Eur. J. Biochem. 267, 3025±3031 (2000) q FEBS 2000

Detection and distribution patterns of telomerase activity in insects Takashi Sasaki and Haruhiko Fujiwara Graduate School of Frontier Sciences, University of Tokyo, Tokyo, Japan

Telomeres of most insects consist of pentanucleotide (TTAGG)n repeats, although the repeats are absent in Diptera and some other insect species, where the telomere regions are perhaps maintained without telomerase. To understand various and unusual telomere formation in insects, we have studied the characteristic features of a putative insect telomerase that has not been previously described. Using a modified telomeric repeat amplification protocol (TRAP), we first detected the telomerase activity in crickets, cockroaches and two Lepidopteran insects. The telomerase from crickets and cockroaches required dATP, dGTP and dTTP but not dCTP as a substrate and sequence analyses of the products of TRAP revealed that the (TTAGG)n repeats are synthesized by telomerase. The cockroach telomerase was detected both in somatic (fat body, muscle and neural tissues) and germ line (testis) cells, suggesting that expression of this enzyme is not regulated in a tissue-specific manner at an adult stage. While we detected high levels of telomerase activity in crickets and cockroaches, we could not detect activity in all tissues and cell cultures of the silkworm, Bombyx mori and in two Drosophila and one Sarcophaga cell lines. This supports the theory that Dipteran insects maintain their telomeres without telomerase. Keywords: telomerase; telomere; TRAP (telomeric repeat amplification protocol); insect.

Most eukaryotic telomeres consist of direct short nucleotide sequences called telomeric repeats, which are synthesized by a reverse transcriptase activity of telomerase [1,2]. It is hypothesized that the terminal sequences of chromosomal ends shorten with each cell division through the removal of RNA primers during lagging strand replication [3]. In many organisms, a reduction of telomere length below a critical threshold sometimes causes cellular senescence or cessation of cell division [4,5]. Therefore, the addition of telomeric repeats by telomerase is essential to compensate for such a telomere crisis., Some insects, however, have been shown to lack the typical type of telomeric repeat and have alternative mechanisms for telomere [6,7]. At the chromosomal ends of Drosophila melanogaster, many numbers of nonLTR retrotransposons, HeT-A and TART are accumulated. The telomere loss in Drosophila seems to be compensated by retrotransposition of these elements onto the chromosomal tips [8,9]. The telomeres of other Dipteran insects, Chironomus pallidivittatus [10] and Anopheles gambiae [11,12], are likely to be maintained by recombinational events. These telomerase-independent telomere maintenance mechanisms may be a general back up for telomerase, and offer interesting models to study telomere function [7]. In a previous study using fluorescence in situ hybridization (FISH) analyses and Bal31 experiments, we have shown that the telomere of the silkworm, Bombyx mori, consists of a 6±8 kb long stretch of (TTAGG)n. This (TTAGG)n short repeat also exists in the genome of most other insects [13], suggesting that the telomerase-dependent telomere addition is the main system for maintenance of insects' telomeres. At Correspondence to H. Fujiwara, Department of Integrated Biosciences, Graduate School of Frontier Sciences, University of Tokyo, Hongo 7-3-1, Bunkyo-ku, Tokyo, Japan 113-0033. Fax: 1 81 358414411, Tel.: 1 81 358414447, E-mail: [email protected] Abbreviations: TRAP, telomeric repeat amplification protocol; FISH, fluorescence in situ hybridization; nonLTR, non-long terminal repeat. (Received 22 December 1999, accepted 16 March 2000)

present, however, there has been no report on the telomerase activities of insects. In contrast, all Dipteran insects so far tested and some species in Coleoptera and Hymenoptera seem to have lost the (TTAGG)n repeat from their genome [13]. In these insects, it has not yet to be determined whether the telomerase activity is lost or the genes for telomerase themselves are damaged. Analysis of data accumulated on the structure of various types of reverse transcriptase has revealed a close phylogenetic relationship between telomerase and nonLTR-type retrotransposons [14±17]. Notably, the telomere retrotransposons in D. melanogaster resemble the telomerase in structure and function: both ribonucleoproteins that have a reverse transcriptase with similar seven RT motifs and an RNA subunit that can add the DNA sequence on the chromosomal ends using its own RNA as a template. To clarify the evolutionary relationship between telomerase and retroposontype telomeres in insects, it is necessary to identify and characterize the telomerase itself. In this study, we have attempted to detect telomerase activity from a widespread group of insects using TRAP analysis modified for the (TTAGG)n repeats of insects.

