THE JOURNAL OF BIOLOGICAL CHEMISTRY © 1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Vol. 272, No. 19, Issue of May 9, pp. 12692–12698, 1997 Printed in U.S.A.

Cloning and Characterization of the Promoter Region of a Gene Encoding a 67-kDa Glycoprotein* (Received for publication, September 23, 1996, and in revised form, January 29, 1997)

Nabendu Chatterjee‡, Cheng Zou‡, John C. Osterman§, and Naba K. Gupta‡¶ From the ‡Department of Chemistry and §Biological Sciences, University of Nebraska, Lincoln, Nebraska 68588-0304

A rat genomic library constructed in l-EMBL3 (SP6/ T7) vector (CLONTECH) was screened using 32P-labeled rat p67 cDNA. A clone containing a segment of 5*-upstream region of p67 genomic DNA was obtained. The DNA (about 1.7 kilobase pairs) was isolated and characterized. Sequence analysis of this DNA fragment showed that the 898 base pairs at the 5*-end of the upstream region was identical to several long interspersed nucleotide sequences. One hundred forty-eight base pairs at the 3*-end contained the beginning of the first exon including the ATG initiator codon. The remaining 652 base pairs in between contained two AT-rich regions and several regulatory sequences. The mRNA initiation site was identified at 89 base pairs upstream from the translation start codon. The DNA fragment was also analyzed by transient transfection. When linked to a firefly luciferase reporter gene, this fragment enhanced transcription in a rat hepatoma cell line (KRC-7). Using a series of deletions in the DNA, the minimum essential promoter region (from 2177 to 260) was identified. The promoter activity was also enhanced by treatment with phorbol 13-myristate 12-acetate (PMA). This enhancement required an AP-1 sequence (2298 to 2292; 5*-TGACTCA-3*) and a similar sequence (297 to 288; 5*-ATGACATCAT3*). Deletion of either of these sequences significantly reduced PMA enhancement. Deletion of both of these sequences almost completely eliminated PMA enhancement.

protein varies widely under different physiological conditions, and this level correlates directly with the protein synthesis activity of the cells (6 – 8). There are indications that the p67 level in the cells under certain physiological conditions is regulated at the transcriptional level (8 –9). The p67 transcription shuts off after serum starvation in a tumor hepatoma cell line (KRC-7). The same serum-starved cell line regains p67 transcription after addition of a mitogen phorbol 13-myristate 12acetate (PMA). To identify the regulatory sequences in p67 transcription, we have now cloned a segment of the 59-upstream region of p67 genomic DNA. In the present paper, we describe the characterization of this DNA fragment and identification of the essential promoter region and the PMA-responsive sequences. EXPERIMENTAL PROCEDURES

Primers The primers used in different experiments are listed in Table I. The primers were synthesized using the facilities of the DNA Synthesis Laboratory at the University of Nebraska, Lincoln, and Life Technologies, Inc. The preparation of pGEM-p67 cDNA has been described (10).

Preparation of

32

P-Labeled Rat p67 cDNA

A 290-bp p67 cDNA fragment was prepared using PCR. The pGEMp67 cDNA was used as template along with two primers, A and B (Table I). The amplified DNA fragment was then purified and random-labeled using [a-32P]dATP following standard experimental procedures.

Isolation and Sequencing of the 59-Upstream Region of the p67 Genomic Clone

Protein synthesis in animal cells is regulated by phosphorylation of a key peptide chain initiation factor, eIF-2.1 Animal cells contain eIF-2 kinases such as heme-regulated inhibitor and double-stranded RNA-activated protein kinase. Under certain physiological conditions, these eIF-2 kinases phosphorylate specifically the a-subunit of eIF-2. This inactivates eIF-2 activity and inhibits protein synthesis (for recent reviews, see Refs. 1–3). Animal cells also contain a 67-kDa glycoprotein, p67 (4 – 8). p67 protects eIF-2 from inhibitory phosphorylation by eIF-2 kinases. This promotes protein synthesis in the presence of active eIF-2 kinase(s) present in animal cells. An important characteristic of p67 is that the level of this

A rat genomic library constructed in l EMBL3 (SP6/T7) vector (CLONTECH) was screened using the 290-bp 32P-labeled rat p67 cDNA. A plaque was identified and later amplified. The phage DNA was isolated from the clone and was digested with BamHI. The digested fragments were analyzed in a Southern blot experiment using a synthetic 70-mer oligonucleotide probe corresponding to 172 to 1142 base pairs of p67 cDNA. One 1.7-kb fragment was detected after autoradiography. The DNA fragment was subcloned into the BamHI site of pGEM 7Zf(1) vector (Promega) and was sequenced following Sanger’s dideoxynucleotide chain termination method (11). The DNA sequence was analyzed using the Genetic Computer Group (GCG) sequence analysis software. This sequence is shown in Fig. 1.

