentrations, and reached 45
C in the presence of 65% fromamide.18) Several studies have reported on the effects of DMSO and formamide on PCR. Chester et al. found that the Tm value of the primer decreased by 1
C when DMSO was increased by 1.7% v/v,11) which is similar to our result (Fig. 4). Sarkar et al. found that for PCR using a G þ C rich sequence (55%), 1.25–5.0% formamide improved specificity, while 2.5–15% DMSO had no such effect.12) Hube´ et al. found that 5% formamide increased the efficiency of PCR amplification of a G þ C rich sequence (70%) more potently than did 5% DMSO.19) This agrees with our finding that formamide had a more potent effect than DMSO. Taken together, for PCR and the reverse transcription reaction, formamide appears to

100337-5

be particularly effective when the target DNA or RNA has a high G þ C rich sequence. Grandgenett found that the
and  subunits of AMV RT dissociated completely in the presence of 30% DMSO, and that the isolated subunits exhibited activity in the presence of >4% DMSO.20) On the other hand, no inhibition of DMSO on MMLV RT activity or of formamide on AMV RT or MMLV RT activities has yet been reported. Formamide at 10% inhibited PCR amplification by non-engineered Taq DNA polymerase, but increased the activity of the genetically engineered thermostable variant AmpliTaq DNA polymerase.19,21) This suggests that genetically engineered thermostable MMLV RT variants22–24) might also be highly resistant to DMSO and formamide effects. Glycerol enhanced the thermal stability of RT (Fig. 5). Therefore, the enhancing effect of glycerol on cDNA synthesis at high temperatures is perhaps due to this effect. Rariy and Klibanov found that unlike DMSO and formamide, glycerol stabilizes proteins and folds denatured protein correctly.25) Bonner and Klibanov found that DNA maintains a duplex structure at 25
C in 99% glycerol,17) indicating that the effects of glycerol on protein and DNA are much different from those of DMSO and formamide. Carninci et al. found that disaccharide trehalose increases the thermal stability of MMLV RT,26) but no theory to explain thermal stabilization by sugars such as glycerol and trehalose has been established. Both Gerard et al.22) and our own laboratory group13) have found that T/P-mediated stabilization of AMV RT was more potent than that of MMLV RT, suggesting that AMV RT has higher affinity toward the T/P than does MMLV RT. Arezi et al. discovered five novel mutations (Glu69 ! Lys, Glu302 ! Arg, Trp313 ! Phe, Leu435 ! Gly, and Asn454 ! Lys) that stabilized genetically engineered MMLV RT in the presence of the T/P, but not in its absence, and generated a highly stable MMLV RT variant, E69K/E302R/W313F/L435G/N454K, by combining these mutations.24) Gerard et al. found that elimination of the RNase H activity of RT markedly enhanced the thermal stability of its reverse transcription activity.22) We reported recently that elimination of the RNase H activity of MMLV RT by a mutation of Asp524 ! Ala enhanced thermal stability but did not increase its affinity for T/P.23) Whether glycerol and trehalose further increase the thermal stabilities of these thermostable variants is the subject of our coming investigations. In conclusion, 12% DMSO and 6–8% formamide improved the efficiency of the AMV RT and MMLV RT-catalyzed cDNA synthesis reactions at low temperatures, and 10% glycerol improved them at high temperatures. It should be noted that DMSO has been used in RNA amplification at 41–43
C to increase primer specificity.4,5,15) Elucidation of the effects of organic solvents on the reverse transcription reaction should provide useful strategies to direct the reaction at desired temperatures, including room temperature.

eV iew Pro ofs

Acknowledgments This study was supported in part by Grants-in-Aid for Scientific Research (nos. 19580104 and 21580110, to K. Y.) from the Japan Society for the Promotion of Science.

100337-6

K. YASUKAWA et al.

References 1) 2) 3) 4)

5)

6) 7) 8) 9) 10) 11) 12) 13)

14)

Temin HM and Mizutani S, Nature, 226, 1211–1213 (1970). Baltimore D, Nature, 226, 1209–1211 (1970). Kimmel AR and Berger S, Methods Enzymol., 152, 307–316 (1982). Ishiguro T, Saitoh J, Horie R, Hayashi T, Ishizuka T, Tsuchiya S, Yasukawa K, Kido T, Nakaguchi Y, Nishibuchi M, and Ueda K, Anal. Biochem., 314, 77–86 (2003). Masuda N, Yasukawa K, Isawa Y, Horie R, Saito J, Ishiguro T, Nakaguchi Y, Nishibuchi M, and Hayashi T, J. Biosci. Bioeng., 98, 236–243 (2004). Roberts JD, Bebenek K, and Kunkel TA, Science, 242, 1171– 1173 (1988). Bieth E and Darlix JL, Nucleic Acids Res., 20, 367 (1991). Das D and Georgiadis MM, Structure, 12, 819–829 (2004). Chakrabarti R and Schutt CE, Nucleic Acids Res., 29, 2377– 2381 (2001). Kova´rova´ M and Draber P, Nucleic Acids Res., 28, E70 (2000). Chester N and Marshak DR, Anal. Biochem., 209, 284–290 (1993). Sarkar G, Kapelner S, and Sommer SS, Nucleic Acids Res., 24, 7465 (1990). Yasukawa K, Nemoto D, and Inouye K, J. Biochem., 143, 261– 268 (2008).

Adv

anc

15) 16) 17) 18) 19) 20) 21) 22)

23) 24) 25) 26)

27)

Yasukawa K, Muzuno M, and Inouye K, J. Biochem., 145, 315– 324 (2009). Bradford MM, Anal. Biochem., 72, 248–254 (1976). Yasukawa K, Agata N, and Inouye K, Enzyme Microb. Technol., 46, 391–396 (2010). Bonner G and Klibanov AM, Biotechnol. Bioeng., 68, 339–344 (2000). McConaughy BL, Laird CD, and McCarthy BJ, Nucleic Acids Res., 8, 3289–3295 (1969). Hube F, Reverdiau P, Iochmann S, and Gruel Y, Mol. Biotechnol., 31, 81–84 (2005). Grandgenett DP, J. Virol., 17, 950–961 (1976). Varadaraj K and Skinner DM, Gene, 140, 1–5 (1994). Gerard GF, Potter RJ, Smith MD, Rosenthal K, Dhariwal G, Lee J, and Chatterjee DK, Nucleic Acids Res., 30, 3118–3129 (2002). Mizuno M, Yasukawa K, and Inouye K, Biosci. Biotechnol. Biochem., 74, 440–442 (2010). Arezi B and Hogrefe H, Nucleic Acids Res., 37, 473–481 (2009). Rariy RV and Klibanov AM, Proc. Natl. Acad. Sci. USA, 94, 13520–13523 (1997). Carninci P, Nishiyama Y, Westover A, Itoh M, Nagaoka S, Sasaki N, Okazaki Y, Muramatsu M, and Hayashizaki Y, Proc. Natl. Acad. Sci. USA, 95, 520–524 (1998). Marmur J and Doty P, J. Mol. Biol., 5, 109–118 (1962).

eV iew Pro ofs