258

Brief Communications

imentacio´n (Generallitat Valenciana). The authors thank Margot Ovenden for her assistance with the English edition and Joaquı´n Ortega for his technical assistance.

Sources and manufacturers a. Dolethalt, Ve´toquinol SA, Lure, France.

References 1. Aziz EM: 1973, Neonatal pneumatosis intestinalis associated with milk intolerance. Am J Dis Child 125:560–562. 2. Blas E, Gidenne T: 1998, Digestion of starch and sugars. In: The nutrition of the rabbit, ed. Blas C, Wiseman J, pp. 17–38. CAB International, London, United Kingdom. 3. De Blas C, Mateos GG: 1998, Feed formulation. In: The nutrition of the rabbit, ed. Blas C, Wiseman J, pp. 241–253. CAB International, London, United Kingdom. 4. De Blas C, Mateos GG, Rebollar PG: 2003, Tablas de composicio´n y valor nutritivo de alimentos para la fabricacio´n de piensos compuestos. FEDNA (Fundacio´n Espan˜ola para el desarrollo de la Nutricio´n Animal), Madrid, Spain.

5. Galandiuk S, Fazio VW: 1986, Pneumatosis cystoides intestinalis. A review of the literature. Dis Colon Rectum 29:358–363. 6. Ho¨er J, Truong S, Virnich N, et al.: 1998, Pneumatosis cystoides intestinalis: confirmation of diagnosis by endoscopic puncture a review of pathogenesis, associated disease and therapy and a new theory of cyst formation. Endoscopy 30:793–799. 7. Jones TC, Hunt RD, King NW: 1997, Intestinal emphysema. In: Veterinary pathology, ed. Cann C, 6th ed., p. 1080. Williams & Wilkins, Baltimore, MD. 8. Koss LK: 1952, Abdominal gas cysts (pneumatosis cystoides intestinorum hominis): an analysis with a report of a case and critical review of the literature. Arch Pathol 53:523–549. 9. McGavin MD, Carlton WW, Zachary JF: 2001, Intestinal emphysema. In: Thomson’s special veterinary pathology, ed. Schrefer JA, 3rd ed., pp. 54–55. Mosby, St. Louis, MO. 10. Meyer RC, Simon J: 1977, Intestinal emphysema (pneumatosis cystoids intestinalis) in a gnotobiotic pig. Can J Comp Med 41: 302–305. 11. Yale CE: 1975, Etiology of pneumatosis cystoides intestinalis. Surg Clin N Am 55:1297–1302. 12. Yale CE, Balish E: 1992, The natural course of Clostridium perfringens. Induced pneumatosis cystoides intestinalis. J Med 23:279–288.

J Vet Diagn Invest 17:258–262 (2005)

A method for detecting complex vertebral malformation in Holstein calves using polymerase chain reaction–primer introduced restriction analysis Yutaka Kanae1, Daiji Endoh, Hajime Nagahata, Masanobu Hayashi Abstract. Complex vertebral malformation (CVM), a hereditary lethal disease in Holstein calves, is characterized by complex anomalies of the vertebral column and limbs in an aborted fetus and in prematurely born, stillborn, and neonatal calves. The mode of inheritance of CVM is autosomal recessive, and CVM is caused by a point mutation from G to T at nucleotide position 559 of the bovine solute carrier family 35 member 3 (SLC35A3) gene. Although an allele-specific polymerase chain reaction (AS-PCR) is a useful method for diagnosis of CVM, the AS-PCR requires selected DNA polymerases and strictly controlled reaction conditions to obtain reliable results. Therefore, an alternative screening method for the CVM gene would be useful. Polymerase chain reaction–primer introduced restriction analysis (PCR-PIRA) is a method that can be used for detecting a single nucleotide mutation in any gene without a restriction site around the mutation site. In this study, primers were designed to introduce PstI or EcoT22 sites into PCR products from the wild-type and CVM alleles, respectively. The wild-type allele, a heterozygote, and a homozygote of the CVM allele could be discriminated by restriction fragment length polymorphism analysis. Specific introduction of restriction sites into PCR products depending on the change in a single nucleotide of template was shown using a variety of DNA polymerases and PCR machines. Therefore, the PCR-PIRA technique using primers designed in this study might provide a more useful method for extensive screening of CVM. Key words:

Complex vertebral malformation; diagnosis; Holstein; PCR-PIRA.