* This work was supported by NIGMS Grant 22079 from the National Institutes of Health, an American Heart Association grant (Nebraska Chapter), and a Nebraska State grant for Cancer and Smoking Diseases (to N. K. G.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. ¶ To whom correspondence should be addressed. Tel.: 402-472-2743; Fax: 402-472-9402. 1 The abbreviations used are: eIF-2, eukaryotic initiation factor-2; p67, eIF-2 associated 67 kDa glycoprotein; DNA, deoxyribonucleic acid; bp, base pair(s); kb, 1kilobase pair(s); PCR, polymerase chain reaction; AP-1, activated protein 1; PMA, phorbol 12-myristate 13-acetate; LINE, long interspersed nucleotide sequence.

The transcription start site of the rat p67 gene was analyzed by primer extension. Total RNA from KRC-7 cells was isolated using the guanidium isothiocyanate method (12). Approximately 10 mg of RNA was used as a template. The primer was an 18-base oligonucleotide (primer C, Table I) corresponding to the inverse complement of 175 to 192 nucleotides of the sequence reported in this paper. The primer (10 pmol) was end-labeled with [g-32P]ATP and T4 polynucleotide kinase (Promega). The primer extension reaction was carried out with avian myeloblastosis virus reverse transcriptase and Primer Extension System (Promega) following standard procedures. The extended product was analyzed on an 8% sequencing gel and compared with the DNA sequence ladder and FX-174 HinfI DNA marker.

Primer Extension Analysis

12692

This paper is available on line at http://www-jbc.stanford.edu/jbc/

p67 Promoter Analysis

12693

TABLE I Primer sequences used in different experiments The primers were synthesized using the facilities of the DNA Synthesis Laboratory at the University of Nebraska, Lincoln, and Life Technologies, Inc. The XhoI restriction sites are single underlined and HindIII restriction sites are double underlined. Primer name

Primer Primer Primer Primer Primer Primer Primer Primer Primer Primer Primer Primer Primer Primer Primer Primer Primer Primer Primer Primer Primer

a

A Bb Cc D E F Gd Ie Jd,e Hd Ke Ld,e Me Nd,e Oe Pd,e Qe Rd,e S Td X

Primer sequence (59- to 39-)

AATAGATGGGAAGACCTACC CCAAAGTTTTCATTGATGACATT CATGTTGCCCGAGAGGGA AGCTATACCTCTCTCGAGCATATAC ACAACTCGAGCAATAGCCTC TTGTCTGTAGGACTCGAGAC TTGTTCAAGCTTCTGTTGAGGG GCCAGAAACCTAGAAATAA/TTACAATAGAATCATTCCAA ATGATTCTATTGTAA/TTATTTCTAGGTTTCTGGCTATTA GCTCAAAGCTTCTTCACCCACTTCC ATCAATATAACAGTTCT/TTAGATGTCCCTCAACAGAA CTGTTGAGGGACATCTAA/AGAACTGTTATATTGATATA GACAAATGGGCTGAG/CAGAAAGTTCGTGAATCAAT TTCACGAACTTTCTG/CTCAGCCCATTTGTCATTTG TGAATCAATCTACTTAA/TCTATATTAGTGGTAGGCAT CCTACCACTAATATAGAT/TAAGTAGATTGATTCACGA CTCAGTTGTTAAAAAAA/AAAATTTGAAGGCCAAGTGGG CTTGCCTTCAAATTTT/TTTTTTTAACAACTGAGTAATGC GGCGGCAAGCTTGGGAGGATG GAGGGCTCGAGCCTTCTTCACC GGCACTCGAGGGAGGATGGGGAG

Primer position (59- to 39-)

1028–1047 1296–1318 175 to 192 21543 to 21519 2459 to 2440 2379 to 2360 2150 to 2171 2199 to 2181/262 to 243 248 to 262/2172 to 2204 130 to 16 2344 to 2328/2179 to 2160 2162 to 2179/2328 to 2348 2492 to 2478/2326 to 2307 2312 to 2326/2478 to 2497 2315 to 2299/2291 to 2272 2275 to 2292/2299 to 2318 2114 to 298/287 to 268 272 to 287/298 to 2120 2659 to 2639 134 to 113 2656 to 2634

a

Sequences of p67 cDNA (10). Sequences of reverse complement of the p67 cDNA (10). Primer used for the primer extension reaction. d Reverse complements of the 59-upstream region of the p67-genomic DNA (Fig. 1). e Primers used for overlap extension PCR for specific internal deletions. b c

Cell Culture The cloned cell-line KRC-7 (a rat hepatoma cell-line; a gift from Dr. J. Koontz, University of Tennessee, Knoxville) was cultured in Dulbecco’s modified Eagle’s medium (Life Technologies, Inc.) supplemented with 5% (v/v) fetal calf serum, 5% (v/v) calf serum, 100 units/ml penicillin, 50 mg/ml streptomycin, and 10 mM sodium pyruvate at 37 °C with 5% CO2.