M AT E R I A L S A N D M E T H O D S Biological materials Lepidoptera. The silkworm, Bombyx mori (Kinsyu  Showa strain), was purchased from Nihon Nosan Kogyo (Yokohama, Japan) and reared on an artificial diet at 23 ^ 1 8C. The potato hornworm (Agrius convolvuly) was provided by M. Shimoda [National Institute of Sericultural and Entomological Sciences (NISES), Tsukuba, Japan]. The swallowtail butterfly (Papilio xuthus) was collected in Matsudo, Chiba prefecture, Japan. Orthoptera. The cricket (Teleogryllus taiwanemma) was provided by S. Masui (University of Tokyo, Japan) and reared on an artificial diet at 25 8C.

3026 T. Sasaki and H. Fujiwara (Eur. J. Biochem. 267)

q FEBS 2000

Table 1. TRAP forward primers. Forward primer specificity for cricket telomerase. When used with BmCXa as a reverse primer, the results were obtained by TRAP with different primers as indicated. 11, strong signals; 1, weak signals; 1/±, high background; ±, no signal. Primer

Primer sequence (5 0 23 0 )

MER

Results

TS TS2 TS21 (TTAGG)3 (TTAGG)5 A5E EcRAR SARTA8801 pBR(21) pBR(GG) pBR(G) AGT-GG

AATCCGTCGAGCAGAGTT AATCCGTCCGAAGCAGAGTTAGGTTAGGTT GACAATCCGTCGAGCAGAGTT TTAGGTTAGGTTAGG TTAGGTTAGGTTAGGTTAGGTTAGG CAGAAACTCACGCGCGTGGT CGACCTATTTTCCCATTAGG AGATCTAAGCTTTTTCATTATGTTATTTCCTGTTTTTATTAG CACTATCGACTACGCGATCAT CACTATCGACTACGCGATCGG ACACTATCGACTACGCGATCG GTTAGGTTACTACGCGATGG

18 28 21 15 25 20 20 42 21 21 21 20

11 1/± 11 ± 1/± 1 ± 1 ± ± ± ±

Blattaria. The cockroach (Periplaneta americana) was provided by T. Kubo (University of Tokyo, Japan) and reared on dog food at 27 8C.

Extracts were stored at 280 8C before use. Cell culture extracts were prepared from about 5  104 cells. The protein concentration of each extract was determined by BCA protein assay reagent kit (Pierce).

Cell culture Three Bombyx (BmN4, l30 and DK10) and three Dipteran cell lines (s-2, mbn4 and sape4) were cultured in respective media at 25 8C. DK10 (NISES-BoMo-DK10) was provided from Drs Imanishi and Tomita of NISES. S-2 (Schneider-2) and mbn4 (blood cell derived) are cell lines of D. melanogaster. Sape4 was established from embryo of fresh fly (Sarcophaga peregrina). These Dipteran cells were kindly provided by T. Kubo. Preparation of tissue extracts Tissue extracts of various insects were usually prepared from testes of male larva of last instar. Tissue extracts of Periplaneta were prepared from testes, fat bodies, neural tissues and leg muscles of adult male just after ecdysis. Approximately 50 mL of each tissue was washed in cold NaCl/Pi, homogenized with 200 mL of extraction buffer [10 mm Tris/HCl, pH 7.5, 1 mm EGTA, 0.1 mm benzamidine, 5 mm 2-mercaptoethanol and 0.5% Chaps, 10% glycerol, (v/v)] and placed on ice for 30 min. After the homogenate was centrifuged at 12 000 g for 20 min, the supernatant was collected and frozen in liquid nitrogen.

