Bioscience, Biotechnology, and Biochemistry

ISSN: 0916-8451 (Print) 1347-6947 (Online) Journal homepage: http://www.tandfonline.com/loi/tbbb20

Cloning, Characterization, and Expression of cDNA Encoding a Lipase from Kurtzmanomyces sp. I-11 Koji KAKUGAWA, Megumi SHOBAYASHI, Osamu SUZUKI & Tokichi MIYAKAWA To cite this article: Koji KAKUGAWA, Megumi SHOBAYASHI, Osamu SUZUKI & Tokichi MIYAKAWA (2002) Cloning, Characterization, and Expression of cDNA Encoding a Lipase from Kurtzmanomyces sp. I-11, Bioscience, Biotechnology, and Biochemistry, 66:6, 1328-1336, DOI: 10.1271/bbb.66.1328 To link to this article: http://dx.doi.org/10.1271/bbb.66.1328

Published online: 22 May 2014.

Submit your article to this journal

Article views: 51

View related articles

Citing articles: 8 View citing articles

Full Terms & Conditions of access and use can be found at http://www.tandfonline.com/action/journalInformation?journalCode=tbbb20 Download by: [37.44.207.136]

Date: 28 January 2017, At: 18:59

Biosci. Biotechnol. Biochem., 66 (6), 1328–1336, 2002

Cloning, Characterization, and Expression of cDNA Encoding a Lipase from Kurtzmanomyces sp. I-11 Koji KAKUGAWA,1,2,3,† Megumi SHOBAYASHI,2 Osamu SUZUKI,1 and Tokichi MIYAKAWA1 1Department

of Molecular Biotechnology, Graduate School of Advanced Sciences of Matter, Hiroshima University, 1-3-1 Kagamiyama, Higashi-Hiroshima, Hiroshima 739-8530, Japan 2Hiroshima Prefectural Institute of Industrial Science and Technology, 3-10-32 Kagamiyama, Higashi-Hiroshima, Hiroshima 739-0046, Japan 3Hiroshima Prefectural Food Technology Research Center, 12-70 Hijiyama-honmachi, Minami-ku, Hiroshima 732-0816, Japan Received December 25, 2001; Accepted January 31, 2002

A cDNA clone of the lipase secreted by Kurtzmanomyces sp. I-11 was isolated from a cDNA library of this yeast by PCR screening using oligonucleotide primers designed on the basis of the partial amino acid sequence of the lipase. The cloned cDNA ( lip1) encoded a hydrophobic protein of 484 amino acids, where the ˆrst 20 amino acids and the following 6 amino acid sequences were predicted to be the signal sequence for secretion and a pro-sequence, respectively. The deduced amino acid sequence of the Kurtzmanomyces lipase was most similar to Candida antarctica DSM 3855 lipase A (74% identity) and weakly to other lipases. The consensus pentapeptide (-Gly-X-Ser-X-Gly-) that forms a part of the interfacial lipid recognition site in lipases was conserved. A high level of lipase was produced by Pichia pastoris transformed with the lip1 cDNA, indicating that the cloned cDNA indeed encodes a lipase. Key words:

lipase; mannosylerythritol lipid; Kurtzmanomyces sp. yeast; cDNA

Lipases (EC 3.1.1.3) catalyze the hydrolysis of triacylglycerols to glycerol as well as the synthesis and transesteriˆcation of glycerides.1) Widely found in animals, plants, and microorganisms,2,3) lipases, especially those from microorganisms, have received increasing attention because they are expected to be useful as catalysts for industrial uses such as ester synthesis,4,5) optical resolution,6,7) transesteriˆcation,8) and washing processes.9) We have puriˆed and characterized a lipase secreted by Kurtzmanomyces sp. I-11, a mannosylerythritol lipid (MEL)-producing yeast.10) The Kurtzmanomyces lipase had peculiar thermophilic

and acidophilic properties. The optimum temperature for the activity was 759C, and the activity was very stable at temperatures below 709C. The active pH range was 1.9–7.2, and the activity was stable at pH below 7.1. The lipases are roughly classiˆed into two groups based on the regiospeciˆcity of hydrolysis.3,11) The lipases from Candida antarctica DSM 3855 (LF058),12,13) Geotrichum candidum,3) and Penicillium cyclopium3) hydrolyze all the ester bonds in triglycerides (non-speciˆc type). In contrast, the lipases from Rhizopus delemar,3) Aspergillus niger,3) and Aspergillus terreus3) hydrolyze only the 1- and 3positioned ester bonds (speciˆc type). The Kurtzmanomyces lipase hydrolyzes the ester bonds at both 1(3)-positions and 2-positions, indicating that it belongs to the non-speciˆc type. Recently, genes and cDNAs encoding lipases from various organisms have been cloned and their primary structures deduced. Of the position-non-speciˆc lipases, the primary structure of Candida antarctica lipase A14) and Geotrichum candidum lipase I15) have been deduced. The N-terminal sequences of Kurtzmanomyces lipase was very similar to that of C. antarctica lipase A, but diŠered from that of G. candidum lipase I.10) C. antarctica lipase A was very thermostable,12,13) similar to Kurtzmanomyces lipase, while G. candidum lipase I was not.16) In this report, we describe the cloning of cDNA encoding the Kurtzmanomyces lipase and compare the deduced amino acid sequence of Kurtzmanomyces lipase ( lip1) with those of other lipases. Heterologous expression of the lip1 in Pichia pastoris GS115 is also described.

