Available online at www.annclinlabsci.org

149

Annals of Clinical & Laboratory Science, vol. 40, no. 2, 2010

Association of Interleukin-10 Gene Polymorphism with Cachexia in Chinese Patients with Gastric Cancer

Fengbo Sun,1 Yunbo Sun,2 Dianliang Zhang,1 Jian Zhang,1 Bo Song,3 and Hongmei Zheng1 Surgery and 2Intensive Care Departments, Qingdao University Medical College and Hospital; 3Yantai Yantaishan Hospital; Shandong Province, China

1General

Abstract. This study investigated whether the single nucleotide polymorphisms (SNPs) and haplotypes of interleukin-10 (IL-10) were associated with cachexia in 223 Chinese patients with gastric cancer diagnosed by histopathological examination. Genomic DNA was extracted from peripheral blood leukocytes. The SNPs at positions −1082A/G, −819T/C, and −592A/C in the IL-10 gene promoter were analyzed using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). No significant differences were found in the allele and genotype frequencies of -592A/C in patients with or without cachexia. Increased frequency of the −1082G allele was found in patients with cachexia (OR = 1.83, 95% CI, 1.00-3.33, p = 0.049). In a logistic regression analysis adjusted for body weight, carcinoma location, and stage, the −1082AG genotype was associated with an odds ratio of 1.989 (95% CI, 1.041–3.802, p = 0.037) for cachexia. The −819CC genotype was associated with an odds ratio of 3.393 (95% CI, 1.298– 8.871, p = 0.013) for cachexia. Furthermore, haplotype analysis revealed that the G1082C819C592 haplotype was associated with increased risk of cachexia as compared to the A1082T819A592 haplotype (OR = 2.21; 95% CI, 1.14 – 4.30; p = 0.02). Our results suggest that genetic polymorphisms of IL-10 contribute to the susceptibility to cachexia in patients with gastric cancer in the Chinese population. Keywords: interleukin-10, single nucleotide polymorphisms, haplotype analysis, gastric cancer, cachexia Introduction Cancer cachexia is a complex syndrome characterized by progressive weight loss, anorexia, early satiety, weakness, anemia, and asthenia [1,2]. It is most commonly seen in patients with gastrointestinal, lung, and prostate cancers. At the time of diagnosis, up to 80% of patients with cancers of the upper digestive tract and 60% of patients with lung cancer suffer from cachexia [3]. Cachexia causes reduced quality of life and shortened life Address correspondence to Dr. Dianliang Zhang, Department of General Surgery, Affiliated Hospital of Qingdao University Medical College, 16 Jiangsu Road, Qingdao 266003, Shandong Province, P. R. China; tel 86 532 8291 1324; fax 86 532 8279 0962; e-mail: [email protected].

expectancy. Patients with cachexia have a lower chance of responding to chemotherapy and are more prone to toxic side-effects [4]. At least 20% of cancer patients die from effects of cachexia [5,6]. Although the mechanism of cancer cachexia is not well known, several key mediators have been identified. Inflammatory cytokines such as TNF-α, IFN-g, IL-1, IL-6, and IL-10 evidently play an important role in the pathogenesis of cancer cachexia [7-12]. There is evidence that the cytokine response is genetically determined in humans [13]. Polymorphic gene sequences of certain cytokines can influence the susceptibility to and clinical outcome of various diseases by changing cytokine production. Several studies have explored the likehood of a genetic predisposition to cancer cachexia [13-15].

0091-7370/10/0200-0149. $2.45. © 2010 by the Association of Clinical Scientists, Inc.

150 Annals of Clinical & Laboratory Science, vol. 40, no. 2, 2010 Interleukin-10 (IL-10) is a pleiotrophic cytokine that can both stimulate and suppress the immune response [16]. Previous studies have suggested that IL-10 plays an important role in cachexia from pancreatic cancer and colorectal cancer [17,18]. The human IL-10 gene is located on chromosome 1q31–32 and is composed of five exons and four introns. Three SNPs at positions -1082A/G, -819T/C, and -592A/C influence the transcription of IL-10 messenger RNA and the expression of IL-10. In addition, the GCC haplotype (defined by three SNPs at positions of -1082, -819 and -592) is associated with high IL-10 production, while the ATA haplotype appears to be a low IL-10 responder [19,20]. A recent study showed that the IL-10 genotype can influence the development of cachexia in patients with gastroesophageal malignancy [21]. However, that study was focused only on the IL-10-1082 locus. In the present study, we genotyped the IL-10 gene in 223 Chinese patients with gastric cancer to evaluate the effect of the common −1082A/G, −819T/C, and −592A/C polymorphisms on the susceptibility to cancer cachexia. Materials and Methods Study population. From 1 October 2008 through 1 May 2009, all patients with gastric cancer admitted to the hospital for surgical treatment were prospectively considered. The exclusion criteria were: (a) age >75 yr; (b) anorexia nervosa; (c) surgery, radiotherapy, or chemotherapy during the previous 4 wk; and (d) other active medical conditions (major gastrointestinal disease, chronic heart failure, hepatic failure, renal failure, uncontrolled diabetes, infections, and HIV). All of the cases were from the Chinese Han population. The diagnosis of gastric cancer was established by histopathological examination. Each case was evaluated for the presence of anorexia, serum C-reactive protein (CRP) level, and weight loss. The patients were divided into two groups: cachectic patients and non-cachectic patients, based on the severity of weight loss during the preceding 6 mo and the serum CRP level at admission. Patients were considered cachectic if their weight loss was >10% of their pre-illness stable weight within 6 mo and if their serum CRP level was >10 mg/L [22]. Cancers were staged according to the International Union Against Cancer (UICC) TNM system [23]. The characteristics of the study patients are shown in Table 1. Informed consent was obtained using a questionnaire completed by each participating subject or a close relative. The study protocol was approved by the Ethics Committee of Qingdao University.

