Proc. Natl. Acad. Sci. USA Vol. 91, pp. 12755-12759, December 1994

Genetics

Hematopoietic development of vav'/- mouse embryonic stem cells (gene targeting/erythroid and myeloid cells/signaling pathways)

RONG ZHANG, FONG-YING TSAI, AND STUART H. ORKIN Division of Hematology/Oncology, Children's Hospital and the Dana-Farber Cancer Institute, Department of Pediatrics, Harvard Medical School, and the Howard Hughes Medical Institute, Boston, MA 02115

Contributed by Stuart H. Orkin, September 22, 1994

ABSTRACT The vav protooncogene product is expressed nearly exclusively in hematopoietic lineages and contains several structural motifs (SH2/SH3 domains and a dbl-oncogene homology region) typical of proteins functioning in signaling pathways. To ascertain if vav expression is required for hematopoiesis we generated vav-negative mouse embryonic stem cells by gene targeting and examined the consequences of loss of vav function on erythroid and myeloid development in vitro and in vivo. In conflict with the conclusions drawn from expression of antisense vav RNA in embryonic stem cells [Wulf, G. M., Adra, C. N. & Lim, B. (1993) EMBO J. 12, 50655074], we observed erythroid and myeloid development in the absence of vav. These experiments demonstrate that vav expression is not absolutely required for hematopoietic development. The vav gene, first discovered by its oncogenic activation during the course of gene transfer assays, is expressed specifically in cells of all hematopoietic lineages (1). Structurally, the encoded protein is distinctive for features suggestive of a role in signal transduction pathways (2-6). These include one SH2 and two SH3 domains near the carboxyl terminus and a central region with homology to the product of the dbl oncogene, a GDT-GTP exchange factor for the Rho/Rac family of small GTP-binding proteins. The SH3SH2-SH3 domain of vav is rapidly phosphorylated on tyrosine residues upon stimulation of diverse hematopoietic cell receptors, such as the T-cell antigen and interleukin 2 receptors in T-lymphoid cells, IgE receptor on basophilic leukemia cells, IgM antigen receptor in B cells, and c-kit receptor in human hematopoietic cell lines (6-9). While it has been suggested that vav is the primary GDP-GTP exchange factor for Ras proteins in hematopoietic cells (10), recent evidence argues that this is not the case (11). Moreover, although original reports proposed that vav contains transcription factor and DNA-binding motifs (1), recent studies have failed to substantiate these weak amino acid similarities (4). Nonetheless, as an hematopoietic-specific protooncogene product, vav is a candidate mediator of critical signaling pathways. Pluripotent murine embryonic stem (ES) cells can be used to study hematopoietic development in vitro and in vivo (12-16). Upon culture in appropriate medium, ES cells form embryoid bodies (EBs) that contain precursors of erythroid, myeloid, and mast cell lineages. Complete differentiation of these precursors occurs either within the EBs (14) or within hematopoietic colonies arising from dispersed EBs replated into semisolid methylcellulose medium (15). Recently, Wulf et al. (17) reported that forced expression of antisense vav transcripts in ES cells prevents their in vitro differentiation into hematopoietic cells, a finding consistent with a central role for vav in early events of blood cell development. We

chose a genetic approach to evaluate a requirement for vav expression in hematopoiesis in which endogenous vav genes were inactivated in ES cells by gene targeting events. Contrary to the results ofWulf et al. (17), we observe that vav-null (vav-/-) ES cells retain the capacity to differentiate into erythroid and myeloid cells, as studied in vitro and in vivo. Thus, vav expression is not required for hematopoietic development.