Telomeric repeat amplification protocol (TRAP) assays The TRAP used for mammal [18±20] was modified to detect insects' telomeric repeat (TTAGG)n, as follows. Among 12 forward primers tested, we decided to use the primer 5 0 -AAGCCATCGAGCAGAGTT-3 0 (TS primer) (see Table 1 and Fig. 1). Among eight reverse primers designed based on the complementary sequence of (TTAGG)n, Bm-CX (5 0 -GTGTAACCTAA-CCTAACC-3 0 ) was selected (see Table 2). The 50 mL of reaction mixture for telomerase was composed of 20 mm Tris/HCl (pH 8.3), 1.5 mm MgCl2, 63 mm KCl, 0.05% Tween 20, 1 mm EGTA, 0.01% BSA, 0.5 mm each dNTP, 1 mm TS primer and cell extracts that contain 10 mg protein. After incubation at 30 8C for 60 min, each reaction mixture was extracted with phenol-chloroform and precipitated with ethanol. Each sample was suspended in 50 mL of PCR reaction mixture that was composed of 10 mm Tris/HCl (pH 8.0), 50 mm KCl, 2 mm MgCl2, 0.25 mm each dNTP, 0.25 mL [32P]dCTP (3000 Ci´mmol21, ICN), 1 mm Bm-CX primer and Ex Taq polymerase (Takara). Two-step PCR was performed with 30 cycles of 94 m for 30 s and 60 f for 30 s. The PCR products were resolved on 12% nondenaturing polyacrylamide gels. After the gels were dried up, the banding patterns were Table 2. TRAP reverse primers. Reverse primer specificity for cricket telomerase. TS was used as a forward primer. 11, strong signals; 1, weak signals; 1/±, high background; ±, no signal.

Fig. 1. Primer specificity of cricket telomerase. Using different forward primers listed in Table 1, telomerase activity in cricket testis extract was analyzed by TRAP. ±, no extract was added.

Primer

Primer sequence (5 0 23 0 )

MER Results

BCX Bm-ACX1 Bm-ACX2 Bm-ACX3 Bm-Cxa Bm-Cxa2 Bm-ACXa1 Bm-ACXa2

CCTTAACCTTACCTTACCTTACCTTA GCGCGGCTTACCTTACCTTACCTAAC GCGCGGCTTACCTTACCTTACCTTAC GCGCGGCTTACCTTACCTTACCTAACC GTGTAACCTAACCTAACC GTGTAACCTAACCTTACC GCGAGTGTTACCTTACCTTACCTAAC GCGAGTGTTACCTTACCTTACCTTAC

25 26 26 27 18 18 26 26

1/± 1/± 1 1/± 11 1/± ± ±

q FEBS 2000

Telomerase activity in insects (Eur. J. Biochem. 267) 3027

Fig. 2. Characterization of telomerase activity in the cricket T. taiwanemma. (A) Inactivation experiments before the elongation step by telomerase. TRAP assay was performed, after the tissue extract of cricket testes was pretreated with 0.1 mg´mL21 RNase A (lane 2), heat-inactivation at 94. (lane 3), phenol-extraction (lane 4) and 0.1 mg´mL21 proteinase K (lane 5) (see text). Lane 1, TRAP assay without inactivation treatments (B). A dilution series of the cricket extract in 10, 1, 0.1, 0.01 and 0.001 mg protein samples (Lanes 2±6) was assayed to compare with the amount of activity in 5000 HeLa cell extracts (2 mg protein) (lane 1).

visualized by autoradiography or a bio-imaging analyzer (BAS-2500Mac, Fujifilm). Cloning and sequencing of TRAP products The TRAP products in crickets and cockroaches were treated with presequencing kit (Amersham Pharmacia Biotec.) to exclude primers and dNTPs and subsequently cloned into pGEM T-easy vector (Promega). After transforming them into E. coli, the color selected colonies were hybridized with 32 P-labeled (TTAGG)4 as a probe. Among more than 150 positive colonies detected in the colony hybridization, four clones were selected and sequenced by an automatic sequencer SQ5500 (Hitachi).

R E S U LT S Detection of telomerase activity in cricket Initially, we tried to detect telomerase activity from B. mori, because we have already observed (TTAGG)n repeats at all chromosomal ends of this insect [13]. However, using a variety of different TRAP conditions, we could not detect telomerase activity from any organs of the silkworm (see below). Subsequently, we tested the cricket, Teleogryllus taiwanemma, because FISH analysis of a closely related cricket, Teleogryllus emma, has shown chromosomal end (TTAGG)n repeats (Fujiwara, H., unpublished results). After successful TRAP detection of telomerase activity in T. taiwanemma, we adapted

Fig. 3. Determination of sequences added by telomerase from crickets and cockroaches. (A) TRAP assays in which dCTP, dATP, dGTP or dTTP were omitted from the telomerase elongation step using the cricket extract, but were added prior to the PCR step. (B) The same experiments as shown in (A) using tissue extract from cockroach testes. (C) Sequences of the TRAP product by cricket telomerase. Sequences of TS and Bm-CXa primers were underlined, respectively.

