© 2010 John Wiley & Sons A/S

Clin Genet 2011: 79: 60–70 Printed in Singapore. All rights reserved

CLINICAL GENETICS doi: 10.1111/j.1399-0004.2010.01498.x

Original Article

Clinical, biochemical and molecular characterization of peroxisomal diseases in Arabs Shaheen R, Al-Dirbashi OY, Al-Hassnan ZN, Al-Owain M, Makhsheed N, Basheeri F, Seidahmed MZ, Salih MAM, Faqih E, Zaidan H, Al-Sayed M, Rahbeeni Z, Al-Sheddi T, Hashem M, Kurdi W, Shimozawa N, Alkuraya FS. Clinical, biochemical and molecular characterization of peroxisomal diseases in Arabs. Clin Genet 2011: 79: 60–70. © John Wiley & Sons A/S, 2010 Peroxisomes are single membrane-bound cellular organelles that carry out critical metabolic reactions perturbation of which leads to an array of clinical phenotypes known as peroxisomal disorders (PD). In this study, the largest of its kind in the Middle East, we sought to comprehensively characterize these rare disorders at the clinical, biochemical and molecular levels. Over a 2-year period, we have enrolled 17 patients representing 16 Arab families. Zellweger-spectrum phenotype was observed in 12 patients and the remaining 5 had the rhizomelic chondrodysplasia punctata phenotype. We show that homozygosity mapping is a cost-effective strategy that enabled the identification of the underlying genetic defect in 100% of the cases. The pathogenic nature of the mutations identified was confirmed by immunofluorescence and complementation assays. We confirm the genetic heterogeneity of PD in our population, expand the pool of pathogenic alleles and draw some phenotype/genotype correlations. Conflict of interest

None declared.

R Shaheena∗ , OY Al-Dirbashia,b,k∗ , ZN Al-Hassnanc,j , M Al-Owainc , N Makhsheedd , F Basheerie , MZ Seidahmedf , MAM Salihe , E Faqihg , H Zaidanc , M Al-Sayedc , Z Rahbeenic , T Al-Sheddia , M Hashema , W Kurdih , N Shimozawai and FS Alkurayaa,e,j a Department

of Genetics, King Faisal Specialist Hospital and Research Center, Riyadh, Saudi Arabia, b Ontario Newborn Screening Laboratory, Children’s Hospital of Eastern Ontario, Ottawa, ON, Canada, c Department of Medical Genetics, King Faisal Specialist Hospital and Research Center, Riyadh, Saudi Arabia, d Jahra Hospital, Jahra, Kuwait, e Department of Pediatrics, King Khalid University Hospital and College of Medicine, King Saud University, Riyadh, Saudi Arabia, f Department of Pediatrics, Security Forces Hospital, Riyadh, Saudi Arabia, g Department of Pediatrics, King Fahad Medical City, Riyadh, Saudi Arabia, h Department of Obstetrics and Gynecology, King Faisal Specialist Hospital and Research Center, Riyadh, Saudi Arabia, i Division of Genomics Research, Life Science Research Center, Gifu University, Gifu, Japan, j Department of Anatomy and Cell Biology, College of Medicine, Alfaisal University, Riyadh, Saudi Arabia, and k Department of Pediatrics, University of Ottawa, Ottawa, ON, Canada ∗ These

two authors contributed equally to this work. Key words: bifunctional – homozygosity mapping – peroxisomal – splice site mutation – very long-chain fatty acid – founder mutation Corresponding author: Fowzan S Alkuraya, MD, Developmental Genetics Unit,

60

Peroximal diseases in Arabs Department of Genetics, King Faisal Specialist Hospital and Research Center, MBC 03, Riyadh 11211, Saudi Arabia. Tel.: +966 1 442 7875; fax: +966 1 442 4585; e-mail: [email protected] [PO Box 3354] Received 10 May 2010, revised and accepted for publication 25 June 2010