MATERIALS AND METHODS Genomic Library Screening and Gene Mapping. Five independent vav genomic phage clones were obtained from a mouse strain 129 library in A FixII (Stratagene) (18). Selected fragments were cloned into pUC18 constructs for restriction mapping and limited DNA sequencing. Construction of Targeting Vectors. Bsk-neo-vav. The construct was assembled in Bluescript KS II plasmid (Stratagene). The phosphoglycerate kinase (PGK)-promoter neomycin-resistance expression cassette from plasmid pPNT (19) was blunt-end cloned into the Sal I site. As a 3' homology region, a 7.6-kb BamHI genomic fragment, including sequences encoding the 3' SH3 domain, was subcloned into the BamHI site. As a 5' homology region, a 2.2-kb Xba I fragment spanning the cysteine-rich region of vav was blunt-end cloned into the Xho I site (Fig. 1). A herpes simplex virus thymidine kinase (HSV-TK) cassette (16, 20) was introduced at the polylinker Not I site after conversion to a Sal I site. The plasmid was linearized by Pvu I digestion before electroporation into ES cells. Bsk-hyg-vav. The construct was assembled in plasmid RMM, which contains a PGK-driven hygromycin B-resistance cassette cloned into Bluescript KS II (21), kindly provided by R. Mortensen. The HSV-TK cassette was inserted into a unique Xho I site. The 5' 2.2-kb Xba I and 3' 7.6-kb BamHI homology regions were subcloned into Sal I and BamHI sites, respectively (Fig. 1). The final construct was linearized by Not I digestion. Transfection and Screening of ES Cells. CCE ES cells (22) were maintained on irradiated STO feeders. Cell culture and electroporation conditions were as described (16). Clones selected in G418 (200 ,ug/ml active) plus ganciclovir (2 ,uM) were subjected to Southern blot analysis. For targeting with Bsk-hyg-vav, cells were selected with G418, ganciclovir, and hygromycin B (300 units/ml). Genomic DNAs were digested with EcoRI or Spe I (Fig. 1). Southern blots were probed with a 0.7-kb Xba I-Sac I genomic fragment (probe A) external to the targeting construct. EcoRI and Spe I fragments of 6.4 kb and 10.7 kb, respectively, were diagnostic of gene targeting. Blots were reprobed with a 0.35-kb vav cDNA fragment Abbreviations: ES, embryonic stem; EB, embryoid body; RT-PCR,

reverse transcription PCR; GM-CSF, granulocyte/macrophage col-

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

ony-stimulating factor; G-CSF, granulocyte CSF; PGK, phosphoglycerate kinase; HSV-TK, herpes simplex virus thymidine kinase; Epo, erythropoietin; KL, kit ligand. 12755

12756

_a~ . ,

Genetics:

Proc. Natl. Acad. Sci. USA 91 (1994)

Zhang et al.

Dbl- homology

SH3 SH2 SH3

Wild- type

X Sa

0.5 kb

IIIII III 1.

vav cDNA

Sp E E Sp

XE

X

1kb

B _ --_1

E B

I

Fav

v

OK

probe A

'PGK- neo

Bsk-neo-vav

HSV- tk

PGK- hygro E B

B

vav

Mutant vav

X Sa

--

----Not

B

---

Expected size (kb) for vav (neo)

HSV- tk

Bsk- hyg-

_- -

Sp EB

_pI

probe A (genomic)

restriction digest EcoRI

Spel B (cDNA)

wild-type

mutant

4.8

6.4 10.7

18.3

7,2.3 18.3, 2.1

EcoRI

Spel

--

-

PGK- neo B

X

Expected size (kb) for vav (hygro) restriction mutant wild-type digest probe 4.8 5.8 A (genomic) EcoRI B (cDNA) EcoRI 7,2.3

E B

probe A

PGK- hygro

FIG. 1. vav gene targeting constructs. At the top is shown the cDNA with the dbl homology region and SH3-SH2-SH3 domains. Below the vav locus, Bsk-neo-vav and Bsk-hygro-vav plasmids, and the targeted locus are depicted with relevant restriction enzyme sites (X, Xba I; Sa, Sac I; E, EcoRI; S, Spe I; B, BamHI). Restriction fragment sizes for the wild-type and targeted alleles using probes A and B are shown to the right.

(probe B) and with a neomycin gene probe to confirm the targeting event. In Vivo ES Cell Differentiation. Gelatin-adapted ES ceil clones were subjected to one-step and two-step in vitro differentiation assays, as described (14, 15, 23, 24). Erythroid and myeloid cells were identified by inverted light microscopy.