To whom correspondence should be addressed. Koji KAKUGAWA, FAX:+81-82-251-6087; E-mail:kakugawa＠syokuhin-kg.pref. hiroshima.jp Present address: Hiroshima Prefectural Food Technology Research Center, 12-70 Hijiyama-honmachi, Minami-ku, Hiroshima 732-0816, Japan Abbreviations : MEL, mannosylerythritol lipid; lip1, cDNA encoding a Lip1 lipase of Kurtzmanomyces †

cDNA Cloning of Lipase from Kurtzmanomyces sp. I-11

Materials and Methods Strains, vectors, and media. Kurtzmanomyces sp. I-11, which was previously identiˆed as a MELproducing yeast, was used.17) The soybean oil medium for lipase production and total RNA preparation was composed of 4z soybean oil, 0.1z NH4NO3, 0.02z KH2PO4, 0.02z MgSO4・7H2 O, and 0.1z yeast extract. Escherichia coli XL1 Blue MRF' and pUC118 for the construction of the cDNA library, and E. coli JM109 for the construction of the expression vector were purchased from Takara Shuzo Co. Ltd. (Japan). The pGEM-T easy vector system for TA cloning of PCR products was purchased from Promega (USA). The E. coli strains were cultivated in L-broth with addition of Viccillin (sodium ampicillin, 100 mg W ml, Meiji Seika, Japan) for the construcml, tion of the cDNA library, or Zeocin (25 mg W Invitrogen) for the construction of the expression vector. Pichia pastoris GS115 and pPICZaA, used for the expression of the recombinant cDNA, were purchased from Invitrogen Corporation (USA). YPDS medium for the transformation of P. pastoris contained 1z yeast extract, 2z peptone, 2z glucose, 1 M sorbitol, and 100 mg W ml zeocin with or without 2z agar. BMMH medium for lip1 expression in P. pastoris contained 100 mM potassium phosphate (pH 6.0), 1.34z yeast nitrogen base with ammonium sulfate, 4×10„5z biotin, 0.5z methanol, and 4×10„3z histidine. Construction of cDNA library. The cells of Kurtzmanomyces sp. I-11 were cultivated in the medium containing soybean oil as the carbon source at 309 C until the OD580 of the culture broth reached 1.0. The cells were washed twice with water, rapidly frozen in liquid nitrogen, and crushed to powder with a pestle and a mortar. Total RNA was isolated by using Trizol Reagent (Gibco BRL, USA) according to the manufacture's manual, and the poly(A)+-RNA was puriˆed by an Oligotex-dT30ºSuperÀ mRNA Puriˆcation Kit (Takara Co. Ltd., Japan). A cDNA library was constructed with the poly(A)+-RNA of Kurtzmanomyces sp. I-11 and a cDNA Synthesis kit (Stratagene, USA), according to the manufacture's instructions. The cDNA was ligated into the pUC118 vector digested with EcoRI-SalI and used to transform E. coli XL1 Blue MRF' (Stratagene, USA) by electroporation. Analysis of the amino acid sequence. The Kurtzmanomyces lipase (100 mg) puriˆed as described previously10) was dissolved in 100 ml of 10 M urea and incubated at 379C for 1 h. To the reaction mixture, 300 ml of Tris-HCl buŠer (pH 8.5) and 0.5 mg of lysyl endopeptidase (Wako Pure Chemicals) were added, and the mixture was incubated at 379C for 5 h. The resulting peptide preparation was put through rever-

1329

se-phase chromatography with a mBondasphere column 5 mC18-100Å (3×150 mm) (Waters Corp., USA) connected to a Shimadzu HPLC system. The sample was eluted with a linear gradient from 0 to 80z acetonitrile containing 0.1z tri‰uoroacetic acid. The fractionated samples were analyzed by a Procise 494 cLC Protein Sequencer (Applied Biosystems, USA).

DNA Sequencing. DNA labeling for sequencing was done by using a Big Dye Terminator Kit (PE Biosystems, USA) according to the manufacturer's instructions, and the sequence was analyzed by a Genetic Analyzer ABI310 (PE Biosystems, USA). Isolation of partial sequence of lip1 cDNA. The internal region of lip1 cDNA encoding the Kurtzmanomyces lipase was ampliˆed by three-step nested PCR. Primers were designed on the basis of the amino acid sequence corresponding to several peptide segments derived from the lipase, and PCR was done with various sets of the primer. The primer sets that yielded the ampliˆed products are shown below; forward primers (F1:CCNGAYCCNAAYGARGAYCC, F2:CCNAAYGARGAYCCNTTYTA, and F3:AAYATHGARACNTTYGCNAA), and reverse primers (R1:TARTANCCYTGYTGYAANGC and R2:DATNACDATNGGNGTRTC). Here, ``R'' indicates A or G, ``Y'' indicates C or T, ``D'' indicates T, G, or A, ``H'' indicates T, C, or A, and ``N'' indicates A, C, G, or T. PCR ampliˆcations were done with a Takara Thermal Cycler 9600 (Takara Co. Ltd, Japan). The PCR procedure consisted of a denaturation step for 5 min at 949C, followed by 30 cycles of the following steps: denaturation for 30 sec at 949C, annealing for 30 sec at 529C, and an extension for C. The last elongation step was done 2.5 min at 729 for 3 min at 729 C. The 50-ml reaction mixture contained 100 pmol of each primer and 0.25 ml Takara EX Taq (Takara Co. Ltd, Japan) with the manufacturer's buŠer system, together with 1 ml of template. In the ˆrst ampliˆcation step, F1 and R1 were used as the primers, and cDNA pool was used as a template. In the second ampliˆcation step, F2 and R2 were used as the primers, and the ˆrst step product was used as a template. In the third ampliˆcation step, F3 and R2 were used as the primers, and the second step product was used as a template. After the third ampliˆcation, about 350 bp PCR product was cloned in a pGEM-T easy vector (Promega, USA) and the sequence of the cloned DNA was analyzed (data not shown). Finally, new reverse primers (R3: CGAGAACAGCCGTTGCCTTGT, and R4: CGGGATCCAGATGGTAGCAAC) were designed on the basis of the sequence data. 5?-end ampliˆcation of lip1 cDNA. A cDNA libra-