Peroxisomes are single membrane-bound organelles that are unique to eukaryotic cells. A number of critical metabolic processes take place in these subcellular compartments including synthesis, fatty acid oxidation and peroxide detoxification. Compounds known to be synthesized in peroxisomes include bile acids and plasmalogen, the latter being an important component of myelin. While β-oxidation of fatty acids occurs in both mitochondria and peroxisomes, very longchain fatty acids and branched-chain fatty acids [e.g. hexacosanoic acid (C26:0) and pristanic acid, respectively] are known to be exclusively oxidized in peroxisomes before being transported to the mitochondria. This diverse metabolic profile explains the significant clinical consequences of defective peroxisomes (1). Peroxisomal disorders (PD), first defined biochemically in 1982, are conventionally classified as peroxisomal biogenesis disorders (PBDs) and single enzyme deficiency disorders (PED) (2, 3). In PBD, peroxisomes fail to assemble normally because of defects in their membrane proteins or their ability to import proteins into their matrix. Zellweger syndrome, neonatal adrenoleukodystrophy and infantile Refsum’s disease are the three classical PBD and all have in common ‘severe peroxisomal phenotype’ in the form of facial dysmorphism, profound neurological impairment and variable degree of hepatic, retinal, renal and adrenal insufficiency. Although characterized by multiple peroxisomal deficiencies, rhizomelic chondrodysplasia punctata type I (RCDP I), in which rhizomelic shortening of long bones with stippling of epiphysis are typical features, is not a classical PBD because peroxisomes appear structurally intact and very long-chain fatty acid (VLCFA) oxidation is normal. PED, on the other hand, are characterized by single enzyme deficiencies the clinical consequence of which range from ‘severe peroxisomal phenotype’ as in D-bifunctional enzyme deficiency to a specific variant phenotype as in hyperoxaluria (4).

The significant genetic and allelic heterogeneity of these disorders often complicates the molecular diagnosis unless aided by the laborious complementation assay which is only available in very few laboratories around the world. We have recently showed the power of homozygosity mapping as a diagnostic technique in genetically heterogeneous autosomal recessive disorders in consanguineous populations (5–7). In this study, we expand the utility of this technique to the study of PBD in Arabs and supplement the results of our molecular analysis with functional data and review the clinical data for phenotype/genotype correlation. Material and methods Human subjects

This is a prospective study of patients with PBD, including RCDP, who were referred to our laboratory for peroxisomal biochemical assays. All patients with abnormal levels of VLCFA, pristanic and/or phytanic acid or clinical picture of RCDP between April 2008 and February 2010 were recruited. Written informed consent was obtained from the parents of each subject under an IRB approved protocol at King Faisal Specialist Hospital and Research Center (KFSHRC) (RAC # 2080033). Clinical information was provided by the referring physicians. Biochemical analysis

VLCFA, pristanic and phytanic acid levels and ratios were determined on plasma samples as described before (8). Plasmalogen level determination was outsourced to a major commercial diagnostic lab. Complementation, microscopic and immunoblot analysis

Skin biopsies were collected from all except RCDP patients for complementation and immunofluorescence assays. Peroxisomes in fibroblast were 61

Shaheen et al.

stained using antibodies to a 70 kDa peroxisomal integral membrane protein (PMP70) as a marker for membrane, and to catalase and D-bifunctional protein (DBP) as a marker for matrix proteins, and then visualized by indirect immunofluorescence microscopy (9). Complementation analysis was performed as previously described (10). Immunoblot analysis of DBP was performed as previously described (11). DNA and RNA extraction

Blood was collected in EDTA tubes and PAXGene tubes from the affected patients. Following the manufacturer’s instructions, DNA extraction from EDTA tubes was carried out using the Gentra DNA Extraction Kit and RNA was extracted from the PAXgene tubes using Qiagen miniRNA extraction kit (Qiagen, Germantown, MD). Occasionally, DNA and/or RNA were extracted from skin fibroblasts when blood samples were unavailable.

the cDNA was carried out using the iScript™ cDNA synthesis kit and random primers (Applied Biosystems, Carlsbad, CA). Primers spanning two neighboring exons, which will specifically amplify from the cDNA, were used to amplify the appropriate cDNA fragment. PCR products were then evaluated on 2% agarose gel and were purified using the QIAquick PCR Purification Kit according to the manufacturer’s instructions (Qiagen, Germantown, MD) and then sequenced as described above. Missense mutations were verified by sequencing 192 Saudi controls (384 chromosomes) and by checking for conservation at the protein level using multiple alignment tool (http://blast.ncbi.nlm.nih.gov/Blast.cgi). The residue conservation was visualized using UCSF Chimera program (http://www.cgl.ucsf.edu/ chimera/). Results Clinical presentation