Complex vertebral malformation (CVM), a familial lethal syndrome in Holstein calves, has been reported in stillborn, From the Departments of Veterinary Radiology (Kanae, Endoh, Hayashi) and Animal Health (Nagahata), School of Veterinary Medicine, Rakuno Gakuen University, 582 Bunkyodai-Midorimachi, Ebetsu, Hokkaido 069-8501, Japan. 1Corresponding Author: Yutaka Kanae, Department of Veterinary Radiology, School of Veterinary Medicine, Rakuno Gakuen University, Ebetsu, Hokkaido 069-8501, Japan.

aborted, and preterm calves.1 Affected calves are characterized by shortened cervical and thoracic regions of the vertebral column, bilateral symmetric contraction of the metatarsophalangeal joints, and symmetric arthogryposis.1,3,8,11 Multiple hemivertebrae, scoliosis, and synostosis of the vertebral column have also been reported.1,3,8,11 Complex vertebral malformation was first identified and characterized in Holstein cattle in Denmark.1 Two common ancestors in pedigrees of CVM were found; both were elite sires of US Holstein origin. Because of the widespread international use of

Brief Communications

259

Figure 1. Schematic presentation of exon 4, depicted by a solid box, partial exon 4 sequences of wild-type and CVM SLC35A3 gene around the 559th nucleotide of the gene, nucleotide sequences of PstI and EcoT22I forward primers, and introduced restriction sites. The bold characters show mismatched sequences of primers for introduction of restriction sites.

semen from the sires in pedigrees of affected calves, it is expected that CVM will occur in many countries. Indeed, the occurrence of CVM in Holstein calves has been reported recently in the United States,3 the United Kingdom,11 and Japan.8 The Danish Institute of Agricultural Science has determined that the mode of inheritance of CVM is autosomal recessive and that CVM is caused by a point mutation from G to T at nucleotide position 559 of the bovine solute carrier family 35 member 3 (SLC35A3) gene (Ministeriet for Fodervarer, Landburg og Fiskeri Danmarks Jordbrugsforskining, International Patent WO 02/40709 A2, 2002) and developed a detection method using an allele-specific polymerase chain reaction (AS-PCR). They provide 2 primer sets complementary to G for the normal allele and T for the CVM allele at nucleotide position 559 of the bovine SLC35A3 gene. Specific amplification can be obtained if the 39 end of the oligonucleotide matches the desired alleles, but a mismatched allele is poorly amplified if at all because mismatch prevents efficient elongation from the 39 ends of primers by DNA polymerase. Wild-type and CVM alleles can be distinguished by detection of amplified bands from either the primer for G or the primer for T. The amplified bands can be resolved by agarose gel electrophoresis with no additional manipulation.5,12 Although the AS-PCR is useful in the diagnosis of CVM, it requires a selected DNA polymerase7 and strictly controlled reaction conditions to obtain reliable results. Thus, the development of an alternative method may be necessary for extensive screening for the CVM gene. Polymerase chain reaction–restriction fragment length polymorphism (PCR-RFLP) is a reliable method for detection of single nucleotide mutations and genetic polymorphisms because digestibility by restriction endonucleases strictly depends on nucleotide sequences of PCR products. However, there are no restriction sites around the 559th nu-

cleotide of the SLC35A3 gene. Polymerase chain reaction– primer introduced restriction analysis (PCR-PIRA) is a method for detection of single nucleotide mutations by introducing artificial restriction endonuclease sites using primers containing mismatches.4 This method has been used for detection of single nucleotide mutations of a variety of genes.2,6,9 For CVM screening, 2 primer sets were designed. One included an EcoT22I site in the amplified product from the CVM allele and the other included a PstI site in the amplified product from the wild-type allele (Fig. 1). Both primers were complementary to sequence from nucleotides 537 to 554 of the bovine SLC35A3 gene, but 2 nucleotides at the fourth and fifth positions from the 39 ends of the primers were different. Three nucleotides at the 39 ends of both primers were matched to nucleotides 556–558 of both the wild-type and CVM alleles. The EcoT22I and PstI sites were introduced in PCR products depending on the nucleotide sequences of templates (Fig. 1). To examine the effects of mismatches of 2 nucleotides in the primers on specific introduction of restriction sites, 2 clones were constructed. A total of 233 base pair (bp) fragments including a part of exon 4 and intron 4 sequence (nucleotides 536–637 of exon 4 and 132 bp of the intron 4 sequence) were amplified using 39 alteration primers in which the 559th nucleotide was G or T of the bovine SLC35A3 gene (59cacaatttgtaggtctcatggca(t/g)39) and a reverse primer (59cgatgaaaaaggaaccaaaaggg39) from genomic DNA of normal Holstein calves (GenBank accession number: AY 160683 and Ref. 8). The PCR for amplification of 233-bp fragments from calf DNA was performed in a 30-ml reaction mixture containing 10 mM Tris–HCl (pH 8.3 at 25 C), 50 mM KCl, 0.001% (wt/vol) gelatin, 300 ng genomic DNA, 0.01 units of Taq polymerase,c 0.2 mM deoxynucleoside triphosphate, 15 mM MgCl2, and 0.5 mM each primer using a thermal cyclerd under the following conditions: ini-