1330

K. KAKUGAWA et al.

ry was constructed with the pUC118 vector as described above. To obtain the 5?-end region of cDNA, it is necessary to amplify the cDNA with a peculiar sense primer to the vector and a peculiar antisense primer to the cDNA.18,19) For this purpose, two-step nested PCR was done by using pUC118-speciˆc primers (RV-M and RV-P, Takara Co. Ltd, Japan) and reverse primers (R3 and R4). The ˆrst step PCR was done in a 50-ml reaction mixture contained 10 pmol RV-M, 10 pmol R3, and 0.2 ml Takara EX Taq (Takara Co. Ltd, Japan) with the manufacturer's buŠer system together with 1 ml of the cDNA pool as template. In the second step ampliˆcation, RV-P and R4 were used as primers, and the ˆrst step product was used as a template. The PCR procedure was slightly modiˆed from the procedure described above. For the ˆrst denaturation step, annealing step and extension step, incubations for 1 min at 949C, for 30 sec at 559 C and for 1.5 min at 729C, respectively, were used. The PCR product (about 400-bp) was cloned in a pGEM-T easy vector (Promega, USA) and the sequence of the cloned fragment was analyzed (data not shown). Finally, new forward primers (F4: CGCAAGGTTCCCACCGACATT, and F5: GTCGTACCGCACCACAAACAC) were designed on the basis of the sequence data.

3?-end ampliˆcation of lip1 cDNA. To obtain the 3?-end region of cDNA, it is necessary to amplify the cDNA with a peculiar sense primer to the cDNA and a peculiar antisense primer to the vector.18,19) Therefore, two-step nested PCR was done by using forward primer (F4 and F5) and pUC118 speciˆc primers (M13-47 and M13-20, Takara Co. Ltd, Japan). The PCR conditions were similar to those of 5?-end ampliˆcation. The primer sets (F4, M13-47) and (F5, M13-20) were used in the ˆrst step ampliˆcation and the second step ampliˆcation, respectively. The PCR product (about 1400 bp) was cloned in a pGEM-T easy vector (Promega, USA) and the sequence of the cloned DNA was analyzed (data not shown). Ampliˆcation of full length cDNA encoding lipase by long PCR. The full-length cDNA encoding lipase was ampliˆed by a two-step nested PCR. Based on the sequences of 5? and 3? ends of cDNA, PCR primers were designed as follows; forward primers (F6:CTTTTTCGCTCCCGTCCCTG, and F7:CCGTCCCTGCCACTGCCTCT), and reverse primers (R5:ATGGAGCGATCCGGTTTCGG, and R6:CGGTTTCGGATGTGGGTCA). The ˆrst step PCR was done in a 50-ml reaction mixture that contained 10 pmol of F6, 10 pmol of R5 and 0.5 ml of KOD Plus (Toyobo Co. Ltd, Japan) in the manufacture's buŠer system, together with 1 ml of the cDNA pool as template. In the second ampliˆcation step, F7 and R6 were used as primers, and the ˆrst step product was

used as the template. The PCR was done by the procedure described for the 5?-end ampliˆcation. A 1550-bp PCR product was cloned into HincII digested pUC118 vector by using a Takara BKL Kit (Takara Co. Ltd, Japan).

DNA analysis. The translation of DNA sequences into amino acids, the multiple alignment, and the construction of a phylogeny tree were done by using GENETYX-WIN software Ver.4.0.6 (Software Development Co. Ltd. Japan). Cloning of lip1 cDNA in P. pastoris expression vector. To insert the sequences between the two EcoRI restriction sites before the N-terminus and behind the termination codon, PCR ampliˆcation of the lip1 cDNA in pUC118 was done with the forward primer (GCGAATTCGCCGCACTCCCG) and the reverse primer (GCGAATTCCTACAGCAACTT). The PCR procedure consisted of a denaturation step for 2 min at 949 C followed by 30 cycles of the following steps: denaturation for 1 min at 949C, annealing C, and an extension for 2 min at for 1 min at 599 729 C. A last elongation step was done for 3 min at C. The reaction mixture (50 ml) contained 729 25 pmol each of primer and 0.25 ml Takara EX Taq (Takara Co. Ltd, Japan) in the manufacturer's buŠer system, together with 1 ml of lip1 cDNA. The PCR products were hydrolyzed with EcoRI. After agarose gel electrophoresis, the EcoRI-digested PCR products were ligated with EcoRI-digested pPICZaA by using a Takara Ligation Kit II (Takara Co. Ltd, Japan). Expression of lip1 in P. pastoris. P. pastoris GS115 was transformed with pPICZaA-lip1 by the competent cells method as described in the Easy Select Pichia Selection Kit manual, Invitrogen. Before transformation, pPICZaA-lip1 was linearized by digestion with SacI. For expression experiments, transformants containing vector without lipase gene were used as controls. An insert check of transformants was done by PCR according to the manufacturer's instruction. For an expression experiment, transformants were picked from a YPDS-Zeocin plate, inoculated into 100 ml of BMMH medium and grown for 7 days at 309C on a shaking incubator (160 rpm), and methanol was added at intervals of 24 hr to a ˆnal concentration of 0.5z to maintain gene expression. Characterization of lipase. Lipase activity was measured by a ``spectrophotometric method'' with p-nitrophenyl laurate (Sigma, USA) as substrate.9,20) The standard reaction mixture was composed of 0.95 ml of substrate (2.63 mM p-nitrophenyl laurate (Sigma, USA) in 50 mM acetate-Na buŠer, pH 5.6, containing 4z Triton X-100) and 50 ml of lipase