Homozygosity mapping

DNA samples were processed on the Affymetrix Gene Chip Human Mapping 250K array (Affymetrix, Santa Clara, CA) following the manufacturer’s instruction. Genotypic data generated were used for homozygosity mapping using Affymetrix Genotyping Console software (GTC) which utilizes the Birdseed algorithm and CNAG software which utilize a DM algorithm for the detection of runs of homozygosity (ROH) as described before (5). Mutation analysis

Known PBD genes that reside within ROH were selected for polymerase chain reaction (PCR) amplification of the entire coding and flanking intronic regions (up to 200 bp). Primers were also designed to PCR amplify sequencespecific cDNA fragments of PEX16, GNPAT, ACOX1 and HSD17B4 in order to confirm splice site mutations (primers and conditions are available upon request). Direct bidirectional sequencing was performed using BigDye Terminator Cycle Sequencing v3.1 kit and the Prism 3730XL Genetic Analyzer (Applied Biosystems, Carlsbad, CA). Sequences were analyzed using the Seqman II program of the DNASTAR analysis package (Lasergene, Madison, WI). Intronic sequence alterations were evaluated in silico (http://www.fruitfly.org/seq tools/splice.html) and those predicted to affect splicing were further evaluated by two-step RT-PCR. Preparation of 62

A total of 17 patients representing 16 Arab families (two patients were cousins) were included in this study and their clinical data are summarized in Table 1. Consanguinity was reported in 15 families. With the exception of five patients who presented with the clinical phenotype of RCDP, all remaining patients had classical Zellweger-spectrum or ‘severe peroxisomal phenotype’ (Fig. S1 and Table 1). Homozygosity mapping

Most patients had only one ROH that overlaps with candidate peroxisomal genes (range 1–4). All RCDP patients were found to have ROH that overlaps only with GNAPT gene as a candidate RCDP gene. Using this approach, only the gene(s) which falls within ROH was sequenced in each patient (Fig. 1). Mutation analysis

Ten mutations were identified in the 17 patients including five novel ones with a detection rate of 100% (Table 2). Three novel mutations were identified in HSD17B4 which include two missense mutation (p.H515Q and p.L736H) and one indel mutation in the donor site of intron 5 (c.280+3 del) (Fig. 2). The two missense mutations identified in HSD17B4 replace highly conserved amino acid residues and were not observed in 192 ethnically matched controls (Fig. 3). The novel donor splice site mutation in SA-Pt.11

