FEMS Microbiology

Letters 136 (1996) 163-168

Divergicin 750, a novel bacteriocin produced by Carnobacterium divergens 750 b

a.MATFORSK, NorwegianFood Research Institute, Osloreien I, N-1430 is, Norway b Bundesforschungsanstaltftir Eniihrung, Received

15 November

1995; revised

Karlsruhe, Germany

11December 1995; accepted 13 December 1995

Abstract Divergicin 750, a bacteriocin produced by Camobacterium divergens 750, preferentially inhibited the growth of strains of Camobacterium and Enterococcus. Selected strains of Listeria monocytogenes and Clostridium perfringens were also inhibited. The bacteriocin was purified to homogeneity by ammonium sulfate precipitation and sequential S-Sepharose, hydrophobic interaction and reversed phase chromatography. The complete amino acid sequence was determined by Edman degradation. The peptide consisted of 34 amino acid residues. The calculated M, from the peptide sequence, 3447.7, agreed well with that obtained by mass spectrometry. Divergicin 750 did not show any sequence similarities to other known bacteriocins. The plasmid-located structural gene encoding divergicin 750 (dun750) was cloned and sequenced. The gene

encoded a primary translation product of 63 amino acids with a deduced M, = 6789.4 which is cleaved between amino acid residues 29 and 30 to yield the mature bacteriocin. Keywords: Lactic acid bacteria;

Carnobacterium diuergens; Bacteriocin;

1. Introduction Lactic acid bacteria produce a variety of compounds with antimicrobial activity [ 11. Some of these are proteins or peptides and are termed bacteriocins [2,3]. Bacteriocins from lactic acid bacteria are currently being divided into four classes [4]. Class II bacteriocins are small and have little post-translational modifications. They are usually heat stable, hydrophobic and often act on the cell membrane of susceptible target cells. Bacteriocins are commonly secreted by a dedicated transport and maturation

Protein purification;

0378-1097/96/$12.00 0 1996 Federation SSDI 0378.1097(95)00500-5

of European

Microbiological

peptide; Cloning

system. The bacteriocins usually inhibit the growth of closely related species. Some bacteriocins also inhibit the growth of pathogens and spoilage organisms and may thus be of interest for enhancing food safety and food hygiene [5]. Carnobacteria grow at low temperature, produce relatively little acid and volatile compounds and they generally also have low proteolytic and lipolytic activity. Little is known about bacteriocins from carnobacteria. Some bacteriocin-producing carnobacteria have been identified [6,7]. We have previously purified and characterised piscicolin 61 from Carnobacterium LV 17 produced

* Corresponding author. Tel.: +47 64 97 01 00; Fax: +47 64 97 03 33; E-mail: [email protected].

Antimicrobial

piscicola

LV61

[8].

C. piscicola

three bacteriocins, termed carnobacteriocin A, BMl and B2 [9,10] of which carnobacteriocin A was identical to piscicolin 6 1. CarnobacteriSocieties. All rights reserved

Downloaded from http://femsle.oxfordjournals.org/ by guest on January 16, 2017

Askild Holck a,*, Lars Axelsson a, Ulrich Schillinger

ocin BMl and B2 show significant sequence similarity and contain the -YGNGVXCmotif typical of bacteriocins active against Listrricr. Recently, divergicin A, produced by C. dil,ergens LVI 3 was charactericed [I 11. It constitutes an interesting exception in being a small class II-like bacteriocin which uses the cells’ set system for translocation. A lanthionine-containing bacteriocin, camocin U149 has been purified as well [ 121. Here we describe the purification, characterisation and cloning of divergicin 750, a novel bacteriocin from C. dil,ergens 750.