cDNA Cloning of Lipase from Kurtzmanomyces sp. I-11

solution. The reaction mixture was incubated at 379 C for 15 min. The reaction was stopped by addition of 2.0 ml of acetone and measured the absorbance at 410 nm. One unit of enzyme activity was deˆned as the amount of enzyme required to release 1 mmol of p-nitrophenol per min. Since p-nitrophenyl laurate is unstable at basic pHs, the pH-activity of lipase was measured by ``Triglyceride G Test Wako'' (Wako Pure Chemical Industries, Japan) using 1-monooleyl glycerol (Sigma, Approx.99z, USA) as substrate in various buŠers.21,22) The standard assay mixture contained 5.6 nmol of substrate, 200 ml of n-hexane, 800 ml of 100 mM buŠer, and 100 ml of lipase solution. After C for 30 min with mixing every 3 min, reaction at 379 1 ml of CHCl3 was added to stop the reaction and the glycerol released into the water layer was measured with a Triglyceride G Test Wako (Wako Pure Chemical Industries, Japan).22) One unit of enzyme activity was deˆned as the amount of enzyme which released 1 mmol of glycerol per min. The details of the properties of the Kurtzmanomyces lipase were described in our previous report.10)

Electrophoretic analysis of proteins. Sodium dodecylsulfate-polyacrylamide gel electrophoresis (SDS-PAGE) was done in a ``DPE2210 electrophoresis system'' with ``multigel 10 W 20'' gel (Daiichi Pure Chemicals, Japan). A low molecular weight electrophoresis calibration kit (Amersham Pharmacia Biotech, Sweden) was used as reference proteins. The gel was stained with Coomassie Brilliant Blue. Glycosidase treatment of lipases. The native or recombinant lipases (100 mg W ml) in 50 mM sodium acetate (pH 5.6) and 1 mM PMSF was incubated over ml of endoglycosidase H (Roche night with 10 mU W Diagnostics, Germany) at 379 C. After treatment with endoglycosidase H, the lipase was analyzed by SDSPAGE.

Results and Discussion Amino acid sequence of kurtzmanomyces lipase A partial amino acid sequence of the peptides derived from the Kurtzmanomyces lipase was analyzed to design oligonucleotide primers for cloning a cDNA copy of the lipase by nested PCR. Six major peaks were detected by HPLC analysis of the peptides produced by lysyl endopeptidase treatment of the lipase (data not shown). During the course of the experiment, it was found that Peak 4 consisted of two sub-components, which could be resolved into Peaks 4–1 and 4–2 by further analysis. The amino acid sequences of the components in Peak 1 to Peak 6 (including Peaks 4–1 and 4–2) were analyzed and the results are summarized in

1331

Table 1. Partial Amino Acid Sequences of Kurtzmanomyces Lipase The amino acid sequences of Peak 1–5 and N-terminus were analyzed as described in ``Materials and Methods''. X shows an amino acid not identiˆed. Sample

Amino acid Sequences

Peak1 Peak2 Peak3 Peak4-1 Peak4-2 Peak5 Peak6

AALPDPNEDPFYSTPSNIE AALPDPNEDPFYSTPSNIETFANGQIIQSR VPTDIGNSNNAASYQLSYRTTNT NVFALVNDTNLLTEQPI LPQDSAVGAYGYSGGAHATV FPRFLXAALDEIVPYVP ATAVLDTPIVISWALQQGYY

N-terminus

AALPDPNEDPFYSTPSNIETFANGQIIQS

Table 1. The sequences of both Peak 1 and Peak 2 peptides coincided with the N-terminal sequence of the Kurtzmanomyces lipase previously analyzed,10) indicating that the N-terminus of the lipase was not blocked. Based on these sequences, a forward primer was designed referring to the N-terminal sequence corresponding to the Peak 1 peptide and a reverse primer was designed referring to the sequence corresponding to other peptide fragments. With a reverse primer derived from the Peak 6 peptides were used, the ampliˆed product was obtained (see, ``Materials and Methods'').