Preparation of Different Deleted p67 59-Upstream Region Constructs Different deleted p67 59-upstream regions were prepared using PCR and in some cases followed by nested deletions. The DNA sequences were purified and subsequently subcloned into the XhoI and HindIII sites located upstream of the promoterless luciferase gene in the pGL3basic vector (Promega) to generate the pGL3-deleted p67 59-upstream region constructs. Table II describes different DNA templates and primer combinations used. Fig. 3 describes the deleted constructs. The preparations of individual constructs are described below. 59-Sequential Deletion—(i) PCR, pGL321531/124, pGL32652/124, pGL32454/124, and pGL32366/124 were prepared by PCR. For preparation of pGL321531/124, one forward primer (primer D; Table I) with an XhoI site and a reverse primer (primer H; Table I) with a HindIII site were synthesized. These two primers and the pGEM7– 1.7-kb 59-upstream region template were used to amplify the fragment using Taq DNA polymerase. The PCR-amplified product was purified by Wizard PCR Prep (Promega) and was digested with XhoI and HindIII. The digested fragment was purified and subsequently subcloned into the XhoI and HindIII sites located upstream of the promoterless luciferase gene in the pGL3-basic vector (Promega) to generate the pGL321531/124 construct. The DNA sequence was confirmed by Sanger’s dideoxynucleotide chain termination method (11) using Sequencing II kit (USB). The experimental procedures for the preparation of pGL32652/124, pGL32454/124 and pGL32366/124 were the same as described above. The primers used were pGL32652/124, primer X 1 primer H; pGL32454/124, primer L 1 primer H and pGL32366/124, primer F 1 primer H. (ii) PCR followed by nested deletion, pGL32271/124, pGL32177/ 124 and pGL3260/124. pGL32652/124 was prepared as described as above (i). This DNA construct was subjected to nested deletion by using the Erase-A-Base system (Promega) and standard procedures. Promoter in Reverse Orientation—pGL3 reverse 2652/124. Reverse orientation of the promoter in the expression vector was obtained by creating a HindIII site at the 59-end and XhoI site at the 39-end by PCR using primer S and primer T (Table II). During ligation, the promoter

was inserted in the reverse orientation of the pGL3 basic vector. 39-Deletion—pGL32652/2156. The 39-deleted construct was generated by PCR. The primers X and G were used (Table II). The amplified fragment was digested, purified, and subcloned. Internal Deletions—pGL3D2180/260, pGL3D2327/2179 and pGL3D2477/2326. The PCR overlap-extension technique of Pease and co-workers (13) was utilized to create the specific internal deletions (Fig. 3, panel D). Initially, two different PCR products were synthesized. For preparation of pGL3D2180/260, the primers used were as follows: reaction 1, primer X and primer I (deletion at 260 to 2180 nucleotides in reverse orientation, Table I); reaction 2, primer J (deletion at 2180 to 260 nucleotides in the forward orientation, Table I) and primer H. The two PCR products were mixed and fused together. The fused products were amplified with primer X and primer H. Details are given in Table II. The amplified DNA was subcloned into pGL3 basic vector. The procedures for preparation of pGL3D2327/2179 and pGL3D2477/2326 were the same as described above. Details are given in Table II. In both cases, the fused products were amplified with primer X and primer H. The amplified DNA was subcloned into pGL3 basic vector. Sequence-specific Deletions—pGL3DAP-1 (2298 to 2292), pGL3DAP1-like (297 to 288), and pGL3DAP-1 (2298 to 2292)/DAP-1-like (297 to 288). Selective deletion(s) of the two putative PMA-responsive sequences were also performed using the overlapping PCR technique as mentioned above. The specific primers (Table I) were designed to eliminate the AP-1 sequence at 2298 to 2292 or the AP-1-like sequence at 297 to 288 or both (Table II) (Fig. 3, panel E).

Transient Transfection Approximately, 3 3 106 KRC-7 cells were transiently transfected with different promoter construct by lipopolyamide-mediated transfection (LipofectAMINETM, Life Technologies, Inc.) according to standard procedure. The constitutive expression vector (5 mg of pSV-b galactosidase from Promega) for b-galactosidase was included in the DNA mixture as a marker for transfection efficiency (14). The cells were harvested 48 h after transfection and assayed for luciferase and b-galactosidase activities.

Treatment of Cells for PMA Induction The cells were transiently transfected with different deletion mutants and were serum-starved by replacing the transfection medium with serum-free medium after 8 h post-transfection. The transfected cells were then treated with 1.5 mM PMA for 2 h before harvesting them.