2. I. Growth

and methods

of bacteria

Thirty-seven strains of carnobacteria were screened for production of bacteriocin. Ctrrwbncterium dicergens 750 from the laboratory stock of Bundesanstalt fur Fleischforschung, Kulmbach. Germany, produced divergicin 750. For production of bacteriocin, cells were grown at 25°C overnight in cMRS medium containing Peptone proteose no. 3 (10 g l-‘1, yeast extract (5 g I-‘), sucrose (20 g I-‘), K,HPO, (2 g I-‘), (NH,), citrate (2 g I-‘), MgSO, (0.02 g I- ’ ), MnSO, (0.02 g 1- ’ 1. pH was adjusted to 8.5 with NaOH and the medium autoclaved for 20 min. In growth kinetic experiments C. dicergens 750 was grown in D-MRS broth [ 131 adjusted to initial pH 6.6 and pH 8.2. The broths were inoculated at a 0. I % level of overnight cultures and incubated for 48 h at 25°C. At appropriate time intervals the number of colony-forming units and bacteriocin activity in the culture supernatant was determined. Growth of C. divergens 750 in D-MRS broth of different pH values was monitored using an automated turbidometer, BIOSCREEN C (Labsysterns, Helsinki, Finland). IO ~1 of a ten-fold diluted 24-h culture were added to honeycomb wells containing 190 ~1 D-MRS broth of pH 4.5, 5.0, 6.0. 7.0, 8.0, 9.0, and 10.0. Al! inoculations were done in triplicate and incubation was for 48 h at 30°C. After 14 h and 38 h, samples were withdrawn from a second honeycomb plate and tested for bacteriocin activity. To test the bacteriocin for pH stability, fractions of culture supernatants were adjusted to pH

Bacteriocin activity was quantified by using serial dilutions of the bacteriocin in the agar spot test as described previously [14]. One arbitrary unit (AU) was defined as the reciprocal of the highest dilution yielding a definite zone of inhibition on the indicator lawn. Alternatively. bacteriocin activity was quantified in a microtiter plate assay system by measuring the growth of the indicator organism in two-fold dilutions of bacteriocin in medium as described previously [ 151. When necessary, bacteriocin fractions were adjusted to pH 6.5 and sterilised by filtration through Millipore filters (0.22 pm, Millipore. UK) prior to activity measurements. One bacteriocin unit (BU) was defined as the amount of bacteriocin which inhibited growth of the indicator organism by 50% as compared to a control culture without bacteriocin. Unless otherwise stated C. dicergens L66 was used as an indicator strain. 2.3. Purijication

arid anal_ysis of dicergicin

750

Bacteriocin was purified essentially as described previously [ 161. In short, a 2-l culture of C. dicergets 750 was grown to the stationary phase and cells were removed by centrifugation. The bacteriocin present in the supernatant fraction was concentrated by ammonium sulfate precipitation and subjected to ion exchange chromatography (S-Sepharose), hydrophobic interaction chromatography (Octyl-Sepharose) and reversed phase FPLC (Pharmacia). The purified bacteriocin was stable in 40% (v/v) 2-propanol containing 0.1 a/Ctrifluoroacetic acid at - 20°C. Amino acid sequencing and mass analysis of purified divergicin 750 were done as described previously [ 161. 2.4. Recombitzartt DNA techniques Basic cloning techniques were used [17]. The probes were end-labelled with “P using a terminal transferase end-labelling kit (Amersham, UK). Plasmid DNA from C. dicergens 750 was digested with

Downloaded from http://femsle.oxfordjournals.org/ by guest on January 16, 2017

2. Materials

values between 2 and I I with 5 M NaOH or 2 N HCI. After I h of incubation at 20°C. residual activity was examined by use of the agar spot assay.