Cloning of lip1 cDNA and Its nucleotide sequence A cDNA clone encoding the lip1 lipase was isolated by nested PCR as described in ``Materials and Methods''. The nucleotide sequencing of the ˆnal PCR product demonstrated a 1374 bp open reading frame (Fig. 1) (DDBJ accession number: AB073866). The deduced 458 amino acid sequence of lip1 cDNA contained all the fragments (Peaks 1 to 6) as indicted by the underlines in a perfect match (Fig. 1). As expected for the lysyl endopeptidase treatment, each peptide fragment was preceded by a lysine residue, except for the Peak 1 and Peak 2 fragments, which were presumed to be the N-terminal sequence of mature lipase. The reason for the production of the two overlapping fragments for the N-terminal sequences by the peptidase treatment is unknown. The sequence is identical to the N-terminal sequence of mature lipase (AALPDPNEDPFYSTPSNIE) began from position 27. In agreement with the general features of the signal sequences,23,24) the ˆrst 20 amino acids of this segment were extremely hydrophobic with an Ala residue at its C-terminus. The amino acid at position 26 was Arg. These data suggested that the ˆrst 20 amino acid residues were a putative signal sequence, and the following 6 amino acid residues were a pro-peptide, which may be cleaved oŠ by a trypsinlike protease to generate the mature lipase. From these results, it was assumed that the mature lipase is comprised of 432 amino acids with the calculated

1332

K. KAKUGAWA et al.

constituted part of the interfacial lipid-binding site. The Asn-linked glycosylation generally occurs at the sequence Asn-X-Ser W Thr, where X is a residue other than Pro or Asp. A potential glycosylation sequence was found at positions 307 to 309 of lipase (Fig.1).

Fig. 1. Nucleotide Sequence and Deduced Amino Acid Sequence of Kurtzmanomyces Lipase Cloned by PCR. The deduced amino acid sequence is given under the nucleotide sequence. Numbers begin from the putative start codon. The underlined sequences coincided with the sequences of the Nterminal region or Peak 1-5, respectively. The broken line indicates the putative signal sequence. The double underline indicates the potential N-glycosylation site. The boxed sequence shows the consensus pentapeptide of lipases. The stop codon is indicated by the asterisk.

molecular mass of 46,307 Da, which agreed well with the molecular mass of the deglycosylated mature lipase as measured by SDS-PAGE (47 kDa) (see below). Lipases, esterases, and serine proteases are known to have the consensus pentapeptide (-Gly-X-Ser-XGly-) designated as a catalytic triad. The consensus pentapeptide was found at positions 198 to 202 of the lipase, suggesting that the region containing Ser-200

Homology of Lip1 lipase The amino acid sequences of the lipases produced by various fungi have been reported. A search of databases by the FASTA program revealed that the Kurtzmanomyces lipase was most similar in sequence to the C. antarctica lipase A (74.8z identity),14) and overall similarity to other lipases was not found. The alignment of Kurtzmanomyces lipase with C. antarctica lipase A is shown in Fig. 2. The mature lipases from Kurtzmanomyces sp. I-11 and C. antarctica consisted of 432 and 431 amino acid residues, respectively. The amino acid sequences of the two lipases were very similar throughout their entire lengths. Particularly, the consensus pentapeptide (-Gly-XSer-X-Gly-) of the two lipases were identical (-GlyTyr-Ser-Gly-Gly-). The Kurtzmanomyces lipase had four Cys residues (Cys117, Cys289, Cys366, Cys410) at relative positions very similar to those of C. antarctica lipase A (Cys122, Cys294, Cys371, Cys415),14) which might participate in the formation of 2 sets of disulˆde bonds. The Kurtzmanomyces lipase and C. antarctica lipase A were suggested to have a similar tertiary structure. Based on the primary structure of lipases, fungal lipases can be classiˆed into two families:25,26) the families represented by the lipases of Rhizomucor miehei27) and Geotrichum candidum,15,28) respectively. The lipase family that contains the G. candidum lipase was reported to belong to the cholinesterase family.28) In contrast, the lipases from the R. miehei family was reported to be a precursor protein containing a pro-peptide which may be cleaved oŠ by a trypsin-like protease.26,27,29,30) From this point of view, Kurtzmanomyces lipase and C. antarctica lipase might belong to the R. miehei family, but overall similarity was not found. To clarify the correlation in the primary structure, the amino acid sequence of Kurtzmanomyces lipase was compared to those of the G. candidum family, the R. miehei family, and the Yarrowia lipolytica family, and a tree representation of the clustering relationships in the primary structure of these lipases is shown in Fig. 3. Y. lipolytica have several genes encoding lipases which have diŠerent features.31–33) LIP1 and LIP3 were reported to belong to the G. candidum family, and LIP2 was reported to be a precursor protein containing a propeptide similar to the one of the R. miehei family. Thus, Y. lipolytica produces lipases which belong to two diŠerent families. As shown in Fig. 3, the lipase family that contains Kurtzmanomyces lipase and C. antarctica lipase A

cDNA Cloning of Lipase from Kurtzmanomyces sp. I-11

1333

Fig. 2. Comparison of Deduced Amino Acid Sequences of Kurtzmanomyces Lipase Cloned by PCR and Candida antarctica DSM3855 Lipase A.14) Dashes indicate gaps introduced into the sequences so that the maximum matching may be obtained. Identical amino acids are shown with a box. The arrow shows the N-terminus of Kurtzmanomyces lipase and Candida antarctica lipase A. The underlined sequences show the consensus pentapeptide of the lipases. The open triangles show the Cys residues.

lipases as an intermediate between the Geotrichum and the Rhizomucor, families. Regarding the enzymatic properties, both the Kurtzmanomyces lipase and C. antarctica lipase A are highly thermostable and position-non-speciˆc.10) However, the pH properties of the two lipases were quite diŠerent, with the Kurtzmanomyces lipase more acidophilic than C. antarctica lipase A.13,34) The structural features responsible for the diŠerence in the enzymatic properties still remain to be investigated.