Reverse Transcription PCR (RT-PCR) Analysis. Colonies were obtained by replating day 6-8 EBs in methylcellulose medium containing erythropoietin (Epo) plus kit ligand (KL) for erythroid differentiation or granulocyte/macrophage colony-stimulating factor (GM-CSF) plus granulocyte colonystimulating factor (G-CSF) for myeloid differentiation. Colonies were harvested between days 6 and 7 following replating, and RNA was isolated using the acid/guanidinium/ phenol/chloroform protocol (25). RT-PCR, using Moloney murine leukemia virus reverse transcriptase for preparing first strand cDNA followed by PCR reactions, was performed

A

kb 23-~

9.6-

4.4-

23-

T!9r

each primer pair were empirically determined. Primer pairs for (-actin, PH1-globin, and (3major globin were as described (24). Primers for GATA-1, gp9l-phox, mannose receptor, and PU.1 were as described in refs. 26-29. Primer sets for vav transcript PCR were as follows: vav SH2-1:

GAGAAGAAGGCTTTCCGGGG/CCACCAGCCTTGCTGTCCCTTC (product, 273 bp); vav SH2-2: GGTGCGGCAGAGGGTGAAAG/CCACCAGCCTTGCTGTCCCTTC (product, 382 bp); vav DH-1: GATAAGCGCTGCTGCTGCCTGCGGG/CAGACCGTAGGGTGAAATCGGCC (product, 397 bp); vav DH-2: GGCCGATTTCACCCTACGGTCTG/CTCTGGGTAAATGTTGGAGATGGCC (product, 574 bp). Chimera Analysis. vav-/- clones were injected into C57BL/6J blastocysts to generate the vav-/-/wild-type chimeras (16). Hemoglobin analysis of heparinized whole blood from chimeras was performed as described (30). B

Probe A

Probe B ur

In

Probe A

ES N28 N28N24 S E S E S E

to examine specific mRNAs. Optimal PCR conditions for

N50 N50N8 S E S E

Probe B ES N28 N28N24 S E S E S E

~o oc 0

N50 N5ON8 S E S E

CA

3ZZ

kb

z

9.46.6-

4.4-

2.3-

FIG. 2. Disruption of the vav locus in ES cell clones. (A) ES cell clones targeted with Bsk-neo-vav. Genomic DNAs isolated from wild-type CCE, vav+/- (N28, N50), and vav-/- (N28N24, N50N8) clones were digested with EcoRI (E) or Spe I (S) and hybridized with probe A or B. (B) Targeting with the Bsk-hygr-vav vector. Genomic DNAs isolated from wild-type CCE, vav+/- (N106), and vav-/- (N106H53) cells were digested and probed as in A.

Genetics: Zhang et al. A

CCE

SKO

DKO

1 2 3 1 2 3 1 2 3

B

Proc. Natl. Acad. Sci. USA 91 (1994)

A

CCE SKO _DKO 1 2 3 1 2 3 1 2 3

FIG. 3. Expression of vav RNA transcripts in differentiating ES cells. (A) Expression of RNA transcripts containing the vav 3' SH2 region in wild-type CCE, vav+/- (SKO), and vav-/- (DKO) cells. RT-PCR was performed as described in the text. Lanes 1, ,-actin; lanes 2, vav SH2-1 primers; lanes 3, vav SH2-2 primers. (B) Expression of RNA transcripts containing the dbl-oncogene homology region in wild-type CCE, vav+/- (SKO), and vav-/- (DKO) cells. Lanes 1, ,-actin; lanes 2, vav DH-1 primer set; lanes 3, vav DH-2 primers. RT-PCRs in which no cDNA was added produced no visible products (not shown).