Al-Dirbashi et al. (12) Al-Dirbashi et al. (12) A female infant, who was a product of 35 weeks pregnancy which was complicated by pregnancy induced eclampsia resulting in emergency Cesarean section. She was noted to be floppy at birth with difficulty in feeding and sucking requiring nasogastric tube. At the age of 3 weeks, she had seizures and was treated with Phenobarbital. She had CT of the head that reported diffuse hypodensity of white matter. The parents, who were first cousins, lost a child at 6 months of age with hypotonia and intrahepatic cholestasis. On examination, she was very floppy, lying in a frog leg posture, with a significant head lag. There was no organomegaly. Plasma very long-chain fatty acids analysis was abnormal showing elevated C26, C 24/22, and C 26/22 ratios. Male neonate born at term with normal growth parameters following pregnancy notable for decreased fetal movements. Cyanosis developed on 1st day of life after feeding and was transferred to NICU. Typical Zellweger facies and severe hypotonia. He had elevated liver enzymes and renal cysts. MRI showed mild brain atrophy. Male neonate born at 28 weeks of gestation with normal growth parameters. Typical Zellweger facies, talibes and hypotonia were apparent at birth. He had neonatal seizures (temporal lobe cortical dysplasia), elevated liver enzymes and renal cysts and died at 6 months of age due to aspiration pneuomonia. Two deceased siblings had a similar presentation. A female infant, who was a product of full-term spontaneous vertex delivery with normal Apgars score. She was noted at birth to have severe hypotonia. No history of seizure. Her parents are first cousins and there is no family history of a similar problem. When she was evaluated in our hospital at 16 months of age, she had global developmental delay; cannot sit, roll over, or hear. She had severe generalized hypotonia and was found to have hepatomegaly. Plasma very long-chain fatty acids analysis was abnormal showing elevated C26, C 24/22, and C 26/22 ratios. Male neonate born at term with low birth wt. Typical Zellweger facies, talibes and hypotonia were apparent at birth. Liver enzymes were slightly elevated. MRI brain showed prominent ventricles, widening of the sulci and sylivian fissures and the cerebellar vermis hypoplasia. He died at 8 months of age. Four deceased siblings had a similar presentation. Male neonate, born via C/S due to pre-ecmplasia. Managed in NICU for 2 weeks for low birth weight. Progressive hypotonia noted by parents at 4 months of age, had global developmental delay, facial dysmorphism with high forehead, tented mouth. Had seizures with abnormal EEG. Several hospital admissions for recurrent chest infections. Had high VLCFA with normal phytanic and pristanic acid. Developed hearing loss and blindness due to corneal opacity, and became vegetative, and ventilator dependent. Developed hepatomegaly with normal liver function, and no evidence of adrenal gland insufficiency. Normal brain MRI at 1 year 9 months and brain CT scan at 3 years showed bilateral cerebellar increased hypodensity with no cortical involvement. Died at 3 years 9 months. Female born 12 days earlier. Pregnancy was notable for polyhydramnios and decreased fetal movements. Delivered at 36 weeks due to fetal distress and transferred to NICU due to poor Apgar scores. She had high forehead, high arched palate and severe hypotonia. Severe jaundice was treated with phototherapy. Seizures developed on 5th day of life. MRI showed polymicrogyria and mild brain atrophy. Echo and abdominal ultrasound were normal. Severe adrenal insufficiency was treated with steroid replacement. She is still alive at 7.5 months. Male neonate cousin of SA-Pt.09 born at term following pregnancy notable for polyhydramnios and decreased fetal movements. He had hypotonia, nystagmus and micrognathia. Seizures developed on the 2nd day of life with abnormal EEG. MRI brain was normal. Echo confirmed PDA. Adrenal insufficiency was treated with steroid replacement. He is still alive at 7 months. Female neonate born at term with normal growth parameters. Poor apgar scores and severe hypotonia necessitated NICU admission. She had typical Zellweger facies. Seizures developed at 1 week of age. MRI showed cerebellar vermis hypoplasia and hyperintense globus pallid. No evidence of liver, renal or cardiac involvement. She is still alive at 14 months. 7.5-year old boy with profound global developmental delay. He was referred to us at 3 month of age with severe hypotonia, neonatal seizures, dysmorphism (typical Zellweger facies), cataract and undescended testes. MRI showed temporal lob polymicrogyria. A similarly affected sibling died at 7 m of age. 7-year old girl with profound global developmental delay. She has microcephaly, anteverted nares, brachycephaly, pale optic disc and rhizomelic shortening of all limbs. She has low plasmalogen, high phytanic, and normal VLCFA.

SA-Pt.01 SA-Pt.02 SA-Pt.03

SA-Pt.13

SA-Pt.12

SA-Pt.11

SA-Pt.10

SA-Pt.09

SA-Pt.08

SA-Pt.07

SA-Pt.06

SA-Pt.05

SA-Pt.04

Clinical phenotype

Patient ID

Table 1. Clinical characterization of the patients recruited in this study

Peroximal diseases in Arabs

63

64

EEG, electroencephalogram; FTNSV, full term normal spontaneous vaginal; FTNSVD, full term normal spontaneous vaginal delivery; MRI, magnetic resonance imaging; NICU, neonatal intensive care unit; PDA, patent ductus arteriosus; RBS, random blood sugar; VLCFA, very long-chain fatty acid.

SA-Pt.17

SA-Pt.16

SA-Pt.15

20-month-old girl with congenital cataract, severe failure to thrive and developmental delay. She had microcephaly, spasticity and rhizomelic shortening of upper limbs. Skeletal survey showed short humeri, calcification in the hyoid bone and stippling. Female neonate born at term with normal growth parameters. She was admitted to NICU because of respiratory distress and found to have bilateral choanal atresia which was surgically corrected. She was found to have rhizomelic shortening of her limbs, cataract and flexion deformity of hips and knees. Postaxial polydactyly was present in this patient; however, it was segregating independently of the rhizomelia in the family. Plasmalogen was low but VLCFA was unremarkable. MRI brain was unremarkable. A female infant, a product of FTNSVD, who was noted at birth to have short upper limbs, mainly proximal. At 1 week of age, she was diagnosed to have cataract. Her parents are first cousins. The patient’s first cousin was diagnosed to have RCDP. The skeletal survey revealed stipple ossification in the region of the patella bilaterally with shortening of both humeri. RBS plasmalogens levels were low. Plasmalogens synthesis in cultured fibroblasts was also low. A female infant, was a product of FTNSV. She was noted at birth to have short limbs and dysmorphic features. Examination revealed cataract, long philtrum, frontal bossing, and rhizomelic shortening of upper limbs. Parents are first cousins. They have another child who is similarly affected. Skeletal survey showed large open anterior fontanelle, mid-face hypoplasia, coronal clefts of the thoracolumbar spine, stippled ossifications within the greater trochanters, upper humeri bones, marked shortening of bilateral humeri. Ultrasound abdomen revealed a small echogenic right kidney with abnormal parenchyma. RBS plasmalogens levels were low whereas plasma VLCFA were normal. SA-Pt.14