260

Brief Communications

Figure 2. Effects of a variety of DNA polymerases and PCR machines on specific introduction of restriction sites. The PCR-PIRA was performed as described in the text using G-233 (G) and T-233 (T) as templates. Three PCR machines (PCR machine 1,d 2,l and 3m) and 5 types of polymerase, Taq polymeraseh (A), Hotstart Taq polymerasec (B), Hotstart Taq polymerasei (C), DNA polymerase having proofreading activityj (D), and DNA polymerase having high proofreading activityk (E) were used. Eco represents amplified products using EcoT22I forward primer, which were digested with EcoT22I. Pst represents amplified products using PstI forward primer, which were digested with PstI. The digested PCR products were analyzed by agarose gel electrophoresis. M represents a molecular weight marker (100-bp ladder markerp). NC represents a negative PCR control without a template.

tial denaturation at 94 C for 1 minute, 30 cycles of 94 C for 30 second, 56 C for 30 second, and 72 C for 30 second followed by a final extension at 72 C for 2 minute. The PCR products were cloned into a plasmid vector.b Clones containing 233-bp fragments from normal and CVM alleles were designated as G-233 and T-233, respectively. Sequences of the clones were confirmed by the DYE terminater method using a cycle sequencing kite with an autosequencerf according to the manufacturer’s protocol. The PCR-PIRA was carried out using G-233 or T-233 as a template, 5 types of polymerasesc,h–k (1 normal Taq polymerase,h 2 hotstart Taq polymerases,c,i and 2 polymerasesj,k that have proofreading activity) and 3 brands of PCR machines.d,l,m The PCR reactions were carried out with 10-ml reaction mixtures according to the manufacturer’s directions except that the annealing temperature was 56 C and the num-

ber of amplification cycles was 25. The PCR products were digested with EcoT22In or PstIo at 37 C for 1 hour in a 10ml reaction mixture containing 8-ml PCR products, 5 mM Tris–HCl, pH 7.5, 1 mM MgCl2, 10 mM NaCl, 0.1 mM dithiothreitol, and 0.01 units of EcoT22I or PstI. The digested fragments were electrophoresed in Tris–borate–ethylenediaminetetraacetic acid, 3% (wt/vol) agarose gel g stained with ethidium bromide and observed under an UV transilluminator. Although all combinations of DNA polymerases and PCR machines yielded 233-bp PCR products, EcoT22I digested only PCR products from T-233 and PstI digested only PCR products from G-233, except for 1 DNA polymerasek (Fig. 2) with a high proofreading activity. It is possible the mismatched nucleotides between the template and the primer may be recognized by the high proofreading activity and digested by the 39–59 exonuclease activity of

Brief Communications

261

Figure 3. Analysis of CVM allele by the PCR-PIRA method. The PCR-PIRA was performed as described in the text using DNA samples from normal, carrier, and CVM calves as templates. Eco represents amplified products using EcoT22I forward primer, which were digested with EcoT22I. Pst represents amplified products using PstI forward primer, which were digested with PstI. The digested PCR products were analyzed by agarose gel electrophoresis. M represents a molecular weight marker (100-bp ladder markerp).