the TRAP protocol to analysis of telomerase activity in insects using cricket tissue extracts. The TRAP assay consists of two steps, elongation by telomerase with a forward primer and PCR amplification with a reverse primer. We synthesized 12 reverse primers (Table 1) and eight forward primers (Table 2) [20,21] and compared the signal intensities and the level of background using several primer combinations. Figure 1 shows the results of TRAP using 12 forward primers and BmCXa as a reverse primer. TS21 and TS showed strong and clear ladder bands with five nucleotides periodicity, while TS2 and TelBm showed strong but smeary bands from primer-dimer formation. Similarly, we tested eight reverse primers combined with the TS forward primer. BmCXa

3028 T. Sasaki and H. Fujiwara (Eur. J. Biochem. 267)

q FEBS 2000

Fig. 4. Telomerase activity in Lepidopteran and Dipteran insects. (A and B) Telomerase activity was detected by TRAP with testes extracts of potato hornworm, (A) A. convolvuly, and of swallowtail, (B) P. xuthus. Pre-treatment of RNase A and heat at 94 8C abolished the ladder bands (lanes 2 and 3). (C) No telomerase activity was detected from extracts of any cell lines (lanes 1±3) and of any larval tissues (lanes 4±6) of the silkworm, B. mori. p.c (positive control), TRAP product of the cricket telomerase. (D) No telomerase activity was detected in three Dipteran cell extracts. Lane 1, sape4 (fresh fly cell line); Lane 2, s-2 (Drosophila Schneider-2); Lane 3, mbn (Drosophila blood cell line); Lane 4, positive control, TRAP product of cricket telomerase.

gave the clearest ladder band without background (data not shown). Based on these results, we decided to use the standard TRAP assay primer, TS, as the forward primer and BmCXa as the reverse primer. When the reaction temperature for telomerase elongation in the TRAP assay was varied from 24 to 40 8C, the strongest band intensities were observed at 30 8C (data not shown). We examined both 3-step and 2-step PCR using a reverse primer and found clearer signals and lower background using the 2-step PCR protocol. When comparing the annealing temperature at 60, 62 and 64 8C in 2-step PCR, 60 8C gave the strongest bands (data not shown). In subsequent TRAP assays, therefore, we used 30 8C for elongation and performed 2-step PCR for 30 cycles with a 60 8C annealing temperature (see Materials and methods). Characterization of insect telomerase To ensure that the observed telomerase activities are really dependent on telomerase itself, we performed a number of inactivation experiments (Fig. 2A). Before the elongation step by telomerase, the tissue extract of cricket testes was treated with 0.1 mg´mL21 RNase A at 37 8C for 60 min and heated at 94 8C for 15 min. Both treatments abolished the PCR product ladder bands. Phenol extraction and proteinase K treatment (100 mg´mL21 at 55 8C for 1 h) of the extracts also blocked the

elongation reaction. These results indicate that a putative complex of RNA and protein, the components of telomerase, may be responsible for the TRAP results we obtained. Further, to assess the level of Teleolgryllus telomerase activity, we compared activity in this organism with human HeLa cells activity (Fig. 2B). The extract from 5000 HeLa cells yielded approximately 2 mg protein. When using 10 mg of protein from the cricket extract, the TRAP results showed approximately a third of band intensity observed using the HeLa extract. A 1 : 1000 dilution of the cricket extract (0.01 mg protein) did not generate a detectable TRAP result. To identify the kind of sequence synthesized by cricket telomerase, we next excluded each dNTP from the elongation mixture. Exclusion of dATP, dTTP or dGTP eliminated all bands (Fig. 3A). Omission of dCTP, however, showed the same pattern in the presence of all four dNTP. The same result was obtained using the extract of cockroach, Periplaneta americana (Fig. 3B). Thus, we concluded that the sequence added by telomerase at least in these insects, is composed of A, T and G, which is consistent with the presumed (TTAGG)n repeats in the insect telomere. We cloned and sequenced the TRAP products using the pGEMT plasmid vector (see Materials and methods). The resultant sequences of cricket (Fig. 3C) and cockroach clones (data not shown) were complete (TTAGG)n repeats that were connected directly to the forward and reverse primers at exact positions. Thus, the telomerase of insects can elongate the