12694

p67 Promoter Analysis

TABLE II Templates and primers used for preparation of different deleted p67 59-upstream regions In case of D and E, overlapping PCR technique was used. Initial PCR products were obtained by using two primers as mentioned in parentheses. Initial PCR products were fused together and amplified with primers X and H. All the final PCR products were gel-purified and cleaved with XhoI and HindIII. The resulting products were again purified and subcloned into XhoI/HindIII-digested pGL3 basic vector. Proper deletions were confirmed by DNA sequencing of the constructs. Template

Primers

A, 59-Sequential deletions pGEM7–1.7-kb DNA pGEM7–1.7-kb DNA pGEM7–1.7-kb DNA pGEM7–1.7-kb DNA B, Reverse orientation pGEM7–1.7-kb DNA C, 39-deletion pGEM7–1.7-kb DNA D, Internal deletions pGEM7–1.7-kb DNA pGEM7–1.7-kb DNA pGEM7–1.7-kb DNA E, Sequence-specific deletions pGEM7–1.7-kb DNA pGEM7–1.7-kb DNA DAP-1-like

Primer Primer Primer Primer

D 1 primer H X 1 primer H E 1 primer H F 1 primer H

21531/124 2652/124 2454/124 2366/124

Primer S 1 primer T

Reverse 2652/124

Primer X 1 primer G

2652/2156

(Primer X 1 primer I) 1 (primer J 1 primer H) (Primer X 1 primer K) 1 (primer L 1 primer H) (Primer X 1 primer M) 1 (primer N 1 primer H) (Primer X 1 primer O) 1 (primer P 1 primer H) (Primer X 1 primer Q) 1 (primer R 1 primer H) (Primer X 1 primer O) 1 (primer P 1 primer H)

Luciferase and b-Galactosidase Assays The luciferase activity was measured by the luciferase assay kit (Promega) essentially according to the manufacturer’s instructions. The cells were harvested after 48 h post-transfection and lysed in reporter lysis buffer (Promega). Aliquots were used for luciferase and b-galactosidase assays. Cell extracts from untransfected cells and from cells transfected with the pGL3 basic vector alone without the 2652/124 inserted sequence were used as negative controls. Luciferase activities were determined by mixing lysates with luciferase assay buffer containing luciferin, Mg21, and ATP at room temperature and were analyzed immediately by a scintillation counter (15–16). The b-galactosidase activity was analyzed using a commercial enzyme assay system (Promega) at 420 nm. The luciferase activity was normalized with the b-galactosidase activity. The relative luciferase values are the average of three independent experiments. The mean of the luciferase activities relative to pGL3 basic activity 6 S.D. are presented in all the figures. RESULTS

Isolation and Characterization of Rat p67 Genomic Clone A total of 2 3 105 plaques from a genomic DNA library were screened using a 290-bp 32P-labeled rat p67 cDNA probe. One positive plaque was isolated after three rounds of rescreening. The phage was amplified in Escherichia coli following the standard procedure. The phage DNA was isolated. The DNA was digested with BamHI and analyzed by Southern blotting. A 1.7-kb fragment from the 59-end of the gene was identified. This fragment was later subcloned into pGEM 7Zf(1) and amplified.

Sequence Analysis of the 59-Upstream Region The sequence of the 1.7-kb DNA fragment was determined following the Sanger’s dideoxy method (11) (Fig. 1). The 59-end of the upstream region containing 898 base pairs was identical to several LINE sequences (17–19), and 148 base pairs of the 39-end contained the beginning of the first exon including the ATG initiation codon. In between these two regions is the proximal promoter of the p67 genome (652 base pairs). The promoter region contains two potential TATA-like sequences between 240 and 220 and several regulatory sequences (underlined in Fig. 1).

Determination of Transcriptional Initiation Site by Primer Extension The results of a primer extension experiment using total RNA from KRC-7 cells and a 18-base oligonucleotide primer

Modified p67 59-upstream region

D2180/260 D2327/2179 D2477/2326 DAP1(2298 /2292) DAP-1 like (297/288) DAP1 (2298/2292) DAP-1-like (297/288)

(primer C, Table I) are shown in Fig. 2. A DNA fragment was detected corresponding to a position 89 bases upstream to the ATG codon (Fig. 2, lane 2). No extended signal was observed with yeast tRNA (Fig. 2, lane 1). From the sequence analysis, it was determined that the transcription start site was located about 25 bases downstream from the proximal TATA-like element (Fig. 1).