Patient ID

Table 1. Continued

Clinical phenotype

Shaheen et al.

was found to result in skipping of exon 5 and creation of premature termination (p.D94Ef sX96). Similarly, the novel donor site mutation in PEX16 (c.460+5G>A) in SA-Pt.07 was also found to result in skipping of exon 5 and a premature termination (p.A121Wf sX122) (Fig. 2). The previously reported PEX5 c.1578T>G (p.N526K) missense mutation was found in three patients in this study (SA-Pt03, SA-Pt04, SAPt05) (13). The same mutation was also found in two other Saudi patients (personal communication) making it the most common among Saudi PBD patients. The three patient SA-Pt03, SA-Pt04 and SA-Pt05 were found to share the same haplotype using microsatellite markers surrounding PEX5 indicating that this is a founder mutation (data not shown). All RCDP patients recruited in this study have the same splice acceptor mutation (c.569−3T>G) in GNPAT. The mutation completely abolishes normal splicing and, interestingly, creates two aberrant transcripts. The first, and predominant, aberrant transcript lacks the entire exon 5 thereby creating a frameshift and introducing a premature termination codon (p.D189Ef sX195). The second transcript lacks exon 5 and 34 bp of exon 6 causing a transcript with a deletion of 54 aa (p.del189242) (Fig. 4). Similar to the PEX5 mutation, we have shown by microsatellites that this was another founder mutation in our population.

Functional studies

With the exception of RCDP patients, our mutation analysis was always supplemented by immunofluorescence microscopy and complementation studies to unequivocally prove the pathogenic nature of the mutation identified. The complementation group assigned to the patient fibroblasts matched our molecular analysis in 100% of the cases (Fig. 5). Immunofluorescence studies revealed that no punctate immunofluorescences with anti-human DBP antidody was seen in fibroblast from patients SAPt.09, SA-Pt.11, SA-Pt.12, whereas large particlebound immunofluorescences with anti-human catalase were seen in the fibroblasts from all three patients (Fig. 5a), which indicate that the patients SA-Pt.09, SA-Pt.11, SA-Pt.12 were DBP deficient, i.e. PED rather than PBD. Immnobot analysis using DBP antibody also revealed the absence of DBP in the fibroblasts from patient SA-Pt.12 (Fig. 5b). Complementation analysis confirmed that the patient SA-Pt-07 belong to group D (PEX16 ) of PBDs (Fig. 5c).

Peroximal diseases in Arabs

Fig. 1. Summary of homozygosity mapping. The runs of homozygosity (shown to scale) are color coded to match the patient ID as presented in the text. Table 2. Peroxisomal disorder genes mutations identified in this study Patient ID Consanguinity Affected gene SA-Pt.01

Yes

PEX13

SA-Pt.02 SA-Pt.03 SA-Pt.04 SA-Pt.05 SA-Pt.06 SA-Pt.07 SA-Pt.08 SA-Pt.09 SA-Pt.10 SA-Pt.11

Yes Yes Yes No Yes Yes Yes Yes Yes Yes

SA-Pt.12 SA-Pt.13

Yes Yes

HSD17B4 GNPAT

SA-Pt.14 SA-Pt.15 SA-Pt.16 SA-Pt.17

Yes Yes Yes Yes

Mutation nucleotide level

Mutation protein level

Reference

PEX13 PEX5

147,308 bp del including entire gene (described at genomic DNA level) c.107 120delGTCCTACTTTAATG c.1578T>G

Al-Dirbashi et al. (12) p.G36DfsX61 p.N526K

Al-Dirbashi et al. (12) Dodt et al. (13)