A. Holck et al. / FEMS Microbiology Letters 136 (19961 163-168

3. Results

3.1. Production gicin 750

and inhibition

spectrum

Time (h) 25007

1B

01 45

5

6

7

PH

Fig. 1. (A) Growth of C. divergens 750 in D-MRS broth of different pH values as measured by BIOSCREEN automatic turbidometric system. (B) Bacteriocin activity in supematants were measured after 14 h and 38 h of incubation. Activity was measured using the agar spot test.

of diver-

Growth of C. divergens 750 at different initial pH values of the growth media was measured (Fig. 1). The bacteria grew well at high pH while growth was significantly retarded at pH 5. Bacteriocin was produced over a wide range of pH values and could be detected even down to pH 5. It appeared that divergicin 750 was produced in the late exponential phase of growth as the cells entered the early stationary phase and remained fairly stable in the growth supernatant after production (results not shown). When C. divergens 750 was grown at different temperatures, maximum production of bacteriocin occurred at 25°C (results not shown). Bacteriocin production was detected down to growth at 4°C. At 37°C no activity was observed. Consequently, cells were grown at initial pH 8.5 and 25°C to enhance the yield of bacteriocin. Some lactic acid bacteria are known to produce more than one bacteriocin. To rule out interference from other inhibitory substances, purified divergicin 750 (see below) was used in determination of the inhibition spectrum (Table 1). Divergicin 750 prefer-

Table 1 Inhibition

spectrum of purified divergicin

750

Indicator bacteria

Number of sensitive/ number tested a

Carnobacterium dieergens Camobacterium piscicola Camobacterium gallinatum Enterococcus faecalis Enterococcus,faecium Lactobacillus sake Bacillus cereus Brochothrix thermosphacta Clostridium butyricum Clostridium perfringens Clostridium sporogenes Listeria innocua Listeria ivanot,ii Listeria monocytogenes Listeria seeligeri Listeria welshimeri Propionibacterium acnes Staphylococcus aureus Strevtococcus mutans

l/l l/l O/l 2/2 O/’ O/’ O/l O/l O/l I/’ O/1 o/2 O/l l/5 O/’ O/l O/l O/4 O/l

a Inhibition was tested by using the purified bacteriocin (2048 AU ml-’ ) in the agar spot test assay described in Materials and methods.

Downloaded from http://femsle.oxfordjournals.org/ by guest on January 16, 2017

various restriction endonucleases and the resulting fragments were separated on agarose gels, blotted onto nylon filters and hybridised with a divergicin 750-specific degenerate oligonucleotide probe. Two partly overlapping fragments, a 2-kb EcoRI fragment and a 0.2-kb Mb01 fragment, hybridising to the oligonucleotide probe, were purified by excising them from a low-melting-point agarose gel and subsequently employing the MagicTM clean-up system (Promega, USA). Cloning was done in Escherichia coli DHSLU using the cloning vector pGEM-7Zf( + ) (Promega). Positive clones were identified by colony hybridisation. The cloned DNA fragments were sequenced completely on both strands using the Sequenase version 2.0 DNA sequencing kit (Amersham) and a primer walking strategy. Computer analyses were carried out on an IBM personal computer employing the DNASIS sequence analysis program (Hitachi, Japan) and on a UNIX computer employing the GCG programme package [ 181.

165

A. Holck

166

et ~11./ FEM.5

Microhiolog~

Letters

136 f IYY6)

163-168

100

0.3 i_

z

3448 5

75

C z 2

SO-

? j$

$b

0

k, ,v,

15

I 20

25

Divergicin 750 consisted of one polypeptide chain of 34 amino acid residues. No unusual amino acid residues such as lanthionins were found. The calculated M, of 3447.7 was almost identical to the value of 3448.5 Da obtained by PDMS (Fig. 3). The extra I Da in the mass analysis probably originated from protonation of the polypeptide during desorption.

ably inhibited strains of Camobacterium and Enterococcus. Selected strains of Clostridium petfringens and Listeria monocytogenes were also inhibited. qf dk,ergicin

3.3. Cloning and DNA sequencing 750 structural gene

750

Divergicin 750 was purified by ammonium sulfate precipitation, sequential cation exchange, hydrophobic interaction and reversed-phase chromatography (Table 2). The purified bacteriocin appeared homogeneous when subjected to FPLC-reversed phase chromatography (Fig. 2). Overall, a more that 600fold increase in specific activity was observed (BU mg-’ protein). The purified bacteriocin had an activity of approx. 10000 BU pg-’ protein. The complete amino acid sequence of the purified bacteriocin was determined by Edman degradation. The sequence was identical to that deduced from the structural gene after cloning (see below, Fig. 4).

of divergicin

Purification

stage

Culture supernatant (NH&SO, cont. (Fr I) S-Seph. chrom. (FrII) Octyl-Seph. chrom. (FrIII) Rev. phase FPLC (FrIV)

750.