Fig. 3. A Phylogenic Tree Representation of the Clustering Relationships among the Known Lipases from Fungi. This data was clustered by GENETXY-WIN software using the Neighbor-joining Method.

appeared to be separate from those that contain the Geotrichum and Rhizomucor, lipases, respectively, positioning the Kurtzmanomyces and C. antarctica

Expression of lip1 cDNA in Pichia pastoris To conˆrm that lip1 cDNA indeed encodes a lipase and to develop a convenient heterologous lipaseproducing system, we used the methanol-inducible P. pastoris expression system for lip1 cDNA. The pPICZaA vector has the a-factor secretion signal downstream of the AOX1 promoter. The region that encodes mature lip1 lipase was ampliˆed and inserted downstream of the a-factor secretion signal in frame (Fig. 4). The resulting plasmid, pPICZaA-lip1, and the control plasmid pPICZaA were cut with SacI, and used to transform P. pastoris GS115 competent cells. P. pastoris GS115 transformants were cultivated in 100 ml of BMMH medium with shaking at 309C for 7 days. Culture medium was collected and centrifuged every 24 h to prepare samples to measure lipase activity (data not shown) and to analyze by SDS-PAGE (Fig. 5A). Lipase activity was not detectable in the

1334

K. KAKUGAWA et al.

Fig. 4. Plasmid Construct for the Expression of Kurtzmanomyces Lipase, lip1, in P. pastoris GS115. The original secretion signal peptide (SP) of the Kurtzmanomyces lipase was replaced with that of a-factor in frame as described in ``Materials and Methods''. lip1 DSP is the region encoding the mature lip1 protein. a-factor SP is the region encoding the a-factor signal peptide.

culture supernatant of a control culture (GS115 strain), while the strain transformed with pPICZaAlip1 secreted a high level of lipase. The lipase activity ml, a level after 7 days of cultivation was 46.3 units W much higher than that by Kurtzmanomyces sp. I-11, ml of lipase after 7 days of which produced 6 units W cultivation in the medium containing soybean oil. The molecular mass of the recombinant lipase was estimated to be 52 kDa, which was signiˆcantly larger than the lipase produced by Kurtzmanomyces sp. I-11 (49 kDa). The diŠerence was larger than expected due to the presence of two additional amino acids (Glu-Phe) at the N-terminus of the recombinant lipase, which were derived from the EcoRI restriction site introduced into the construct. It was thought that the diŠerence in molecular size was due to the diŠerence in the extent of glycosylation between the two lipases. A potential glycosylation site was present at positions 307 to 309 of the deduced amino acid sequence of the lip1 cDNA. In fact, both the recombinant lipase and the Kurtzmanomyces lipase were converted to an identical size (ca. 47 kDa) after treatment with endoglycosidase H (Fig. 5B). Next, we examined to see if the recombinant and native lipases have similar enzymatic properties. No signiˆcant diŠerence was observed in the thermal properties and substrate speciˆcities of the two lipases (data not shown). Interestingly, however, the pH properties of the two enzymes showed clear diŠerences. With the recombinant lipase, both the activity range and stability range under various pH conditions extended toward the alkaline pH side compared to native lipase, with no signiˆcant diŠerences

Fig. 5. Analysis of the Recombinant Lipase Produced by P. pastoris GS115 by SDS-PAGE. (A) Comparioson of the recombinant Lip1 lipase with the lipase produced by Kurtzmanomyces sp. I-1. M, molecular mass standards; Lane 1, puriˆed lipase produced by Kurtzmanomyces (7 mg); Lane 2, supernatant fraction of Pichia pastoris GS115 integrated with pPICZaA with lip1 (7 mg); Lane 3, supernatant fraction of Pichia pastoris GS115 integrated with pPICZaA without lip1 (7 mg). (B) Comparison of the lipases after an endoglycosydase H treatment. M, molecular mass standards; Lane 1, puriˆed lipase produced by Kurtzmanomyces (5 mg); Lane 2, recombinant lipase produced by Pichia pastoris GS115 integrated with pPICZaA with lip1 (5 mg). The protein band of about 30 kDa (indicated by an arrowhead) represents endoglycosidase H.

in the proˆles in the acidic pH ranges (Fig. 6A, B). We have eliminated the possibility that these diŠerences are due to the destruction of the lipase by contamination with alkaline-speciˆc proteases in the puriˆed preparation of the Kurtzmanomyces lipase (data not shown). The diŠerences in the properties of the lipases seemed to be due to the diŠerence in the extent and W or mode of glycosylation of the lipases, which was indicated by the diŠerence in the mobility of the two enzymes by SDS-PAGE analysis (Fig. 5A). The alteration of pH speciˆcity of enzyme activities by diŠerences in glycosylation is known with several enzymes.35–37) The Kurtzmanomyces lipase had unique enzymatic properties such that the activity is position-nonspeciˆc, thermostable, and acidophilic. Thus, the lipase is expected to be useful for ester hydrolysis, ester synthesis, or wastewater treatment under acidic conditions. Of these possibilities, we are currently examining the possibility of using the Kurtzmanomyces lipase as the treatment agent of acidic waste containing oil. A high level of lipase production is required for this purpose. Lipase production by Kurtzmanomyces sp. I-11 requires the presence of triacylglycerides in the culture medium as an inducer for the lipase production.10) In addition, a high level of MEL together with lipase is produced in the medium.

cDNA Cloning of Lipase from Kurtzmanomyces sp. I-11

1335

Fig. 6.