PEX12 PEX16 ACOX1 HSD17B4

c.533 535delAAC c.460+5G>A c.431−1G>A c.2207T>A

p.Q178L p.A121WfsX122 P.G144V p.L736H

Steinberg et al. (22) Novel Rosewich et al. (16) Novel

HSD17B4

c.280+3 del GAGTATTTCTTTTTCA InsTGTTGT GATTTTTTAGTGAATTGTGTATTTT AGTGATGTGTGTATAATTTTTTTA AAAAGTATATACTTTCCTCCTTTTA CCCTATACAACATTGATTT c.1545C>G c.569−3T>G

p.D94EfsX96

Novel

p.H515Q p.D190EfsX196 p.delD190-243E

Novel Novel

65

Shaheen et al. (a)

(c)

(b)

(d)

Fig. 2. Sequence chromatogram of the one novel mutation in PEX16 and three novel mutations in HSD17B4 gene: Change of G to T at the splice donor site of intron 5 in patient SA-Pt.07 led to complete skipping of PEX16 exon 5 (cDNA shown) (a). Missense mutations in HSD17B4 at the genomic level are shown for patients SA-Pt.09 and SA-Pt.12 (b, d; patient SA-Pt.11 has a 16 bp deletion and 99 bp insertion in the donor site of exon 5 of HSD17B4 gene leading to complete skipping of exon 5 (cDNA shown) (c).

Discussion

Despite their worldwide rarity, we were able in 60% of mutations among PBD patients are in PEX1 (16). In fact, none of the patients included in this study was found to harbor a mutation in PEX1. Although this study was designed to specifically study PBD, we have included all patients with RCDP phenotype assuming PEX7 -related RCDP (type I) would be the commonest phenotype as shown by others (17). However, and in another striking contrast, all five RCDP patients were found to harbor a

Peroximal diseases in Arabs (a)

(b)

Fig. 3. 3D structure of the amino acid residues 622–736 (a) and 484–600 (b) of D-bifunctional protein using the PDB structures 1iKt [sterol-carrier protein type 2 (SCP-2) like domain] and 1S9C (2-enoyl-CoA hydratase 2 domain), respectively. The coloring reflects the conservation alignment in cross species (Rattus norvegicus, Mus musculus, Macaca mulatta, Bos Taurus, Xenopus laevis, Salmo trutta fario, Danio rerio; red: conserved in all species listed, blue: conserved in 33%). The two missense mutations in HSD17B4 replace highly conserved amino acid residues (arrow).

GNPAT mutation instead, confirming that they in fact represent RCDP II which is a single peroxisomal enzyme deficiency disorder. GNPAT encodes glyceronephosphate O-acyltransferase with acyltransferase domain that occupies a stretch of 205 amino acids (amino acids 134–339). The first transcript created by the mutation reported in this study leads to a frameshift and a truncated protein with the acyltransferase domain lacking 155 amino acids. While the other aberrant transcript results in in-frame deletion in which the deleted 53 amino acids are within the acyltransferase domain so this too is probably to be pathogenic even though it retains the putative peroxisomal targeting signal type I (PTS1) at the extreme C-terminus necessary for the import of protein (18). In addition, our quantification of the two aberrant transcripts showed that the second transcript is present at a ratio of 1:3 (data not shown) so even if

it is hypomorphic in nature, its low abundance is unlikely to rescue the phenotype. The reason for the unusual pattern of splicing aberration caused by this mutation is unclear but it shows the complex nature of the spliceosomal machinery. PEX16 encodes 336 amino acid integral peroxisomal membrane protein peroxin Pex16p (19). Cells deficient in this protein have no detectible peroxisomes. The mutation in PEX16 identified in this study creates a protein with only the first 120 amino acids. This truncation predicts either nonsense mediated decay of the aberrant transcript (20) or a protein that lacks both its two transmembrane domains TM1 (aa residues 110–131) and TM2 (aa residues 222–243) necessary for the integration of protein into peroxisomal membrane as well as the C-terminus which probably plays a role in an early stage of peroxisome assembly. Either possibility would qualify the mutation as null and render the cell completely devoid of PEX16 function as we indeed showed on immunofluorescence and complementation analysis. This explains the severe clinical profile of the patient SA-Pt.07 (Table 1). DBP encoded by HSD17B4 gene is an enzyme with three functional domains: 3-hydroxyacyl CoA dehydrognase; 2-enoyl-coenzyme A (CoA) hydratase and sterol-carrier protein 2 like unit which plays a key role in peroxiosomal βoxidation (21). Our novel missense mutation H515Q is located within the 2-enoyl-coenzyme A (CoA) hydratase domain. The complete loss of DBP from the cells of patient Sa-Pt.12 as shown by immunoblotting indicates that H515Q may cause improper folding which targets the protein for degradation. For proper peroxisomal functioning, peroxisomal matrix proteins and enzymes are made in the cytoplasm and are targeted to the peroxisomes by signal found on their C-terminus (PTS1) or N-terminus (PTS2). DBP sequence has its PTS1 consensus sequence, alanine-lysine-leucine (AKL), at the extreme C-terminal end (aa residues 734–736). Remarkably, the novel missense mutation L736H in SA-Pt.09 and SA-Pt.10 affects the last residue of PTS1which is also the very last amino acid residue of the protein. The loss of function of DBP in these two patients, therefore, is probably due to improper localization of protein. In summary, we describe the clinical, biochemical and molecular profile of PBD in the largest cohort from the Middle East. We show that homozygosity mapping is clearly a powerful molecular diagnostic tool for the genetically heterogeneous disorder of PBD in consanguineous 67