30

Fig. 2. Purity of divergicin 750 after FPLC reversed phase chromatography. The bar indicates the bacteriocin collected for Nterminal sequencing and mass determination.

Table 2 Purification

3480

Fig. 3. Mass spectrum of the purified divergicin

.I

Time (min)

3.2. Purification

3440

Molecular weight

qf the dicergicin

Hybridisation of a degenerate oligonucleotide probe to plasmid DNA from C. dicergens 750 gave one strong hybridisation signal to a 2-kb EcoRI fragment and a partly overlapping 0.2-kb Mb01 fragment. The EcoRI and Mb01 fragments were cloned and sequenced. The structural gene is presented in Fig. 4. The gene encoded a primary translation product of 63 amino acids with a calculated M, = 6789.4. Cleavage of this peptide between amino acid residue 29 and 30 would give the mature divergicin 750. Uncertain amino acid residue determinations in positions 1, 6, 11 and 26 of divergicin 750 were corroborated by deduction from the sequence of the cloned

750 Fraction volume (ml)

Total protein (mg)

Specific activity (BU mg-’ X lo-‘)

Yield

2000 200 50 9 2

120 90 21

I.6 4.2 0.2 100 1000

100 190 2.5 70 35

I .4 0.07

(a)

Downloaded from http://femsle.oxfordjournals.org/ by guest on January 16, 2017

10

0 11,_ 25 3400

A. Holck ct a/. / FEMS Microbiology Letters 136 (19961 i63- 168

1 1

rbs dvn750 GATCACAGACAGCAAAAA?"A?TAGAAAAAA CTAATATAGGAGGATGATACTATGATTM M I K

167

SO 3 120 23

121 24

AAGAGUAAGAACAGAAC.UTT?CTTCCCTTGGTTATGAAGAAATT?CTAATCAT~TT SSLGYEEISNHKL REKNRTI . GCAAGAAATACUGGTGG~GGAATTC?TGGTAAACTAGGAGTAGTACAGGCAGGAGT QEIQGGKGILGKLGVVQAGV

181 44

GGATTTTGTATcAGGAG~G_GGGGCTGG~T~cAGTc?GCC~GATCATCCT~TGC DFvSGVWAGIKQSAKDHPNA

240 63

241

GTAACTTTAATTTAATAAGT:XGCGAAATTUATGTTATTGAAAGGTTATTATTTTAAC

300

301

AGTPAGACAATATACCTCTGACTGTACAAATCGGAGGTATATTGTTT~TATTTATTTGG . . .

360

361

TTTTATC"TTAGCACCCTl'XTl'MACAA'?.4.TTTTTTTGAGAAUAATAATT~T

420

61 4

180 43

gene. Downstream of the structural dyad symmetry was found.

gene, a region of

4. Discussion Divergicin 750 is a low molecular mass, hydrophobic and basic peptide and thus shares characteristics with other bacteriocins of lactic acid bacteria. Divergicin appeared to be produced only in the late exponential phase of growth (results not shown). This is in contrast to many other bacteriocins, for example sakacin A from L. sake Lb706 and sakacin P from L. sake Lb674, which are constitutively synthesized [ 16,191. Nothing is known about the mechanism of regulation of divergicin 750. The bacteriocin was purified by a procedure similar to that used for other bacteriocins [8,19]. During purification a drop in activity was observed after elution from the S-Sepharose column, whilst the activity was regained after the next purification step. The reason for this apparent drop is unknown. The molecular mass of divergicin 750 as calculated from the deduced amino acid sequence was very close to that determined by PDMS and is consistent with the proposed amino acid sequence. Taken together with the information that no lanthionins were detected upon amino acid composition analysis, divergicin 750 appeared not to be subjected to extensive post-translational covalent modifications and thus belonged to the class II bacteriocin group. No sequence similarities of divergicin 750 with other