q FEBS 2000

Telomerase activity in insects (Eur. J. Biochem. 267) 3029

telomerase activity seem to be involved in conferring long-term capacity for proliferation in mammal and plant cells [21]. Thus, we examined whether telomerase is expressed only in germ line cells but not in somatic tissues in insects that, in general, have a shorter life span. From the adult male of cockroach Periplaneta, which showed the strongest telomerase activity among insects previously tested, we prepared extracts from testes, fat bodies, neural tissues and leg muscles. In every tissue, clear ladder bands with similar intensities and five base intervals were detected (Fig. 5). Similar results were also obtained with extracts from the testes, Malpighian tubules and fat bodies in old nymph of the cricket, Teleolgryllus at different developmental stages (data not shown). This suggests that there is generally no fine control on tissue-specific expression of telomerase at least in later developmental stages of hemimetabolous insects.

DISCUSSION

Fig. 5. Telomerase activity in several tissues of cockroaches. TRAP assays were performed with 10 mg protein samples from the indicated tissues of P. americana. ±, TRAP under standard conditions. RNase and heat treatment blocked the elongation reaction of the cockroach telomerase.

G rich strand of (TTAGG)n telomeric repeats onto the forward primer. Distribution of telomerase activities among insects After detecting telomerase activity in the cricket, we screened a wide variety of insects for telomerase activity and detected the same activity that adds (TTAGG)n repeats in adult testes of the cockroach, Periplaneta. Although crickets (Orthoptera) and cockroaches (Blattaria) belong to Hemimetabola, they do not share a close phylogenetic relationship (Fig. 6). We then attempted to identify the telomerase activity in holometabolous insect groups, Lepidoptera and Diptera (Fig. 4). From the testes of two Lepidoptera, the potato hornworm (Agrius convolvuly) and the swallowtail (Papilio xuthus), we detected the telomerase activity, which was lost after RNase and heat treatment (Fig. 4A,B). In another Lepidoptera, B. mori, however, repetitive attempts to find telomerase activity in a wide range of tissues (testes, fat bodies and silk glands) were unsuccessful (Fig. 4C). Furthermore, we could not detect activity in three different cell lines of Bombyx, BmN4, DK10 and l30. In the silkworm therefore it is concluded that there is little or no telomerase activity that can be detected by TRAP. To test the telomerase activity of the Dipteran insect that may have lost telomeric repeats, we used three different cell lines, sape 4 from fresh fly, Sarcophaga peregrina, and S-2 and mbn4 from fruit fly, D. melanogaster (Fig. 4d). Using extracts from these cell lines, we did not observe any TRAP bands, suggesting that Dipteran insects have no telomerase activity, at least to add (TTAGG)n. We did not use organs such as testis for assays in these insects, as they are too small to prepare sufficient extracts. Telomerase activity in several cockroach organs In human, telomerase activity is expressed in germ line and tumor cells, but lost in most of somatic tissues [18,22±24]. The

We have previously shown the (TTAGG)n sequence, a putative telomeric repeat in B. mori, to be in the genome of a prawn, Peneus semisulcatus (Crustacea) and a widespread group of insects [13]. FISH analyses have also shown the (TTAGG)n sequence at the chromosomal ends of ants (Myrmecia formicidae, Hymenoptera) [25], three Orthoptera (Locusta migratoria, T. emma and Teleogryllus taiwanemma) and two Lepidoptera (Antheraea yamamai and Antheraea pernyi ) (K. Kojima and H. Fujiwara, unpublished results). A recent report on (TTAGG)n distribution patterns among insects by FISH and Southern hybridization analyses [26] reinforces the above data. They showed that all Lepidoptera (seven species) and Himenoptera (three species) so far tested include (TTAGG)n repeats, although the repeats were absent in Diptera (seven species) and in some other insects. Figure 6 summarizes distribution of (TTAGG)n sequences in Arthropods. In this study, as predicted from these previous observations, we succeeded in detecting telomerase activity in four insect species of Blattaria, Orthoptera and Lepidoptera, which are distantly related on the phylogenetic tree (Fig. 6). Combining this with a recent report of Klapper et al. [27] on telomerase of lobster telomerase (Homarus americanus), the telomerase that synthesizes (TTAGG)n repeats appears to be widely conserved within Arthropod groups. The telomerase activities detected were dependent on protein and RNA components (Fig. 2) and the sequences of the telomerasegenerated products revealed that the arthropod telomerase can synthesize the exact repeat of the TTAGG pentanucleotide (Fig. 3 and [27]). In conclusion, the distribution patterns of (TTAGG)n are essentially consistent with those of telomerase activities, at least in the level of the Arthropod order. It is of interest that the telomerase activities of cockroaches (Fig. 5) and crickets were observed in all tissues tested, both somatic and germ line. Similar telomerase expression patterns were also reported in several differentiated lobster tissues, suggesting that the organ-specific control of telomerase activity, such as shown in adult human cells [18,23,24], is less stringent in arthropod animals. However, to confirm this idea, we need to examine the telomerase activity in other developmental stages of many organs, using more quantitative methods. In the distribution patterns of (TTAGG)n sequences in insects, one intriguing finding is the absence of telomeric repeats in many species that belong to four different orders of insect (Fig. 6). For example, in a class of Diptera, five species tested, including D. melanogaster, lost the (TTAGG)n from their genome [13]. D. melanogaster actually lacks telomeric repeats, as shown by the failure to cross-hybridize with various