Promoter Activity of the 59-Upstream Region of the p67 Gene To determine the promoter region responsible for transcriptional regulation, KRC-7 cells were transiently transfected with the p67 59-upstream promoter sequence (21531 to 124 bp) and also different deleted promoter constructs fused upstream to a luciferase reporter gene (Fig. 3). The promoter activities were then determined by analysis of luciferase expression in the transfected cell extracts. The luciferase activity was normalized with the b-galactosidase activity in the same cell extracts. The normalized luciferase expressions in cells transfected with different pGL3 constructs (1 promoter) and pGL3 basic (2 promoter) were compared. The fold increase (3 fold) with pGL3 constructs (1 promoter) over the pGL3 basic (2 promoter) is presented in different figures. Identification of the Promoter Region—Transfection of pGL321531/124 construct into KRC-7 cells resulted in a 10fold increase in luciferase expression, and pGL32652/124 resulted in an 11-fold increase in luciferase expression over the promoterless pGL3 basic construct. When the promoter region was put in reverse orientation (pGL3 reverse 2652/124), no luciferase activity was observed indicating the directionality of the promoter (Fig. 4, panel A). These results suggest that the promoter region lies between 2652 and 124. Functional Analysis of the p67 Promoter Using Sequential Deletions—To locate the region essential for transcription activation, a series of deletion constructs of the promoter region were prepared and were used to transfect KRC-7 cells. The results are shown in Fig. 4, panel B. The lysates of the cells transfected with pGL32454/124 (panel B, 1st bar) showed a slight but significant decrease in luciferase expression compared with pGL32652/124 (panel A, 4th bar). Further deletions to 2366, 2277, and 2177 caused decrease in luciferase expression. However, 80% maximum luciferase expression (pGL32652/124) was retained even when deletion was ex-

p67 Promoter Analysis

12695

FIG. 1. The nucleotide sequence of a 1.7-kb DNA containing a segment of the 5*-upstream region of the rat p67 gene. The nucleotide sequences were determined following Sanger’s dideoxy method (11). The numbers represent the nucleotide position relative to the transcription initiation site (11). The translation initiation codon ATG is presented in bold and at position 189. The LINE sequences are boxed. The putative DNA binding sequences like AP-1, AP-3, SP-1, heat-shock element and others are underlined. The purine-rich direct repeat is indicated by the double underline. This sequence has been submitted to GenBank with accession number U37710.

FIG. 2. Identification of the transcription initiation site of the rat p67 gene using primer extension analysis. The end-labeled 18-nucleotide primer C (Table I) was hybridized at 65 °C to 10 mg of yeast tRNA (lane 1) or total RNA from KRC-7 cells (lane 2) and then extended using reverse transcriptase at 42 °C for 60 min. The primer extended product was run on an 8% sequencing gel alongside a dideoxy sequencing reaction of the p67 genomic clone. As the sequencing primer was the same as that of the primer extension reaction, the antisense strand is shown. Exposure time was 18 h with intensifying screens.

tended to 2177 (panel B, 4th bar). Further decrease to 260 (pGL3260/124, panel D, 5th bar) led to drastic reduction (8fold) in luciferase expression. These results suggest that the nucleotide sequence between 2177 to 260 is essential for basal transcription. Consistent with the above suggestion, it was observed that the 39-deleted construct pGL32652/2156 (Fig. 3, panel C) did not promote luciferase expression (panel B, 5th bar). Functional Analysis of the p67 Promoter Using Internal Deletions—To further define the cis regulatory regions, internal deletions were performed (Fig. 3, panel D). The results of this experiment are shown in Fig. 4, panel C. The luciferase expression from cell lysates transfected with pGL3D2180/260 suggests that the essential promoter region of the p67 gene lies

between 2180 and 260 (panel C). This result also correlates with the previous result in panel B. The luciferase expression was drastically reduced when transfected with pGL3D2180/ 260. These results, in agreement with the results shown in Fig. 4 (panel B, 4th and 5th bars), suggest that the essential promoter region lies between 2180 and 260. As shown in panel C, the luciferase expression was not significantly reduced when transfected with pGL3D2377/2179 and was increased when transfected with pGL3D2477/2326. The results suggest that this region (2477 to 2326) may not be necessary for p67 transcription. The reason for an increase in pGL3D2477/2326 is not clear and may indicate the presence of a negative regulatory element.

PMA Induction of the p67 Promoter The effects of PMA addition on p67 promoter were studied using both confluent (Fig. 5, panel A) and serum-starved (Fig. 5, panel B) KRC-7 cells. PMA did not significantly enhance the promoter activity in confluent cells (panel A, 5th and 6th bars). The promoter activity was significantly reduced upon serum starvation (panel B, 5th bar). However, addition of PMA to these serum-starved cells significantly enhanced (;50-fold) p67 promoter activity (panel B, 5th and 6th bars).

Identification of the PMA-responsive Sequences in the p67 Promoter Initially, we used different p67 constructs described in Fig. 3 and determined the promoter activity with or without PMA. In several cases examined (Fig. 6, panels A–C), the results were qualitatively the same. However, as shown in the absence of PMA, the luciferase expression in pGL32652/2156 (panel B, 11th bar) and pGL3D2180/260 (panel C, 1st bar) were reduced

12696

p67 Promoter Analysis

FIG. 4. Transient transfection assay for p67 promoter. The details have been described under “Experimental Procedures.” Panel A, 1st bar, KRC-7 cells alone. Other bars in panels A–C indicate KRC-7 cells transfected with different constructs.