that polymerase. These results showed that the CVM allele can be detected by PCR-PIRA using the designed primers despite the presence of 2 nucleotide mismatches and that Taq polymerase and DNA polymerase lacking high proofreading activity and widely used PCR machines can be used for the detection. The PCR-PIRA was performed with genomic DNA samples extracted from the blood of Holstein calves as described above. Genomic DNA samples from 3 CVM-normal and 8 CVM-carrier Holstein calves, which were diagnosed by ASPCR method, were kindly provided by the Livestock Improvement Association of Japan. Genomic DNA from whole blood of a CVM-affected Holstein calf, which was also diagnosed by AS-PCR method,9 was isolated using a DNA isolation kit.a The PCR products from normal calf DNA samples were digested by PstI but not by EcoT22I, and PCR products from CVM calf DNA samples were digested by EcoT22I but not by PstI. The PCR products from CVMcarrier calf DNA samples were digested by both EcoT22I and PstI (Fig. 3). These results showed that the PCR-PIRA method using the primers designed in this study can be used for discrimination between wild-type and CVM alleles of Holstein calves. If cows and bulls that have a CVM gene are not used for breeding, the mutated gene can be removed from the cattle population in the same manner as a gene of bovine leukocyte adhesion deficiency has been successfully eliminated.10 However, if the disease gene was linked to excellent traits such as high milk yield in Holstein cattle, elimination of the disease gene might result in elimination of superior traits. It is well known that the mode of inheritance of most genetic diseases is recessive. Therefore, control of the disease gene might be preferable to its elimination. To control the disease gene, extensive screening is necessary for detection of carriers, especially cows. This study has shown that PCR-PIRA is a reliable and useful method for extensive screening for the CVM allele using DNA polymerase and PCR machines that are widely used in diagnostic laboratories. Acknowledgement. Gratitude is expressed to the Livestock Improvement Association of Japan, Maebashi, Gunma, Ja-

pan, for the generous donation of genomic DNA samples from normal and CVM-carrier calves.

Sources and manufacturers a. PUREGENE Genomic DNA Purification Kit, Gentra, Minneapolis, MN. b. pGEM-T Easy Vector Systems, Promega, Madison, WI. c. JumpStart Taq polymerase, SIGMA, St. Louis, MO. d. iCycler, BIORAD, Hercules, CA. e. DYEnamic ET Terminator Cycle Sequencing Kit, Amersham Bioscience, Piscataway, NJ. f. ABI prism 310, Applied Biosystems, Foster, CA. g. AGAROSE 3:1, AMRESCO, Solon, OH. h. Taq polymerase, SIGMA, St. Louis, MO. i. HotStarTaq polymerase, Qiagen, Hilden, Germany. j. Expand Hi Fidelity, Roche, Mannheim, Germany. k. KOD plus, TOYOBO, Osaka, Japan. l. Takara Thermal Cycler PERSONAL, TAKARA, Shiga, Japan. m. T-Gradient, Biometra, Goettingen, Germany. n. EcoT22I, TOYOBO, Osaka, Japan. o. PstI, TOYOBO, Osaka, Japan. p. Stable 100-bp DNA Ladder, SIGMA, St. Louis, MO.

References 1. Agerholm JS, Bendixen C, Andersen O, Arnbjerg J: 2001, Complex vertebral malformation in Holstein calves. J Vet Diagn Invest 13:283–289. 2. Basolo F, Pisaturo F, Pollina LE, et al.: 2000, N-ras mutation in poorly differentiated thyroid carcinomas: correlation with bone metastases and inverse correlation to thyroglobulin expression. Thyroid 10:19–23. 3. Duncan RB Jr, Carrig CB, Agerholm JS, Bendixen C: 2001, Complex vertebral malformation in a Holstein calf: report of a case in the USA. J Vet Diagn Invest 13:333–336. 4. Haliassos A, Chomel JC, Grandjouan S, et al.: 1989, Detection of minority point mutations by modified PCR technique: a new approach for a sensitive diagnosis of tumor-progression markers. Nucleic Acids Res 17:8093–8099. 5. Huang MM, Arnheim N, Goodman MF: 1992, Extension of base mispairs by Taq DNA polymerase: implications for single nucleotide discrimination in PCR. Nucleic Acids Res 20:4567–4573. 6. Jacobson DR, Moskovits T: 1991, Rapid, nonradioactive screening for activating ras oncogene mutations using PCR-primer in-

262

Brief Communications

troduced restriction analysis (PCR-PIRA). PCR Methods Appl 1:146–148. 7. Kwok S, Kellogg DE, McKinney N, et al.: 1990, Effects of primer-template mismatches on the polymerase chain reaction: human immunodeficiency virus type 1 model studies. Nucleic Acids Res 18:999–1005. 8. Nagahata H, Oota H, Nitanai A, et al.: 2002, Complex vertebral malformation in a stillborn Holstein calf in Japan. J Vet Med Sci 64:1107–1112. 9. Ni Z, Liu Y, Keshava N, et al.: 2000, Analysis of K-ras and p53

mutations in mesotheliomas from humans and rats exposed to asbestos. Mutat Res 468:87–92. 10. Powell RL, Norman HD, Cowan CM: 1996, Relationship of bovine leukocyte adhesion deficiency with genetic merit for performance traits. J Dairy Sci 79:895–899. 11. Revell S: 2001, Complex vertebral malformation in a Holstein calf in the UK. Vet Rec 149:659–660. 12. Rust S, Funke H, Assmann G: 1993, Mutagenically separated PCR (MS-PCR): a highly specific one step procedure for easy mutation detection. Nucleic Acids Res 21:3623–3629.