Shaheen et al. (a)

(c)

(b)

Fig. 4. (a) Sequence chromatogram of the one novel mutation in GNPAT gene found in the five RCDP patients. Change of G to T at the accepter splice site of intron 4 of GNPAT gene leads to two cryptic splice sites, therefore two different transcripts. The first transcript lacks exon 5 (128 bp). The second transcript lacks exon 5 and 34 bp of exon 6 (total 162 bp) (cDNA shown) as shown in (b). (c) Clinical radiographs of two patients showing the variable degree of rhizomelic shortening of the upper limb in spite of identical genetic lesion.

populations. Most of our patient families have chosen to pursue molecular-based early prenatal diagnosis for future pregnancies to prevent the occurrence of more affected children which we see as a direct translational benefit of this study. At the 68

current rate of case identification, we expect to be able to report a follow-up paper with more cases in the near future. We hope this and future studies will improve our understanding of this rare but important group of metabolic diseases.

Peroximal diseases in Arabs

(a)

(b)

(c)

Fig. 5. (a) Immunofluorescence microscopy analysis staining in fibroblast from patients SA-Pt.09, SA-Pt.11, SA-Pt.12. Cells were stained using antibodies to human catalase and DBP. No DBP containing particles were seen in the fibroblasts from the three patients as compared with findings in control. (b) Immunoblot analysis of protein extract from patient SA-Pt.12 fibroblast using DBP antibody. No band was seen from the patient in patient panel SA-Pt.12 (lane 2) as compared with finding in control (lane 1). The result shows complete absence of hydroxysteroid (17-beta) dehydrogenase 4 protein in patient SA-Pt.12. (c) Complementation of peroxisome in fibroblast from patient SA-Pt-07. Cells were stained using antibody to human catalase and PMP70. Numerous peroxisomes were seen in the fused cells between fibroblasts from patient SA-Pt-07 and fibroblast with PEX3 and PEX19 defect (groups G and J of PBD, respectively), whereas no peroxisomes were seen in cell hybrid of the patient SA-Pt-07 and fibroblasts with PEX16 defect (group D of PBDs) which confirms the patient SA-Pt-07 belong to group D of PBDs.

Supporting Information The following Supporting information is available for this article: Fig. S1. Clinical photographs of a number of patients with variable degree of severity of ‘Zellweger facies’ which comprises high forehead, hypotonic elongated face and micrognathia. Additional Supporting information may be found in the online version of this article. Please note: Wiley-Blackwell Publishing is not responsible for the content or functionality of any supplementary materials supplied by the authors. Any queries (other than missing material) should be directed to the corresponding author for the article.

Acknowledgements We would like to express our deep appreciation to the family members for their enthusiastic and generous participation. We thank

our Sequencing Core Facility for their help in DNA sequencing and genotyping. We would also like to thank our Genomic Core Facility for their help in processing Affy 250K SNP chips. This study was approved and funded by the King Faisal Specialist Hospital and Research Center (RAC # 2080033).

References 1. Wanders RJ, Vreken P, Ferdinandusse S et al. Peroxisomal fatty acid alpha- and beta-oxidation in humans: enzymology, peroxisomal metabolite transporters and peroxisomal diseases. Biochem Soc Trans 2001: 29: 250–267. 2. Brown FR 3rd, McAdams AJ, Cummins JW et al. Cerebrohepato-renal (Zellweger) syndrome and neonatal adrenoleukodystrophy: similarities in phenotype and accumulation of very long chain fatty acids. Johns Hopkins Med J 1982: 151: 344–351.