Comparison of the EŠects of pH on the Activity (A) and Stability (B) of the Kurtzmanomyces Lipase and the Recombinant Lipase. (A) The activity of lipase was measured by using a Triglyceride G TEST as substrate at various pH. BuŠers used were as follows. 50 mM glycine-HCl (pH pH1. 9–2.9); 50 m M Na-citrate (pH3.3–4.4); 50 m M Na-acetate (pH4.1–6.0); 50 mM Na-phosphate (pH6.4–7.1); 50 mM Tris-HCl (pH7.2–8.8); 0.1 M glycine-NaOH (pH8.8–12.0). (B) The stability of lipase activity was measured by the residual activity of puriˆed Kurtzmanomyces lipase and () and puriˆed recombinant lipase () after incubation of the enzymes at 49C for 24 h in the buŠers with various pHs as in (A).

By the analysis of secreted proteins on SDS-PAGE, it was found that the P. pastoris strain GS115 secreted only a very low level of native proteins in the medium in comparison with the recombinant lipase (Fig. 5A). Moreover, since the presence of triacylglycerides is not required for the production of recombinant lipase by Pichia, the puriˆcation of lipase from the culture medium of P. pastoris is much simpler than that of Kurtzmanomyces. For these reasons, the lipase production from the Pichia expression system would be much more convenient for large-scale puriˆcation of the lipase.

4)

5)

6)

7)

Acknowledgments We thank Haruyuki Iefuji, Miyoko Myojin, and Katsuhito Hashizume for their help in the experiments. We thank Andreea Cristina Cunita for editing the manuscript. This works was supported in part by Special Coordination Funds for Promoting Science and Technology of the Science and Technology Agency of the Japanese Government.

8)

9)

10)

References 1)

2)

3)

Ghosh, P. K., Saxena, R. K., Gupta, R. Yadav, R. P., and Davidson, S., Microbial lipases: production and applications. Sci. Prog., 79, 119–157 (1996). Antonian, E., Recent advances in the puriˆcation, characterization and structure determination of lipases. Lipids, 23, 1101–1106 (1988). Okumura, S., Iwai, M., and Tsujisaka, Y., Positional speciˆcities of four kinds of microbial lipases. Agric. Biol. Chem., 40, 655–660 (1976).

11)

12)

13)

Okumura, S., Iwai, M., and Tsujisaka, Y., Synthesis of various kinds of esters by four microbial lipases. Biochim. Biophys. Acta., 575, 156–165 (1979). Nakano, H., Kitahata, S., Tominaga, Y., and Takenishi, S., Esteriˆcation of glycosides with glycerol and trimethyloipropane moieties by Candida cylindracea lipase. Agric. Biol. Chem., 55, 2083–2089 (1991). Kirchner, G., Scollar, M. P., and Klibanov, A. M., Resolution of reacemic mixtures via lipase catalysis in organic solvents. J. Am. Chem. Soc., 107, 7072–7076 (1985). Langrand, G., Secchi, M., Buono, G., Baratti, J., and Triantaphylides, C., Lipase-catalyzed ester formation in organic solvents. An easy preparative resolution of a-substituted cyclohexanols. Tetrahedron Lett., 26, 1857–1860 (1985). Kaufman, B., Basu, S., and Roseman, S., Isolation of glucosylceramides from yeast ( Hansenula ciferri ). J. Biol. Chem., 246, 4266–4271 (1971). Kojima, Y., Yokoe, M., and Mase, T., Puriˆcation and characterization of an alkaline lipase from Pseudomonas ‰uorescens AK102. Biosci. Biotechnol. Biochem., 58, 1564–1568 (1994). Kakugawa, K., Shobayashi, M., Suzuki, O., and Miyakawa, T., Puriˆcation and characterization of lipase from glycolipid-producing yeast Kurtzmanomyces sp. I-11. Biosci. Biotechnol. Biochem. in printing. Okumura, S., Iwai, M., and Tsujisaka, Y., The eŠect of reverse action on triglyceride hydrolysis by lipase. Agric. Biol. Chem., 45, 185–189 (1981). Ishii, M., Suzuki, E., Abo, M., Nielsen, T. B., and Heldt-Hansen, H. P., Thermostable, positional nonspeciˆc lipase. Hakkokogaku Kaishi (in Japanese), 66, 408–410 (1988). Ishii, M., U. S. Patent 5273898 (Dec. 28, 1993).