3030 T. Sasaki and H. Fujiwara (Eur. J. Biochem. 267)

q FEBS 2000 Fig. 6. Distribution patterns of telomerase and telomeric repeats (TTAGG)n in insects. The phylogenetic tree of insect orders was depicted based on the report of Kristensen [36]. Former results of cross-hybridization of (TTAGG)n and FISH analyses in various insect species [13,25,26] were summarized in the figure. 1, strong signals were observed in the species indicated between parentheses; ±, no signal was observed; ^, weak signals were observed. Only the number of species tested was shown between parentheses (see [13,26]). Major species tested in each insect order are as follows. 1, Peneus s.; 2, Homarus. a; 3, Periplaneta f.; 4, Periplaneta a.; 5, Locusta m., Teleogryllus e., Diestrammena j.; 6, Teleogryllus t.; 7, Manica y., Apis m., Mymecia f.; 8, Bombyx m., Antheraea y., Samia c; 9, Agrius c., Papillio x.; 10, Bombyx m.; 11, Neoitamus a., Drosophila m., Tabanus, t.; 12, Drosophila m., Sarcophaga p. The present data on telomerase were shown in the right section. The telomerase activity in lobster (Homarus a.2) was reported in the [27]. The putative loss of telomerase function during insect evolution is indicated as the symbol of large X in the figure.

oligonucleotides whose design is based on several telomeric sequences [28±30]. In addition, two other Diptera, Chironomus [31,32] and Anopheles [7], also seem to have no (TTAGG)n repeats. That we could not detect telomerase activity in two Drosophila and one Sarcofaga cell lines in this study, is consistent with the observed telomeric repeat missing in Diptera. In general, telomerase activity appears to be involved in a conserved mechanism, conferring the proliferation capacity of the cell. Thus, an undetectable level of telomerase in the actively proliferating cells of Diptera may reflect the actual loss of genes responsible for telomerase in these insects, not only downregulation of the genes. We also used the extract from whole pupa of D. simulans for TRAP analysis and could not detect any bands (data not shown), supporting this conclusion. In D. melanogaster, telomere specific retrotransposons, HeT-A and TART, can compensate for telomere shortening from lack of telomerase, while it is still ambiguous whether such a telomere maintenance is conserved among the genus Drosophila [7]. It is hypothesized that the telomeres of two other Diptera, Chironomus and Anopheles, are maintained by gene conversion or recombinational events. The Dipteran insect prototype may have lost the function of telomerase genes. At present, however, we do not know whether all or some of the components for telomerase in Diptera are blocked functionally, or which promoter or coding regions of the responsible genes are damaged. From a phylogenetic point of view, the four insect orders that have species missing the (TTAGG)n (Dermaptera, Hemiptera, Coleoptera and Diptera) are distantly related. This suggests that the functional block of telomerase may have occurred independently several times during insect evolution (Fig. 6). It is hard to speculate on the mechanisms that may have caused such a discontinuous evolutionary event, but it is possible that one or some components of telomerase conserved amongst Arthropods may be less stable in structure compared to other eukaryotes. An interesting finding in this report is the absence or a very weak activity of telomerase in B. mori, which have (TTAGG)n

repeats at extreme ends of all chromosomes. In spite of numerous attempts to detect telomerase activity using TRAP, no activity was observed in Bombyx cell lines or any tissue at any developmental stage. This suggests that there is quite low telomerase activity in the silkworm. In further study, it will be clarified whether some components of Bombyx telomerase are blocked functionally and what mechanisms underlie the (TTAGG)n addition under such a low telomerase activity. In Bombyx telomeres, hundreds of copies of several families of nonLTR retrotransposons (LINE-like elements) are accumulated within the telomeric repeats [33,34]. These telomeric repeat associated retrotransposons, named TRAS and SART, are actively transcribed and possibly work on telomere elongation [35]. It is of interest to study which telomerase or TRAS/SART retrotransposons is predominantly involved in maintaining telomere regions of the silkworm.