J Vet Diagn Invest 17:262–269 (2005)

Gastrointestinal pythiosis in two cats Pauline M. Rakich1, Amy M. Grooters, Kai-Ning Tang Abstract. Two young adult male Domestic Shorthair cats living in the southeastern United States were evaluated for signs attributable to partial intestinal obstruction. Physical examination indicated a palpable abdominal mass in each animal. Exploratory laparotomy revealed a large extraluminal mass involving the ileum and mesentery with adjacent mesenteric lymphadenopathy in cat No. 1 and an abscessed mass in the distal duodenum in cat No. 2. Mass resection and intestinal anastomosis were performed in both cats. Histologic evaluation indicated that the intestinal lesions involved primarily the outer smooth muscle layer and serosa and consisted of eosinophilic granulomatous inflammation with multifocal areas of necrosis. In Gomori methenamine silver–stained sections, broad (2.5–7.5 mm), occasionally branching, infrequently septate hyphae were observed within areas of necrosis. A diagnosis of Pythium insidiosum infection was confirmed in both cats by immunoblot serology and by immunoperoxidase staining of tissue sections using a P. insidiosum–specific polyclonal antibody. Cat No. 1 was clinically normal for 4 months after surgery but then died unexpectedly from an unknown cause. Cat No. 2 has been clinically normal for at least 9 months after surgery and appears to be cured on the basis of follow-up enzyme-linked immunosorbent assay serology. Key words:

Feline; fungal; intestine; oomycete; Pythium insidiosum.

Pythiosis is a chronic, invasive, and frequently life-threatening infection caused by the oomycete Pythium insidiosum. The disease most commonly involves the skin of horses and dogs and the gastrointestinal (GI) tract of dogs.6 Pythiosis is rare in cats and, when it does occur, usually causes cutaneous lesions.6,20 In addition, isolated cases of subcutaneous20 and nasopharyngeal/retrobulbar3 infections have been noted, but GI infections have not been reported previously in cats. This report describes P. insidiosum infection of the GI tract in 2 cats. Cat No. 1 was a 1.5-year-old castrated male Domestic Shorthair (DSH) from southeastern Georgia that was presented to the referring veterinarian for vomiting of 2 days duration and apparent weight loss. At physical examination, From the Athens Veterinary Diagnostic Laboratory, College of Veterinary Medicine, University of Georgia, Athens, GA 306027383 (Rakich), Department of Veterinary Clinical Sciences, Louisiana State University, Baton Rouge, LA 70803 (Grooters), and Antech Diagnostics, 17672-A Cowan Avenue, Suite 200, Irvine, CA 92614 (Tang). 1Corresponding Author: Pauline Rakich, Athens Veterinary Diagnostic Laboratory, College of Veterinary Medicine, University of Georgia, Athens, GA 30602-7383.

a mass measuring approximately 3 3 4 cm was palpated within the abdomen. Abdominal radiography revealed a mass in the region of the spleen. Hematologic and biochemical abnormalities included leukocytosis (30,000/ml) with a left shift (.3,000 bands/ml as determined by an in-clinic complete blood count [CBC]) and hyperglobulinemia (5.5 g/ dl; reference upper limit, 5.1 g/dl). An extraluminal mass involving the ileum and mesentery and measuring 12 3 8 3 4 cm was found at surgery. An adjacent mesenteric lymph node was enlarged. The mass was resected and intestinal anastomosis performed. Formalin-fixed tissue was submitted for histologic examination with a presumptive diagnosis (based on the gross appearance) of lymphosarcoma. Histologic examination of multiple sections of the submitted tissue consisted of small intestine with a nodular inflammatory reaction extending from the serosal surface (Fig. 1A). The mucosa, submucosa, and inner portion of the smooth muscle wall appeared normal. The lesion consisted of dense fibrous connective tissue stroma containing loosely distributed eosinophils, macrophages, and fewer lymphoid cells without formation of distinct granulomas. Variably sized foci of necrosis composed of bright eosinophilic material and nuclear debris were scattered randomly throughout