proteins encoded by sequences in the EMBL and GenBank sequence databases were found. Divergicin 750 thus differs from other bacteriocins of the lactic acid bacteria. A general mechanism of action for the class II bacteriocins has been suggested [20]. In this model the bacteriocin molecules are thought to form amphiphilic cr-helices that combine to make a pore in the cell membrane of susceptible cells. Nothing is known about the mechanism of action of divergicin 750. The region encompassing amino acid residues 7-28 may be able to form an amphiphilic o-helix and may indicate a similar mode of action for divergicin 750. Divergicin 750 is processed from a longer primary translation product. The N-terminal 29 amino acid residues are cleaved off adjacent to a glycine doublet to yield the mature product. This leader sequence, although unusually long, shows typical signatures of bacteriocin leader peptides of the double-glycine type [21], for example a hydrophilic region at positions - 8 to - 11 flanked by hydrophobic amino acid residues. Other bacteriocins of lactic acid bacteria with this type of leader invariably have a dedicated secretion system for their export [22]. Indeed, a putative open reading frame starting approx. 1 kb downstream of the structural gene showed a high degree of similarity to bacteriocin ABC exporter genes such as supT 1231 (results not shown). This indicates that dun750 may be part of a larger gene cluster involved in production and secretion of divergicin 750.

Downloaded from http://femsle.oxfordjournals.org/ by guest on January 16, 2017

Fig. 4. Nucleotide sequence of the region encoding the divergicin 750 structural gene (dw750). A proposed ribosome-binding site IS underlined. Dyad symmetries are indicated by convergent arrows. Downward pointing arrowhead indicates cleavage site of the leader sequence to give the mature divergicin 750. Boldfaced amino acids were also determined by N-terminal Edman degradation. The EMBL accession number is 254201.

Bacteriocins and bacteriocinogenic strains may be used by the food industry as additives to prevent outgrowth of pathogens and spoilage organisms. giving an enhanced control over production processes. The study of the structure of bacteriocins is an important step in establishing knowledge about the parts of the molecule that are responsible for the inhibitory activity. Subsequently, it may be possible to increase the inhibitory spectrum and enhance the activity by changing specific amino acid residues in the bacteriocin molecules.

We want to thank Birgitta Baardsen and Merete Bjamslett for technical assistance. We also want to thank Dr. K. Sletten at the Department of Biochemistry, University of Oslo, for carrying out the automatic amino acid sequencing, and S. Bayne. Applied Biosystems Division of KEBO lab, Ballerup, for analysing the samples on the Biolon 20 mass analyser.

References [I] Lindgren,

S.E. and Dobrogosz. W.J. (1990) Antagonistic activities of lactic acid bacteria in food and feed fermentations. FEMS Microbial. Rev. 87. 149-163. [2] De Vuyst. L. and Vandamme. E.J. (1994) Antimicrobial potential of lactic acid bacteria. In: Bacteriocins of Lactic Acid Bacteria (De Vuyst, L. and Vandamme. E.J., Ed&.). pp. 9 I - 142. Chapman and Hall, London. [3] Jack. R.W., Tagg, J.R. and Ray, B. (1995) Bacteriocins of Gram-positive bacteria. Microbial. Rev. 59. 171-200. [4] Klaenhammer. T.R. (1993) Genetics of bacteriocins produced by lactic acid bacteria. FEMS Microbial. Rev. 12, 39-86. 151 Ray, B. and Daeschel. M.A. (1994) Bacteriocins of starter culture bacteria. In: Natural Antimicrobial Systems and Food Preservation (Dillon, V.M. and Board, R.G., Eds.). pp. 133165. Cab International, Wallingford. UK. [6] Schillinger. U. and Holzapfel, W.H. (1990) Antibacterial activity of carnobacteria. Food Microbial. 7. 305-3 IO. [7] Ahn, C. and Stiles, M.E. (1990) Plasmid-associated bacteriocin production by a strain of Camobac~rriwn piscicda from meat. Appl. Environ. Microbial. 56. 2503-25 10. [8] Holck, A.L., Axelsson. L. and Schillinger, U. (1994) Purification and cloning of piscicolin 61. a bacteriocin from Carnobacrerium piscicoh LV6 I. Curr. Microbial. 29, 63-68.