1336

14)

15)

16)

17)

18)

19)

20)

21)

22)

23)

24)

25)

26)

K. KAKUGAWA et al.

Svendsen, A., Patkar, S. A., Egel-Mitani, M., Borch, K., Clausen, I. G., and T., Hansen, M., U. S. Patent 6020180 (Feb. 1, 2000). Shimada, Y., Sugihara, A., Tominaga, Y., Iizumi, T., and Tsunasawa, S., cDNA molecular cloning of Geotrichum candidum lipase. J. Biochem., 106, 383–388 (1989). Tsujisaka, Y., Iwai, M., and Tominaga, Y., Puriˆcation, crystallization and some properties of lipase from Geotrichum candidum Link. Agric. Biol. Chem., 37, 1457–1464 (1973). Kakugawa, K., Tamai, M., Imamura, K., Miyamoto, K., Miyoshi, S., Morinaga, Y., Suzuki, O., and Miyakawa, T., Isolation of yeast Kurtzmanomyces sp. I-11, novel producer of mannosylerythritol lipid. Biosci. Biotechnol. Biochem., 66, 188–191 (2002). Tung, J. S., Daugherty, B. L., O'Neill, L., Law, S. W., Han, J., and Mark, G. E., PCR ampliˆcation of speciˆc sequences from cDNA library In ``PCR Technology principles and application for DNA ampliˆcation'', eds. Erlich, H., A., (Katoh, I.)(in Japanese). Takara Shuzo Co. Ltd., pp. 139–145 (1997). Gibbons, I. R., Asai, D. J., Ching, N. S., Dolecki, G. J., Mocz, G., Phillipson, C. A., Ren, H., Tang, W.-J. Y., and Gibbons, B., H., A PCR procedure to determine the sequence of large polypeptides by rapid walking through a cDNA library. Proc. Natl. Acad. Sci. USA, 88, 8563–8567 (1991). Winkler, U. K. and Stuckmann, M., Glycogen, hyaluronate, and some other polysaccharides greatly enhance the formation of exolipase by Serratia marcescens. J. Bacteriol., 138, 663–670 (1979). Lin, S.-F., Chiou, C.-M., Yeh, C.-M., and Tsai, Y.-C., Puriˆcation and partial characterization of an alkaline lipase from Pseudomonas pseudoalcaligenes F-111. Appl. Environ. Microbiol., 62, 1093–1095 (1996). Mase, T., Matsumiya, Y., and Akiba, T., Puriˆcation and characterization of a new lipase from Fusarium sp. YM-30. Biosci. Biotechnol. Biochem., 59, 1771–1772 (1995). Briggs, M. S., and Gierasch, L. M., Molecular mechanisms of protein secretion: the role of the signal sequence. Adv. Protein Chem., 38, 109–180 (1986). Heijne, G. V., A new method for predicting signal sequence clavage sites. Nucl. Acids Res., 14, 4683– 4690 (1986). Shimada, Y., Sugihara, A., and Tominaga, Y., Production, structure and reaction of lipase from Geotrichum candidum. Kagaku to Kogyo (in Japanese), 70, 312–319 (1996). Nagao, T., Shimada, Y., Sugihara, A., and

27)

28)

29)

30)

31)

32)

33)

34)

35)

36)

37)

Tominaga, Y., Cloning and nucleotide sequence of cDNA encoding a lipase from Fusarium heterosporum. J. Biochem., 116, 536–540 (1994). Boel, E., Huge-Jensen, B., Christensen, M., Thim, L., and Fiil, N., P., Rhizomucor miehei triglyceride lipase is synthesized as a precursor. Lipids, 23, 701–706 (1988). Shimada, Y., Sugihara, A., Iizumi, T., and Tominaga, Y., cDNA cloning and characterization of Geotrichum candidum lipase II. J. Biochem., 107, 703–707 (1990). Haas, M., Allen, J., and Berka, T. R., Cloning, expression, and characterization of a cDNA encoding a lipase from Rhizopus delemar. Gene, 109, 107–113 (1991). Yamaguchi, S., Mase, T., and Takeuchi, K., Cloning and structure of the mono- and diacylglycerol lipaseencoding gene from Penicillium camembertii U-150. Gene, 103, 61–67 (1991). Pign àede, G., Wang, H., Fudalej, F., Gaillardin, C., Seman, M., and Nicaud, J. M., Characterization of an extracellular lipase encoded by LIP2 in Yarrowia lipolytica. J. Bacteriol., 182, 2802–2810 (2000). Chouptina, A., Gonzalez, F., Morin, M., Burguillo, F., Ferminan, E., and Dominguez, A., The lipase system of Yarrowia lipolytica. Curr. Genet., 35, 297 (1999). Mileto, D., Brocca, S., Lotti, M., Takagi, M., Alquati, C., and Alberghina, L., Characterization of the Candida rugosa lipase system and overexpression of the lip1 isoenzyme in a non-conventional yeast. Chem Phys Lipids, 93, 47–55 (1998). Patkar, S. A., Bjørking, F., Zundel, M., Schulcin, M., Svendsen, A., Heldt-Hansen, H. P., and Gormsen, E., Puriˆcation of two lipases from Candida antarctica and their inhibition by various inhibitors.. Indian J. Chem., 32B, 76–80 (1993). Acosta, N., Beldarraáƒn, A., Rodráƒguez, L., and Alonso, Y., Characterization of recombinant invertase expressed in methylotrophic yeasts. Biotechnol. Appl. Biochem., 32, 179–187 (2000). Mas áarov áa, J., Mislovicov áa, D., Gemeiner, P., and Michalkov áa, E., Stability enhancement of Escherichia coli penicillin G acylase by glycosylation with yeast mannan. Biotechnol. Appl. Biochem., 34, 127–133 (2001). Kalisz, H. M., Hendle, J., and Schmid, R. D., Structural and biochemical properties of glycosylated and deglycosylated glucose oxidase from Penicillium amagasakiense. Appl. Microbiol. Biotechnol., 47, 502–507 (1997).