ACKNOWLEDGEMENTS We thank Drs T. Kubo, A. Kobayashi, M, Shimoda, S. Imanishi, S. Tomita, M. Nagata and S. Masui for providing cell cultures and insects. This study was supported by grants from the Ministry of Education, Science and Culture of Japan.

REFERENCES 1. Blackburn, E.H. (1991) Structure and function of telomeres. Nature 350, 569±573. 2. Greider, C.W. (1995) Telomerase biochemistry and regulation. In Telomeres (Blackburn, E.H. & Greider, C.W., eds.), pp. 35±68. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, USA. 3. Watson, J.D. (1972) Origin of concatemeric T7 DNA. Nat. New Biol. 239, 197±201. 4. de Lange, T. (1994) Activation of telomerase in a human tumor. Proc. Natl Acad. Sci. USA 91, 2882±2885. 5. Lundblad, V. & Wright, W.E. (1996) Telomeres and telomerase: a simple picture becomes complex. Cell 87, 369±375.

q FEBS 2000 6. Pardue, M.L. (1995) Drosophila telomeres: another way to end it all. In Telomeres (Blackburn, E.H. & Greider, C.W., eds.), pp. 339±370. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, USA. 7. Biessmann, H. & Mason, J.M. (1997) Telomere maintenance without telomerase. Chromosoma 106, 63±69. 8. Biessmann, H., Mason, J.M., Ferry, K., d'Hulst, M., Valgeirsdottir, K., Traverse, K.L. & Pardue, M.L. (1990) Addition of telomereassociated HeT DNA sequences `heals' broken chromosome ends in Drosophila. Cell 61, 663±673. 9. Levis, R.W., Ganesan, R., Houtchens, K., Tolar, L.A. & Sheen, F.M. (1993) Transposons in place of telomeric repeats at a Drosophila telomere. Cell 75, 1083±1093. 10. Cohn, M. & Edstrom, J.E. (1992) Telomere-associated repeats in Chironomus form discrete subfamilies generated by gene conversion. J. Mol. Evol. 35, 114±122. 11. Roth, C.W., Kobeski, F., Walter, M.F. & Biessmann, H. (1997) Chromosome end elongation by recombination in the mosquito Anopheles gambiae. Mol. Cell. Biol. 17, 5176±5183. 12. Biessmann, H., Kobeski, F., Walter, M.F., Kasravi, A. & Roth, C.W. (1998) DNA organization and length polymorphism at the 2L telomeric region of Anopheles gambiae. Insect Mol. Biol. 7, 83±93. 13. Okazaki, S., Tsuchida, K., Maekawa, H., Ishikawa, H. & Fujiwara, H. (1993) Identification of a pentanucleotide telomeric sequence, (TTAGG)n, in the silkworm Bombyx mori and in other insects. Mol. Cell. Biol. 13, 1424±1432. 14. Eickbush, T.H. (1997) Telomerase and retrotransposons: which came first? Science 277, 911±912. 15. Lingner, J., Hughes, T.R., Shevchenko, A., Mann, M., Lundblad, V. & Cech, T.R. (1997) Reverse transcriptase motifs in the catalytic subunit of telomerase. Science 276, 561±567. 16. Nakamura, T.M., Morin, G.B., Chapman, K.B., Weinrich, S.L., Andrews, W.H., Lingner, J., Harley, C.B. & Cech, T.R. (1997) Telomerase catalytic subunit homologs from fission yeast and human. Science 277, 955±959. 17. Nakamura, T.M. & Cech, T.R. (1998) Reversing time: origin of telomerase. Cell 92, 587±590. 18. Kim, N.W., Piatyszek, M.A., Prowse, K.R., Harley, C.B., West, M.D., Ho, P.L.C., Coviello, G.M., Wright, W.E., Weinrich, S.L. & Shay, J.W. (1994) Specific association of human telomerase activity with immortal cells and cancer. Science 266, 2011±2015. 19. Krupp, G., Kuhne, K., Tamm, S., Klapper, W., Heidorn, K., Rott, A. & Parwaresch, R. (1997) Molecular basis of artifacts in the detection of telomerase activity and a modified primer for a more robust TRAP assay. Nucleic Acids Res. 25, 919±921. 20. Falchetti, M.L., Levi, A., Molinari, P., Verna, R. & D'Ambrosio, E. (1998) Increased sensitivity and reproducibility of TRAP assay by avoiding direct primers interaction. Nucleic Acids Res. 26, 862±863.