IL-10 measurement. At 6 a.m. on the first day after admission, peripheral venous blood was collected from each subject before any therapy was given. All subjects were fasting. Serum IL-10 levels were measured with an interleukin radioimmunoassay kit (Beijing Sino-UK Institute of Biological Technology, Beijing, China) according to the manufacturer’s instructions. Genotyping. Genomic DNA was extracted from EDTAanticoagulanted peripheral blood leukocytes using a Wizard genomic DNA purification kit (Promega) according to the manufacturer’s instructions. The IL-10 −1082A/G, −819T/C and −592A/C genotypes were determined by a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technique using primers from Shanghai Sangon Biological Engineeering Technology and Services Co. IL-10−1082A/G. The primers were as follows: forward: 5’CCAAGACAACACTACTAAGGCTCCTTT3’; reverse: 5’GCTTCTTATATGCTAGTCAGGTA3’ [24]. PCR conditions: 94°C 5 min; 35 cycles of 30 sec at 94°C, 45 sec at 56°C, 1 min at 72°C; 72°C 10 min. PCR products were 377bp and digested with 5 units of restriction enzyme EcoNI (New England Biolabs) at 37°C overnight. Digestion products of 280bp + 97bp and 253bp + 97bp + 27bp were obtained for A and G alleles, respectively, visualized by electrophoresis on a 3% agarose gel stained with 0.1% ethidium bromide (Fig.1). IL-10−819T/C. The primers were as follows: forward: 5’TCATTCTATGTGCTGGAGATGG3’; reverse: 5’TGGGGGAAGTGGGTAAGAGT-3’ [25]. PCR conditions: 94°C 5 min; 35 cycles of 30 sec at 94°C, 45 sec at 56°C, 1 min at 72°C; 72°C 10 min. PCR products were 209bp and digested with 5 units of restriction enzyme MaeIII (Roche) at 55°C for 1 hr. Digestion products of 125bp + 84bp and 209bp were obtained for C and T alleles, respectively, visualized by electrophoresis on a 3% agarose gel stained with 0.1% ethidium bromide (Fig. 2). IL-10−592A/C. The primers were as follows: forward: 5’GGTGAGCACTACCTGACTAGC3’; reverse: 5’CCTAGGTCACAGTGACGTGG3’ [25]. PCR conditions: 94°C 5 min; 35 cycles of 30 sec at 94°C, 45 sec at 64°C, 1 min at 72°C; 72°C 10 min. PCR products were 412bp and digested with 5 units of restriction enzyme RsaI (MBI Fermentas) at 37°C for 4 hr. Digestion products of 176 bp + 236bp and 412bp were obtained for A and C alleles, respectively, visualized by electrophoresis on a 3% agarose gel stained with 0.1% ethidium bromide (Fig. 3). Statistics. Serum IL-10 levels were expressed as mean ± SD and compared by the Mann-Whitney U test. The Chi-square test and 2-sample t test were used to compare the demographic and clinical data between groups. The Chi-square test was used to test the distributions of genotype at each SNP locus with Hardy-Weinberg equilibrium. Genotype and allele frequencies among groups were compared using the Chisquare test and Fisher’s exact test as appropriate. Odds ratios (OR) with 95% confidence intervals (CIs) were estimated for

IL-10 gene polymorphism and cachexia in gastric cancer 151 Table 1: Characteristics of the 223 patients with gastric cancer. Parameter

Cachexia (n = 107)

Non-cachexia (n = 116)

Gender (M/F) 70/37 80/36 Age (yr) 61.5 ± 10.9a 59.9 ± 10.4 Serum albumin (g/L) 29.0 ± 3.8 35.3 ± 2.5 Body weight (kg) 65.0 ± 11.4 66.2 ± 10.4 Anorexia (n) 45 53 Serum CRP (mg/L) 23.7 ±13.7 8.1 ±3.6 Carcinoma location in stomach Upper third 4 7 Middle third 36 41 Lower third 67 68 Carcinoma stage I 0 26 II 48 13 III 34 55 IV 25 22 a Mean

p 0.573c 0.268c