CCE 1

B

2 3 4 1

CCE 1

2 3

SKO DKO 2 3 4 1 2 3 4

DKO

SKO 1

2 3

12757

1

2 3

RESULTS Disruption of the Mouse vav Gene. Inactivation of the vav gene was accomplished with targeting vectors designed to replace a 12-kb region encompassing the SH2 and SH3 domains with a drug-resistance cassette (Fig. 1). In the first round of targeting, heterozygous vav+/- clones were selected after introduction of Bsk-neo-vav. As shown for two representative clones (N28 and N50), Spe I and EcoRI fragments diagnostic of homologous recombination events were observed (Fig. 2A). Of 1440 G418/ganciclovir-resistant clones, 6 contained a disrupted vav allele. Homozygous-mutant ES cells can be generated from heterozygous cells either by selection with increased G418 (21) or by successive gene targeting with a construct bearing a second selectable marker (31). In our experiments vav+/clones were subjected to a second round of targeting with Bsk-hyg-vav. Although selection was imposed with neomycin, ganciclovir, and hygromycin B, two of three vav-/clones (N28N24 and N5ON8) contained only neomycinresistance gene-disrupted vav alleles (Fig. 2A), while one (N106H53) displayed a Southern blot pattern consistent with a targeting event with the Bsk-hyg-vav construct (Fig. 2B). As anticipated, a cDNA fragment containing sequences within the targeted deletion (probe B) failed to hybridize to

A

FiG. 5. Expression of erythroid (A) and myeloid (B) transcripts in wild-type CCE, vav+/- (SKO), and vavF/- (DKO) hematopoietic colonies. (A) Lanes 1, vav SH2-1 primers; lanes 2, GATA-1; lanes 3, (-major globin; lanes 4, fH1-globin. (B) Lanes 1, vav SH2-2 primers; lanes 2, gp9l-phox; lanes 3, macrophage mannose receptor.

vav-/- clones, and no wild-type restriction fragments were retained in vav-/- clones (Fig. 2). Characterization of the Disruption as a Null Mutation. We examined RNA derived from differentiating wild-type, vav+/ , and vavF/- ES cells to determine if stable vav transcripts could be expressed from the targeted allele. RNAs obtained from hematopoietic colonies arising upon replating of day 6 EB cells into methylcellulose were subjected to RT-PCR analysis using primers flanking the SH2 (vav SH21/SH2-2; see Materials and Methods) (Fig. 3A) and dbl donmains (vav DH-1/DH-2) (Fig. 3B). vav transcripts were detected in RNAs of wild-type and vav+/- origins but not from vav-/- samples. Since RNA transcripts including the dbl region, which lies upstream of the deleted SH2-SH3 region, were not detected, we conclude that the vav-/- cells are null for vav expression. In Vitro Hematopoietic Differentiation of vav-/- ES Cells. Hematopoietic development of all three vav-/- ES cell

B

M

FIG. 4. Hematopoietic differentiation of vav-/- ES cells. (A) Appearance of typical definitive erythroid colony upon replating of day 6 EB cells into methylcellulose containing Epo and KL. (B) Cytocentrifuge analysis of myelo-erythroid colony. M, macrophage; E, erythroid precursor. (Original magnification: A, x200; B, x400; here shown: A, x170; B, x340.)

12758

Proc. Natl. Acad. Sci. USA 91 (1994)

Genetics: Zhang et al. 1

2

vav-chimeras

Hbbd

Hbbs

FIG. 6. Contribution of vavF/- ES cells to mature erythroid cells in adult chimeras. Blood samples were analyzed as in ref. 30. Lane 1, C57BL/6J; lane 2, control C57BL/6J/wild-type CCE chimera. Results for two chimeras generated with vav-/- cells are shown to the right.