Telomerase activity in insects (Eur. J. Biochem. 267) 3031 21. Fitzgerald, M.S., McKnight, T.D. & Shippen, D.E. (1996) Characterization and developmental patterns of telomerase expression in plants. Proc. Natl Acad. Sci. USA 93, 14422±14427. 22. Broccoli, D., de young, J.W. & Lange, T. (1995) Telomerase activity in normal and malignant hematopoietic cells. Proc. Natl Acad. Sci. USA 92, 9082±9086. 23. Hiyama, K., Hirai, Y., Kyouizumi, S., Akiyama, M., Hiyama, E., Piatyszek, M.A., Shay, J.W., Ishioka, S. & Yamakido, M. (1995) Activation of telomerase in human lymphocytes and hematopoietic progenitor cells. J. Immunol. 155, 3711±3715. 24. Harle-Bachor, C. & Boukamp, P. (1996) Telomerase activity in the regenerative basal layer of the epidermis in human skin and in immortal and carcinoma-derived skin keratinocytes. Proc. Natl Acad. Sci. USA 93, 6476±6481. 25. Meyne, J., Hirai, H. & Imai, H.T. (1995) FISH analysis of the telomere sequences of bulldog ants (Myrmecia: formicidae). Chromosoma 104, 14±18. 26. Sahara, K., Marec, F. & Traut, W. (1999) TTAGG telomeric repeats in chromosomes of some insects and other arthropods. Chromosome Res. 7, 449±460. 27. Klapper, W., Kuhne, K., Singh, K.K., Heidorn, K., Parwaresch, R. & Krupp, G. (1998) Longevity of lobsters is linked to ubiquitous telomerase expression. FEBS Lett. 439, 143±146. 28. Richards, E.J. & Ausubel, F.M. (1988) Isolation of a higher eukaryotic telomere from Arabidopsis thaliana. Cell 53, 127±136. 29. Meyne, J., Ratliff, R.L. & Moyzis, R.K. (1989) Conservation of the human telomere sequence (TTAGGG) n among vertebrates. Proc. Natl Acad. Sci. USA 86, 7049±7053. 30. Levis, R.W. (1993) Drosophila melanogaster does not share the telomeric repeat sequence of another invertebrate, Ascaris lumbricoides. Mol. Gen. Genet. 236, 440±442. 31. Nielsen, L. & Edstrom, J.E. (1993) Complex telomere-associated repeat units in members of the genus Chironomus evolve from sequences similar to simple telomeric repeats. Mol. Cell. Biol. 13, 1583±1589. 32. Zhang, Y.J., Kamnert, I., Lopez, C.C., Cohn, M. & Edstrom, J.E. (1994) A family of complex tandem DNA repeats in the telomeres of Chironomus pallidivittatus. Mol. Cell. Biol. 14, 8028±8036. 33. Okazaki, S., Ishikawa, H. & Fujiwara, H. (1995) Structural analysis of TRAS1, a novel family of telomeric repeat-associated retrotransposons in the silkworm, Bombyx mori. Mol. Cell. Biol. 15, 4545±4552. 34. Takahashi, H., Okazaki, H. & Fujiwara, H. (1997) A new family of sitespecific retrotransposons, SART1, is inserted into telomeric repeats of the silkworm, Bombyx mori. Nucleic Acids Res. 25, 1578±1584. 35. Takahashi, H. & Fujiwara, H. (1999) Transcription analysis of the telomeric repeat-specific retrotransposons TRAS1 and SART1 of the silkworm Bombyx mori. Nucleic Acids Res. 27, 2015±2021. 36. Kristensen, N.P. (1981) Phylogeny of insect orders. Ann. Rev. Ent. 26, 135±157.