and Stile>, M.E. (1994) Characteristics and genetic determinant of a hydrophobic peptide becteriocin. carnobacteriocin A. produced by Cumobacrrrium piscicoltr LV 17A. Microbiology 140. 5 17-526. IlO1 Quadri, L.E.N.. Sailer, M., Roy. K.L.. Vederas, J.C. and Stiles. M.E. (1994) Chemical and genetic characterization of bacteriocins produced by Ccrrnohacterilrnl piscicoln LV 17B. J. Biol. Chem. 269, 12204-1221 I. [I II Worobo. R.W.. van Belkum, M.J.. Sailer, M.. Roy. K.L.. Vederas, J.C. and Stiles, M.E. (1995) A signal peptide secretion-dependent bacteriocin from Camohtrcrerium diwrpm. J. Bacterial. 177. 3143-3149. [I21 Stoffels, G.. Nissen-Meyer. J., Gudmundsdottir. A., Sletten, K.. Holo, H. and Nes, I.F. (1992) Purification and characterization of a new bacteriocin isolated from a Carnobacrerium hp. Appl. Environ. Microbial. 58, 1417-1422. [I31 De Bruyn, I.N.. Holzapfel, W.H., Visser, L. and Louw. A.I. ( 1988) Glucose metabolism by Lcrcrohtrc~illus rli~~rgem.J. Gen. Microbial. 134, 2 103-2 109. Schillinger, U.. Stiles. M.E. and Holzapfel. W.H. (1993) Bacteriocin production by Cumohtrctrrium piscicoln LV 6 I. Int. J. Food Microbial. 20, 131-147. [ISI Geis, A.. Jasjit. J. and Teuber. M. (1983) Potential of lactic streptococci to produce bacteriocin. Appl. Environ. Microbiol. 45. 205-2 I I, (161 Holck, A., Axelsson, L., Birkeland, S.-E.. Aukrust, T. and Blom. H. (1992) Purification and amino acid sequence of \akacin A. a bacteriocin from Lmtobacillus sake Lb706. J. Gen. Microbial. 138, 2715-2720. [I71 Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. [I81 Genetics Computer Group (1991) Program manual for the GCG package. version 7. April 1991, Madison, WI. [I91 Holck. A.L.. Axelsson, L., Hiihne, K. and KrSckel. L. (1994) Purification and cloning of sakacin 674, a bacteriocin from ~~ctohrrcilluv strke Lb674. FEMS Microbial. Lett. I IS. l43-

Iso. Abee, T. (1995) Pore-forming bacteriocins of Gram-positive bacteria and self-protection mechanisms of producer organisms. FEMS Microbial. Lett. 129, l-9. Dll HCvarstein, L.S., Holo, H. and Nes, I.F. (1994) The leader peptide of colicin V shares consensus sequences with leader peptides that are common among peptide bacteriocins produced by gram-positive bacteria. Microbiology 140, 23832389. [22] Hgvarstein, L.S.. Diep, D.B. and Nes, I.F. (1995) A family of ABC transporters carry out proteolytic processing of their substrates concomitant with export. Mol. Microbial. 16, 229-240. [23] Axelsson, L. and Holck, A. (1995) The genes involved in production of and immunity to sakacin A, a bacteriocin from LucMmcillussake Lb706. J. Bacterial. 177, 2125-2137.

m

Downloaded from http://femsle.oxfordjournals.org/ by guest on January 16, 2017

Acknowledgements

[91 Worobo. R.W., Henkel, T.. Sailer, M., Roy, K.L.. Vederas. J.