FIG. 3. Preparation of different p67 5*-upstream region constructs. The details of the constructs have been described under “Experimental Procedure.” Panel A, sequential deletions; panel B, the promoter in reverse orientation; panel C, 39-deletion; panel D, internal deletions; and panel E, internal deletions of the PMA-responsive sequences in the p67 promoter.

to less than 25% maximum expression (panel A, 5th bar). In the presence of PMA, the luciferase expression remained essentially the same in pGL32652/2156 (panel B, 12th bar) but increased significantly in pGL3D2180/260 (panel C, 2nd bar). This construct (pGL3D2180/260) contains the AT-rich region not present in pGL32652/2156. These results suggest that (i) the AT-rich region in pGL3D2180/260 construct and (ii) other possible PMA-responsive sequences in this construct (pGL3D2180/260) are necessary for PMA induction. To identify the PMA-responsive sequences, we prepared different constructs deleting specific nucleotide sequences. Fig. 3 describes the preparations of three such constructs with deletions at an AP-1 (2298 to 2292) and/or an AP-10-like (297 to 288) element. Fig. 7 shows the effects of such deletions on luciferase expression. The wild type promoter (pGL32652/ 124) was used as a control. Upon PMA addition, this promoter enhanced luciferase expression approximately 6-fold (5th and 6th bars). Deletions at the AP-1 element (2298 to 2292) (7th and 8th bars) and the AP-1-like element (297 to 288) (9th and 10th bars) significantly reduced luciferase expression. When

FIG. 5. Effect of PMA on the p67 promoter. The details have been described under “Experimental Procedures.” Panel A, confluent cells; panel B, serum-starved cells. The bars in each panel indicate: 1st, KRC-7; 2nd, KRC-7 1 PMA; 3rd, KRC-7 transfected with pGL3 basic; 4th, KRC-7 transfected with pGL3 basic 1 PMA; and 5th, KRC-7 transfected with pGL32652/124; and 6th, KRC-7 transfected with pGL32652/124 1 PMA.

both of these sequences were deleted, PMA enhancement of luciferase expression was almost totally eliminated (11th and 12th bars). DISCUSSION

In this paper, we describe cloning and characterization of a 1.7-kb DNA fragment containing a segment of the 59-upstream region of the p67 gene. Some significant observations are as follows. The 39-end of the DNA fragment is part of the first exon. The transcription start site was located 89 bases upstream from the initiator codon and was marked as 11. No classical TATA element (20) was detected at the expected position. Two ATrich regions were present between 240 and 220. Similar ATrich regions are also present in c-jun (21). In several cases reported (22–24), these AT-rich regions function similarly like TATA sequence. The 59-upstream region contains LINE sequence (17–19) from 21549 to 2652. The LINEs are defined as a major family of long interspersed nucleotide elements present in the genome of humans, primates, and rodents. The functions of these LINEs (if any) in gene expression are not known. The 652 bp between the end of the LINE sequence and the

p67 Promoter Analysis

12697

FIG. 6. Effect of PMA on the deleted p67 promoters. The experimental procedures were the same as described in Fig. 5. The KRC-7 cells were transfected with different constructs as indicated. The light bars indicate luciferase expression in confluent cells without PMA. The dark bars indicate luciferase expression in serum-starved cells with PMA.

FIG. 7. Identification of the active PMA-responsive sequences. The experimental procedures were the same as described in Fig. 5. The p67 promoter (pGL32652/124) and different internally deleted promoters (Fig. 3, panel E) were used to transfect KRC-7 cells.

transcription start site is the promoter region of the p67 gene. A DNA sequence containing this promoter region (2652 to 124) was inserted upstream of the promoterless luciferase gene in the pGL3 basic vector. When transfected into confluent KRC-7 cells, this construct produced an 11-fold increased luciferase expression over that observed with the pGL3 basic vector. This promoter region contains multiple cis-acting elements. Some of these elements that differ by no more than 1 base pair from the consensus sequences of known regulatory elements are listed as follows: Ets-like element (20) at 2645 to 2639; SP-1-like elements (20, 25) at 2609 to 2600 and at 2486 to 2478; Oct-like element (20) at 2500 to 2493; CArG-like element (26) at 2410 to 2401, heat-shock element (27) at 2326 to 2310, AP-1 element (20) at 2298 to 2292; AP-3 element (20) at 2142 to 2132; and AP-1-like sequence (21) at 297 to 288. Using different deletion mutants, we mapped the minimum essential region located between 2177 and 260. A purine-rich direct repeat was located at 2167 to 2144 in the essential promoter region. This sequence includes an 11-base pair direct repeat of 59-AACARAAGAA -39 (R 5 purine). The relevance of this region, at present, is unclear. In human c-FOS gene, an 8-base pair direct repeat is apparently important in promoting the basal level of expression of the gene. This sequence is not