69

Shaheen et al. 3. Shimozawa N. Molecular and clinical aspects of peroxisomal diseases. J Inherit Metab Dis 2007: 30: 193–197. 4. Clarke JTR. Storage syndrome and dysmorphism.. In: Clarke JTR, ed. A clinical guide to inheritied metabolic diseases. Cambridge: Cambridge University Press, 2002: 152–156. 5. Alkuraya FS. Homozygosity mapping: one more tool in the clinical geneticist’s toolbox. Genet Med 2010: 12(4): 236–239. 6. Abu Safieh L, Aldahmesh MA, Shamseldin H et al. Clinical and molecular characterization of Bardet-Biedl Syndrome in consanguineous populations: the power of homozygosity mapping. J Med Genet 2010: 47(4): 236–241. 7. Aldahmesh MA, Safieh LA, Alkuraya H et al. Molecular characterization of retinitis pigmentosa in Saudi Arabia. Mol Vis 2009: 15: 2464–2469. 8. Al-Dirbashi OY, Santa T, Rashed MS et al. Rapid UPLCMS/MS method for routine analysis of plasma pristanic, phytanic, and very long chain fatty acid markers of peroxisomal disorders. J Lipid Res 2008: 49: 1855–1862. 9. Shimozawa N, Tsukamoto T, Suzuki Y et al. A human gene responsible for Zellweger syndrome that affects peroxisome assembly. Science 1992: 255: 1132–1134. 10. Yajima S, Suzuki Y, Shimozawa N et al. Complementation study of peroxisome-deficient disorders by immunofluorescence staining and characterization of fused cells. Hum Genet 1992: 88: 491–499. 11. Suzuki Y, Jiang LL, Souri M et al. D-3-hydroxyacyl-CoA dehydratase/D-3-hydroxyacyl-CoA dehydrogenase bifunctional protein deficiency: a newly identified peroxisomal disorder. Am J Hum Genet 1997: 61: 1153–1162. 12. Al-Dirbashi OY, Shaheen R, Al-Sayed M et al. Zellweger syndrome caused by PEX13 deficiency: report of two novel mutations. Am J Med Genet A 2009: 149A: 1219–1223. 13. Dodt G, Braverman N, Wong C et al. Mutations in the PTS1 receptor gene, PXR1, define complementation group 2 of

70

14.

15.

16.

17.

18.

19.

20.

21.

22.

the peroxisome biogenesis disorders. Nat Genet 1995: 9: 115–125. Aldahmesh MA, Abu-Safieh L, Khan AO et al. Allelic heterogeneity in inbred populations: the Saudi experience with Alstrom syndrome as an illustrative example. Am J Med Genet A 2009: 149A: 662–665. Hildebrandt F, Heeringa SF, Ruschendorf F et al. A systematic approach to mapping recessive disease genes in individuals from outbred populations. PLoS Genet 2009: 5: e1000353. Rosewich H, Ohlenbusch A, Gartner J. Genetic and clinical aspects of Zellweger spectrum patients with PEX1 mutations. J Med Genet 2005: 42: e58. Motley AM, Brites P, Gerez L et al. Mutational spectrum in the PEX7 gene and functional analysis of mutant alleles in 78 patients with rhizomelic chondrodysplasia punctata type 1. Am J Hum Genet 2002: 70: 612–624. Ofman R, Hettema EH, Hogenhout EM et al. Acyl-CoA:dihydroxyacetonephosphate acyltransferase: cloning of the human cDNA and resolution of the molecular basis in rhizomelic chondrodysplasia punctata type 2. Hum Mol Genet 1998: 7: 847–853. Honsho M, Hiroshige T, Fujiki Y. The membrane biogenesis peroxin Pex16p. Topogenesis and functional roles in peroxisomal membrane assembly. J Biol Chem 2002: 277: 44513–44524. Wilusz CJ, Wang W, Peltz SW. Curbing the nonsense: the activation and regulation of mRNA surveillance. Genes Dev 2001: 15: 2781–2785. Ferdinandusse S, Denis S, Mooyer PA et al. Clinical and biochemical spectrum of D-bifunctional protein deficiency. Ann Neurol 2006: 59: 92–104. Steinberg S, Chen L, Wei L, Moser A, Moser H, Cutting G, Braverman N. The PEX Gene Screen: molecular diagnosis of peroxisome biogenesis disorders in the Zellweger syndrome spectrum. Mol Genet Metab 2004: 83(3): 252–263.