clones was assessed in one-step and two-step in vitro differentiation assays (14, 15). In these assays vav-/- ES cells behaved similarly to vav+/- and wild-type cells. Normalappearing definitive erythroid colonies were formed upon replating of EB cells into methylcellulose containing Epo and KL (Fig. 4A). In the presence of GM-CSF and G-CSF, myeloid and mixed myeloerythroid colonies were formed (Fig. 4B). To confirm erythroid maturation, pooled erythroid colonies from the two-step differentiation assay were examined by RT-PCR for expression of embryonic globin (3H1), adult globin ((-major), and GATA-1 transcripts. As shown in Fig. SA, expression of all RNAs was detected in vav-/- colonies. As molecular markers for the myeloid lineage, we examined transcripts of the gp9l-phox and mannose receptor genes, whose expression is restricted to myelomonocytic cells (27, 28). Both were expressed in differentiated vav-/- cells (Fig. 5B). Moreover, transcripts for the myeloid and B-lymphoid cell-restricted transcription factor PU.1 (29) were also expressed (not shown). Hematopoietic Development of Chimeras Generated by vav-/- ES Cells. ES cells of two clones (N28N24 and N106H53) were injected into C57BL/6J blastocysts to generate vav-/-/wild-type chimeras. The hemoglobin composition of chimeras with coat color chimerism of 30% or greater was determined. Hemoglobin Hbbd is a marker of CCE (strain 129)-derived red cells, whereas Hbbs is produced by strain C57BL/6J (16). Five of five chimeras that were examined expressed CCE-derived Hbbd. Results for two of these are shown in Fig. 6. Thus, vav-/- ES cells contribute to mature red cells in vivo. Moreover, by Southern blot analysis we have shown that vav-/- cells also contribute to mast cells and macrophages cultured from the bone marrow of additional chimeras (not shown).

DISCUSSION We have employed a genetic approach to ascertain whether the product of the vav protooncogene is essential for hematopoiesis. The presence of SH2/SH3 domains and a region homologous to the dbl oncogene, together with its restricted pattern of expression, have suggested that vav may serve important functions in signaling pathways in hematopoietic cells (2-6). The findings of Wulf et al. (17) have been interpreted as evidence for a central role for vav in blood cell development. In our experiments we disrupted the vav gene in ES cells by gene targeting (32) and generated vav-/- cells by two steps of selection in culture. Critical to the interpretation of the results presented here is the demonstration that vav-/w ES cells express no stable vav RNA that might encode an active, or partially active, protein (Fig. 3). Development of erythroid and myeloid cells in vitro and in vivo from vav-null ES cells argues strongly that vav is not strictly required for hematopoiesis. Our results cannot be readily reconciled with

the antisense experiments of Wulf et al. (17). We infer that either culture conditions during the selection of ES clones stably expressing vav antisense RNA inadvertently impaired hematopoietic developmental potential independent of vav expression or antisense vav RNA per chance inhibited expression of an unknown transcript required for normal hematopoiesis. Our findings underscore the relative precision of loss of function mutations generated by gene targeting as contrasted with antisense RNA inhibition. The observation that vav is not required for hematopoietic cell development does not exclude this protein as an important mediator of signaling pathways, particularly in cells of specific lineages. For example, our data do not rule out a circumscribed role for vav in c-kit responsiveness of either erythroid or mast cell precursors. Alternatively, vav may be involved in signaling in erythroid or myeloid cells, but other proteins might compensate for its absence. In the studies reported here a role for vav in lymphoid cell development has not been addressed. Indeed, as will be reported elsewhere (R.Z., F. W. Alt, L. Davidson, S.H.O., and W. Swat, to be published elsewhere), vav-/- T and B lymphocytes are impaired in their responsiveness to specific stimuli, consistent with its proposed involvement in receptormediated signaling pathways. Note Added In Proof. Hematopoiesis from vav-null ES cells has also been observed independently by Zmuidzinas et al. (33). We thank Ms. Sabra Goff for excellent assistance in isolating vav phage clones. S.H.O. is an Investigator of the Howard Hughes Medical Institute. 1. Katzav, S., Martin-Zanca, D. & Barbacid, M. (1989) EMBO J. 8, 2283-2290. 2. Katzav, S. (1992) Br. J. Haematol. 81, 141-144. 3. Adams, J. M., Houston, H., Allen, J., Lints, T. & Harvey, R. (1992) Oncogene 7, 611-618. 4. Boguski, M. S., Balroch, A., Attwood, T. K. & Michaels,

G. S. (1992) Nature (London) 358, 113.

5. Bustelo, X. R., Ledbetter, J. A. & Barbacid, M. (1992) Nature

(London) 356, 68-71.