required for PMA induction (28). In addition to the direct repeat, this essential region contain one AP-1-like sequence (297 to 288) and an AP-3-like sequence (2142 to 2132). Although the essential promoter region is necessary for basal transcription, other regulatory elements may also be used to induce transcription under different physiological conditions. In this work, we observed that addition of a mitogen, PMA, to the serum-starved KRC-7 cells increased transcription by 50fold. Using different deletion mutations, we provide evidence that an AP-1 sequence (2298 to 2292) and one AP-1-like sequence (297 to 288) are necessary for this induced transcription. The functional assays indicate that the AP-1-like element at 297 confers the strongest response to PMA and the classical AP-1 is next. However, to achieve maximal PMA response, both the elements must be present. These results suggest cooperation among the PMA-responsive elements. PMA also induces expression of a number of cellular genes (29 –31). It is not clear whether different genes use common or distinct elements. Several cellular proteins such as the AP-1 (32–34), NF-kB (35–36), or novel nuclear factors (37) have been implicated in this induction. In our studies, we observed high levels of PMA induction in KRC-7 cells transfected with pGL32652 construct only in serum-starved cells. We did not observe significant PMA induction in confluent cells. It is not clear whether this difference is due to the presence of a labile inhibitor (38) or the presence of CArG element that may act as a repressor in the presence of serum (39). Several promoters for translational initiation factors eIF-2a (40), eIF-4A (41), and eIF-4E (42) have been reported. eIF-4E promoter has several c-myc regulatory elements (42) and eIF-2a has one (40). Both these genes are regulated by c-myc (43). eIF-4E gene also has a potential p53-binding element (42). The p67 promoter does not contain either c-myc or p53-binding element. On the other hand both p67 promoter (Fig. 1) and eIF-2a promoter contain heat shock element. A past report has indicated that eIF-2a is a heat shock protein (44). Recent work in our laboratory has indicated that p67 level in the cell is also significantly increased upon heat shock.2 Another interesting difference is that whereas the p67 promoter has only 35% G 1 C, the other initiation factor promoters contain at least 52% G 1 C (40 – 42, 45). Also, the p67 promoter has two AT-rich regions. This promoter lacks the CAAT element. The eIF-4A promoter has one classical TATA and CAAT elements. These sequences are absent in eIF-2a or eIF-4E promoters. Another interesting difference is that whereas p67 gene contains a single transcription start site, eIF-2a or eIF-4A contains multiple transcription start sites.

2

M. Chatterjee, unpublished observations.

12698

p67 Promoter Analysis REFERENCES

1. Gupta, N. K., Datta, B., Ray, M. K., and Roy, A. L. (1993) Translational Regulation in Gene Expression (Ilan, J., ed) pp. 287–334, Plenum Publishing Corp., New York 2. Hershey, J. W. B. (1991) Annu. Rev. Biochem. 60, 717–755 3. London, I. M., Levin, D. H., Matts, R. L., Thomas, N. S. B., Petryshyn, R., and Chen, J. J. (1987) in The Enzymes (Boyer, P. D., and Krebs, E. G., eds) Vol. XVII, 3rd Ed., pp. 359 –380, Academic Press, New York 4. Datta, B., Chakrabarti, D., Roy, A. L., and Gupta, N. K. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 3324 –3328 5. Datta, B., Ray, M. K., Chakrabarti, D., Wylie, D. E., and Gupta, N. K. (1989) J. Biol. Chem. 264, 20620 –20624 6. Ray, M. K., Datta, B., Chakrabarty, A., Chattopadhyay, A., Meza-Keuthen, S., and Gupta, N. K. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 539 –543 7. Chakraborty, A., Saha, D., Bose, A., Chatterjee, M., and Gupta, N. K. (1994) Biochemistry 33, 6700 – 6706 8. Gupta, S., Wu, S., Chatterjee, N., Ilan, J., Ilan, J., Osterman, J. C., and Gupta, N. K. (1995) Gene Expr. 5, 113–122 9. Gupta, S., Bose, A., Chatterjee, N., Saha, D., Wu, S., and Gupta, N. K. (1997) J. Biol. Chem. 272, 12699 –12704 10. Wu, S., Gupta, S., Chatterjee, N., Hileman, R. E., Kinzy, T. G., Denslow, N. D., Merrick, W. C., Chakrabarti, D., Osterman, J. C., and Gupta, N. K. (1993) J. Biol. Chem. 268, 10796 –10801 11. Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc. Natl. Acad. Sci. U. S. A. 74, 560 –564 12. Chomczynski, P., and Sacchi, N. (1987) Anal. Biochem. 162, 156 –159 13. Ho, S. N., Hunt, H. D., Horton, R. M., Pullen, J. K., and Pease, L. R. (1989) Gene (Amst.) 77, 51–59 14. deWet, J. R., Wood, K. V., DeLuca, M., Helinski, D. R., and Subramani, S. (1987) Mol. Cell. Biol. 7, 725–737 15. deWet, J. R., Wood, K. V., Helinski, D. R., and DeLuca, M. (1986) Methods Enzymol. 133, 3–14 16. Wampler, S. L., Tyree, C. M., and Kadonaga, J. T. (1990) J. Biol. Chem. 265, 21223–21231 17. D’Ambrosio, E., Waitzkin, S. D., Witney, F. R., Salemme, A., and Furano, A. V. (1986) Mol. Cell. Biol. 6, 411– 424 18. Frischauf, A. M., Lehrack, H., Poustka, A., and Murray, N. (1983) J. Mol. Biol. 170, 827– 842 19. Fanning, T. G., and Singer, M. F. (1987) Biochim. Biophys. Acta 910, 203–212 20. Faisst, S., and Mayer, S. (1992) Nucleic Acids Res. 20, 3–26 21. Hattori, K., Angel, P., LeBeau, M. M., and Karin, M. (1988) Proc. Natl. Acad.