6. Margolis, B., Hu, P., Katzav, S., Li, W., Oliver, J. M., Ullrich, A., Weiss, A. & Schlessinger, J. (1992) Nature (London) 356,

71-74. 7. Bustelo, X. R. & Barbacid, M. (1992) Science 256, 1196-1199. 8. Evans, G. A., Howard, 0. M. Z., Erwin, R. & Farrar, W. L. (1993) Biochem. J. 294, 339-342. 9. Alai, M., Mui, A. L.-F., Cutler, R. L., Bustelo, X. R., Barbacid, M. & Krystal, G. (1992) J. Biol. Chem. 267, 18021-18025. 10. Gulbins, E., Coggeshall, K. M., Baier, G., Katzav, S., Burn, P. & Altman, A. (1993) Science 260, 822-825. 11. Bustelo, X. R., Suen, K.-L., Leftheris, K., Meyers, C. A. & Barbacid, M. (1994) Oncogene 9, 2405-2413. 12. Burkert, U., von Ruden, R. T. & Wagner, E. F. (1991) New Biol. 3, 698-708. 13. Schmitt, R. M., Bruyns, E. & Snodgrass, H. R. (1991) Genes Dev. 5, 728-740. 14. Wiles, M. V. & Keller, G. (1991) Development (Cambridge, U.K.) 111, 259-267. 15. Keller, G., Kennedy, M., Papayannopoulou, T. & Wiles, M. V. (1993) Mol. Cell. Biol. 13, 473-486. 16. Pevny, L., Simon, M. C., Robertson, E., Klein, W. H., Tsai, S.-F., D'Agati, V., Orkin, S. H. & Costantini, F. (1991) Nature (London) 349, 257-260. 17. Wulf, G. M., Adra, C. N. & Lim, B. (1993) EMBO J. 12, 5065-5074. 18. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Lab. Press, Plainview, NY), 2nd Ed. 19. Tybulewicz, V. L. J., Crawford, C. E., Jackson, P. K., Bronson, R. T. & Mulligan, R. C. (1991) Cell 65, 1153-1163. 20. Mansour, S. L., Thomas, K. R. & Capecchi, M. R. (1988) Nature (London) 336, 348-352. 21. Mortensen, R. M., Conner, D. A., Chao, S., Geisterfer-Low-

Proc. Natl. Acad. Sci. USA 91 (1994)

Genetics: Zhang et al.

22. 23. 24. 25.

26. 27.

rance, A. A. T. & Seidman, J. G. (1992) Mol. Cell. Biol. 12, 2391-2395. Robertson, E., Bradley, A., Kuehn, M. & Evans, M. (1986) Nature (London) 323, 445-448. Simon, M. C., Pevny, L., Wiles, M. V., Keller, G., Costantini, F. & Orkin, S. H. (1992) Nat. Genet. 1, 92-98. Weiss, M. J., Keller, G. & Orkin, S. H. (1994) Genes Dev. 8, 1184-1197. Chomczynski, P. & Sacchi, N. (1987) Anal. Biochem. 162, 156-159. McClanahan, T., Dalrymple, S., Barkett, M. & Lee, F. (1993) Blood 81, 2903-2915. Royer-Pokora, B., Kunkel, L. M., Monaco, A. P., Goff, S. C.,

28.

29. 30. 31.

32. 33.

12759

Newburger, P. E., Baehner, R. L., Cole, F. S., Curnutte, J. T. & Orkin, S. H. (1986) Nature (London) 322, 32-38. Harris, N., Super, M., Rits, M., Chang, G. & Ezekowitz, R. A. B. (1992) Blood 80, 2363-2373. Klemsz, M. J., McKercher, S. R., Celada, A., Van Beveren, C. & Maki, R. A. (1990) Cell 61, 113-124. Whitney, J. B. (1978) Biochem. Genet. 16, 667-672. Riele, H. T., Maandag, E. R., Clarke, A., Hooper, M. & Berns, A. (1990) Nature (London) 348, 649-651. Capecchi, M. R. (1989) Science 244, 1288-1292. Zmuidzinas, A., Fischer, K.-D., Lira, S. A., Forrester, L., Bryant, S., Bernstein, A. & Barbacid, M. (1994) EMBO J., in press.