Sci. U. S. A. 85, 9148 –9152 22. Kawakami, K., Masuda, K., Nagano, K., Ohkuma, Y., and Roeder, R. G. (1996) Eur. J. Biochem. 237, 440 – 446 23. McCoubrey, W. K., Jr., Cooklis, M. A., and Maines, M. D. (1995) Gene (Amst.) 160, 235–240 24. McCoubrey, W. K., Jr., and Maines, M. D. (1994) Gene (Amst.) 139, 155–161 25. Kadonaga, J. T., Jones, K. A., and Tjian, R. (1986) Trends Biochem. 11, 20 –23 26. Miwa, T., Boxer, L. M., and Kedes, L. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 6702– 6706 27. Amin, J., Ananthan, J., and Voellmy, R. (1988) Mol. Cell. Biol. 8, 3761–3769 28. Fisch, T. M., Prywes, R., and Roeder, R. G. (1987) Mol. Cell. Biol. 7, 3490 –3502 29. Greenberg, M. E., and Ziff, E. B. (1984) Nature 311, 433– 438 30. Imbra, R. J., and Karin, M. (1986) Nature 323, 555–558 31. Comb, M., Birnberg, N. C., Seasholtz, A., Herbert, E., and Goodman, H. M. (1986) Nature 323, 353–356 32. Lamph, W. W., Wamsley, P., Sassone-Corsi, P., and Verma, I. M. (1988) Nature 334, 629 – 631 33. Angel, P., Baumann, I., Stein, B., Delius, H., Rahmsdorf, H. J., and Herrlich, P. (1987) Mol. Cell. Biol. 7, 2256 –2266 34. Karin, M., Haslinger, A., Holtgreve, H., Richards, R. I., Krauter, P., Westphal, H. M., and Beato, M. (1984) Nature 308, 513–519 35. Kuprash, D. V., Osipovich, O. A., Pokholok, D. K., Alimzhanov, M. B., Biragyn, A., Turetskaya, R. L., and Nedospasov, S. A. (1996) J. Immunol. 156, 2465–2472 36. Muller, S., Kammerbauer, C., Simons, U., Shibagaki, N., Li, L. J., Caughman, S. W., and Degitz, K. (1995) J. Invest. Dermatol. 104, 970 –975 37. Zhang, Z., Hocker, M., Koh, T. J., and Wang, T. C. (1996) J. Biol. Chem. 271, 14188 –14197 38. Auwerx, J., and Sassone-Corsi, P. (1991) Cell 64, 983–993 39. Rivera, V. M., Sheng, M., and Greenberg, M. E. (1990) Genes Dev. 4, 255–268 40. Humbelin, M., Safer, B., Chiorini, J. A., Hershey, J. W., and Cohen, R. B. (1989) Gene (Amst.) 81, 315–324 41. Nielsen, P. J., and Trachsel, H. (1988) EMBO J. 7, 2097–2105 42. Jones, R. M., Branda, J., Johnston, K. A., Polymenis, M., Gadd, M., Rustgi, A., Callanan, L., and Schmidt, E. V. (1996) Mol. Cell. Biol. 16, 4754 – 4764 43. Rosenwald, I. B., Rhodes, D. B., Callanan, L. D., Isselbacher, K. J., and Schmidt, E. V. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 6175– 6178 44. Colbert, R. A., Hucul, J. A., Scorsone, K. A., and Young, D. A. (1987) J. Biol. Chem. 262, 16763–16766 45. Jacob, W. F., Silverman, T. A., Cohen, R. B., and Safer, B. (1989) J. Biol. Chem. 264, 20372–20384